AliNovel

Font: Big Medium Small
Dark Eye-protection
AliNovel > Chains of a Time Loop > 11 - Teleportation Lessons

11 - Teleportation Lessons

    It always rained the night before. As a mage, it was pretty easy to deflect it, but Myra usually didn’t bother. For her, it was good enough to know that she could keep herself dry if she wanted to. Thus, she was a little damp when she entered the dormitory to find Aurora. The senior girl still hadn’t contacted her since they’d last spoken, and now they were cutting it awfully close.


    “Come in.”


    “Hey.” Myra entered Aurora’s room. She was half-sitting, half-lying on her bed.


    “Oh, it’s you.” She stretched her arm out, directing a knife straight at Myra’s eye. “Sky was just lookin’ for ya. I told him where your dorm was.”


    “Thanks, I’ll try to find him.” Myra sidled away from her outstretched blade. “Do you have time to talk about the Mirkas-Ballam security?”


    “Guess so. What do you wanna know, again?”


    “I’m trying to figure out how someone would hypothetically break into their top-secret laboratories.”


    “Hypothetically.”


    “Yeah.”


    “So what do you know about it?”


    “Well, the main building’s got a barrier around it. We were given authorization to enter by signing the guest sheet.”


    “Signing? Like, cryptographically?”


    “Yeah.”


    Aurora was referring to a certain cursive runic typeface specialized for unforgeable signatures. A name written in this form mapped to a cryptographic key, so a paper would light on fire (or worse) if someone tried to sign a name that wasn’t theirs.


    “All of you?”


    “No, just our host, in order to authorize us. I signed it normally. I presume most guests without mage training wouldn’t know how.”


    “I see. So you either need to subvert the barrier or subvert the guest sheet.” She sounded kind of bored.


    “I don’t think I’m going to be breaking cryptography any time soon. Hypothetically.”


    She snorted.


    “What?”


    “You don’t need to break cryptography to subvert the guest sheet. Not in the sense of developing revolutionary mathematics or anything. Whatd’ya know about crypto?”


    “Almost nothing.”


    “Oh, I thought it’d be up your alley. You’re the rune girl, ain’t ya? You should take Alzergodin’s class.”


    “Alzergodin doesn’t like me very much.”


    “So?”


    “So, uh, nothing, I guess. You’re right, I should take her class.”


    “Anyway, the number one lesson she’ll teach you is that cryptography is pointless if you don’t use it correctly. This guest sheet sounds like a prime example. It’s pure security theater. You already told me why.”


    “I did?”


    “Your host signed you in, securely. But you, a guest, signed yourself in normally. You can’t forge a signature to authenticate yourself. But you can…” She trailed off, waiting for Myra to finish.


    “I could… impersonate a different guest who is authorized?”


    “Yep.”


    “Okay… that doesn’t really help, though. I mean, I can already get authorized as a guest. This wouldn’t help me break in at night or anything. Hypothetically.”


    “Okay. You could have said that to begin with.” She kind of scowled. “I guess you have to teleport past the barrier, then.”


    “You can do that?”


    “Sure, it’s just a barrier. High-end barriers are designed to block as much stuff as possible, physical stuff, aura, abstract objects, but you can’t block everything, that would take an infinite amount of aura. There’s always a way around them. Your bigger problem would be the teleportation disruption field. I’m just assuming they have one. They’re pretty standard. And a corporate security system probably has a really strong one, not like the cheap ones in our dorms.”


    “But how do you do that? Like… to teleport, you need a tether, so the tether has to get past the barrier, but most barriers block aura completely.”


    She scowled again. What’s her problem today? “Like I said, nothing blocks aura completely. And most barriers are limited in the number of attacks they can fend off at once, so they’re vulnerable to multi-pronged attacks. Sorry, I don’t know much about the actual practice here.”


    “There’s another thing…” Myra asked, despite her trepidation. “On the inside of the building, there are a bunch of doors that are blocked off with yarn tied in complex knots. Do you know what’s up those?”


    “I ain’t got a fucking clue.”


    “What about the disruption fields? Any idea on that?”


    “The corporate ones or the cheap dorm ones? The cheap dorm ones are mostly organic particles in the air. They’re usually made from plants that emanate domains. There are a million ways to get rid of ‘em. The corporate ones defend against all those million ways. Again, I don’t know how to do it, or anything.”


    “Thanks, I appreciate it. Also, um—” Do I really want to ask? “—is everything all right? You seem kind of put off today.”


    Aurora sighed, pushed herself so she was sitting straight, and turned to look at Myra. She rubbed one of her eyes. “I’m sorry. I’m not put off at you. It’s just… family stuff. I really am curious about that yarn security thing, just to be clear. But I’ve never heard of it before. Maybe you should look into knot theory.”


    “I see…” Myra wanted to ask Aurora if she could ask her family about the yarn thing, but now that would be extremely insensitive. “Is there anything I can do to help?”


    “What, with my family? Hell, no. You don’t wanna get involved in their shit. It’s really nothing big, anyway. They just have a tendency to go off on...” She tapped her foot against the lower edge of her bed frame. “On business unexpectedly.”


    The Blank Cloaks on unexpected business?


    The Blank Cloaks, the assassin clan famous for their impossible murders, on unexpected business. At the end of the loop.


    Huh…


    “When did they set off?”


    Aurora looked at her a little suspiciously. “I dunno. I last heard from ‘em last week. They don’t really keep me informed, that’s what pisses me off.” As she continued to tap at the base of her bed, she seemed to consider something about her knife, then hopped down to pull something out of the drawer she’d just been tapping. She pulled out a thin, shiny disc. “I’ll just try to call them one day, and find out they’re gone, no indication when they’ll be back…” She ran the disc along the edge of her knife, making a terrible, cacophonous screech.


    “Hey, uh, what is that, exactly?”


    “Oh, sorry, I kind of sharpen knives as a tic. Sorry, it’s kind of loud—Hey!”


    Myra grabbed the disc from her without thinking, her heart racing and her body moving on impulse. “This is—”


    It was a diamond disc, all right. It looked a lot like the one they’d found in the event hall, shiny and rough. But…


    It wasn’t the same one. This one had more indentations, and it was also a lot larger than the one in the event hall.


    “Do you have any more of these?”


    “Uh, no. You want one?”


    Myra handed the disc back. “No, sorry.” Right, it doesn’t make any sense for Aurora to be involved. Not with all the help she gave us.


    And it’s not weird that she has a knife sharpener. It would be weirder if she didn’t have one, really.


    “Ya all right?”


    “Yeah, yeah.”


    The girl continued to look at her oddly until they were thankfully interrupted by a man entering the room without knocking, startling Myra. He was short, and he was dressed in a casual business outfit, with thick, rectangular glasses. He was a little damp from the rain. He was surprised to see someone who wasn’t Aurora.


    “Pardon me, am I interrupting?” Myra recognized his voice instantly.


    “Sky Mishram?” Myra asked.


    “Oh! You must be Myrabelle. I was just looking for you.” In person, his deep voice came off much softer than it had over the phone. It was calming and melodic. Oddly, he looked vaguely familiar, too.


    “Why the hell are you soaked?” Aurora demanded, suddenly a lot more chipper with Sky present. “Both of you! I know you can repel water. It’s the first thing I learned to do with the water elemental when I was a snot-nosed teenager.”


    “Are you a mage, Sky?” Myra asked.


    “I have basic training,” he explained. “I did learn how to manipulate water as part of a basic safety course. Personally, it gives me peace of mind to know that I could repel the rain if it rained hard enough to bother me, but otherwise, I don’t bother.”


    Myra nodded along. “Knowing that you can is enough.”


    “She gets it.” He held out his hand for a fist bump.


    “What the fuck are you all talking about…”


    “I should thank you again for your tip, Myra.” Sky adjusted his glasses. “The Halnya Times has stayed on top of our reporting for these peace talks, and it’s all thanks to your tip.”


    “I’m glad. Did you, uh, have any information for me?”


    He thrust a manilla folder at Myra. “This is the information on the participants you asked me to compile. And this is the police record for the crater death. You’re gonna want to look at this one.”


    “Oh?” She flipped the folder open. Aurora, curious, moved where she could see it as well. There were some (grotesque) pictures of the original scene, and there was a sketch “reconstruction” of his face by the forensics team. He was an old, balding man with sideburns and a flat nose. There was a copy of his ID card, which was apparently fake. The ID card read, “John Smith.”


    The next page was a report on his DNA sequence.


    TAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAGTAG…


    “This is… all ‘stop’ codons?” She read the report summary. “He doesn’t have a real DNA sequence? What the hell, is he a—homunculus or something?”


    “I’ve heard of magic that lets you obscure your DNA,” Aurora said.


    “Really? It’s the first I’ve heard of it,” Sky said. “The police were baffled.”


    “It’s pretty obscure, I guess,” Aurora said.


    “The evidence is really stacking up that this guy was up to no good,” Myra concluded. “It doesn’t explain how he died, though.”


    “No, I’m afraid it doesn’t.”


    “God,” Myra said, continuing to flip through. “They still don’t know what the projectile was?”


    “I told you,” Aurora said, a tinge of playful snark creeping into her voice. “It must have been an ice cube.”


    ◆


    It seemed Sky and Aurora were looking to catch up, so after Myra finished her business, she made herself scarce.


    She caught up with Shera (who had been busy sneaking lava out of the training room building) to flip through the new documents. Myra was trying to memorize everything important, and Shera was just looking for anything odd that caught her eye. If nothing else, they finally had the names of the attendees from the Unkmire faction.


    “I’ve been puzzling over the crater murder,” Shera said. “I really feel like the tree’s got to be important.”


    “Those trees are all over the city. It could be a coincidence.”


    “Something was weird about the projectile. It was probably enchanted. So the fact that it passed by the tree has to be important.”


    “I don’t know,” Myra said. “The projectile could have just been a rock from the park or something. That’s why they didn’t find any ‘unusual sediment composition’ or whatever.”


    “Well, I think the culprit needed to break the enchantment on the projectile right before impact.”


    “Then they could have used the victim’s domain—oh.”


    “Not necessarily. We don’t know if they were even a mage. They might not have had their domain activated.” That seemed incredibly unlikely to Myra. Most adults activated theirs as a matter of basic safety, even if they had zero additional mage training. “And I already told you, the billowing elm tree is less selective about it.”


    “Right. If breaking the enchantment would endanger the victim’s life, then his domain wouldn’t break the enchantment. So what, should we conclude that he wasn’t in any danger without the enchantment breaking? I mean, that would explain why the crime could only take place in the park…”


    If you come across this story on Amazon, it''s taken without permission from the author. Report it.


    “Yeah.”


    “So how do you… instantaneously accelerate an object to multiple kilometers per second by breaking an enchantment? Is there a stillness enchantment or something that can bank momentum?”


    “There is. So if you accelerate the projectile, still-ify it, then move it near the tree, the stillness will wear off, and it will accelerate down. It ought to have the impact we observe.”


    Myra massaged her temple. “This is so dumb. Why not just attack him with a normal fireball or something? I’m really skeptical this is the right track, sorry.”


    That’s the question, isn’t it? Why not use a fireball or some normal murder method?


    What were they trying to accomplish?


    ◆


    They continued looking through the paperwork in silence for a while. As they were finishing up, though, Shera broached another subject.


    “Th-there’s something else I wanted to ask you.”


    “Yeah?”


    “I don’t know if this is something I’ve brought up in past loops. I don’t want to bother you by bringing up the same thing over and over…”


    “You shouldn’t worry about that,” Myra assured her.


    “Shouldn’t I? Anything I do to inconvenience you is something you’ll have to deal with N times, while I’m going to forget about it. It w-would add up.”


    “Shera.” She put a hand on her shoulder. “Please tell me what’s on your mind.”


    “Are you looking for a w-way to bring me into the loop?”


    “Of course, I am.” She reached out for Shera’s hand to reassure her.” If I ever make any headway on whatever the hell’s going on, that’s one of the first things I’ll try to do.”


    “Oh. Have I asked it before?”


    “Yeah, you have.”


    “I see.”


    Myra moved her hand, but the girl flinched. She’s still beating around the bush. Whatever she wanted to say, she was taking her time to say it. Myra waited patiently.


    “W-why didn’t you go to Jewel City?” she finally asked.


    “You mean, to investigate the sage’s death?”


    “I-I mean, he d-dies the instant the loop starts. He could be the biggest clue to the w-way th-the loop works, right? B-but you d-did this a-apprenticeship thing instead…”


    “Are you… saying I wasted my time this loop?” Sure, I didn’t learn very much from Professor Bandine, but we still got a lot done…


    She flinched. “S-sorry. I shouldn’t have brought it up.”


    “No, it’s fine. I’m glad you did. I wish you’d brought it up earlier. I had no idea you wanted to go. I didn’t want to ask you to just up and go to another country with me, so I put it off, and then after I got in touch with Sky, it seemed less important…”


    She looked confused. “You thought I wouldn’t want to go?”


    “Well, in the last loop, you seemed really skeptical and just wanted to nitpick about all these timing measurements… I mean, you were really helpful overall!” Myra hastily added. “It just took a while before you really bought in. I was kind of taken aback this time when you actively wanted to know more about what was going on!”


    She shifted uncomfortably. “I s-see. You’re working with all these assumptions about me that I don’t remember. You were really happy about the timing measurements at the beginning of the loop, and I was so happy that I had helped you find a lead. But you really do find me really nitpicky and… and annoying.”


    “No, no, no, no, no, no, no! That’s not what I mean! I told you, you were right, all that stuff was important!”


    “So if it hadn’t b-been important in the end, you would have just found my p-perspective annoying. I should have thought it w-was all too good to be true.”


    Fuck, why did I open my big mouth on that?


    “Shera, I don’t find you annoying,” Myra tried to say with a degree of finality. The girl didn’t say anything. “Look, I know we didn’t get along that much before this month. I consider you a cherished friend now, even if it’s for reasons you don’t entirely remember. My gratitude on the first day of the loop, those were my honest feelings, I promise.”


    “What will your honest feelings be at the beginning of the next loop?”


    “That I want to take you on an adventure in Jewel City to find out what Emmett Massiel has to do with this goddamn loop.”


    Her face turned bright red. “O-okay.”


    “And just in case it needs to be said… I do value your timing measurements and the huge lead we got from them.”


    “Th-thanks.”


    In the end, Shera seemed reassured, and she seemed confident that she would agree to go to Jewel City if Myra acted the same way she had this loop. But…


    But it was evident that the baggage from two years of heated friction between the two girls didn’t exactly evaporate in an instant. Worse, Myra was concerned about the girl’s apparent desire to not inconvenience her. Is she still putting up a front?


    ◆


    Regardless, it didn’t seem to be an issue the next day.


    At around 7pm on the last day, the Mixopolium was overflowing onto the street. The occasion was pretty clear: the Mirkas-Ballam alchemists had finished their drug, completed their contract, and made infinite money.


    They were also too drunk out of their minds for Myra to learn anything useful. Loose lips wasn’t the issue. The issue was that they had just gotten off from three ninety-hour work weeks, and they had no desire to talk about their job. To make things even harder, at least a couple of people even seemed to recognize Myra on sight and did their best to stay away from her.


    Anyway, the company’s success meant the odds were good that Ben could attack any moment, so she needed to keep her guard up. Myra was tempted to skip out on the party completely just to minimize his ability to locate her, but she figured it was unlikely he would attack with so many people around, and she really wanted to see Violet again. She headed to the party early with Shera.


    Her friends hadn’t arrived yet, so the first person she made eye contact with was Aurora Ferara who was there with Sky. Suddenly, it clicked in Myra’s head where she’d seen the man before. He was always here with Aurora, every loop.


    That made enough sense. Even without Myra’s tip, he had reason to show up here for the reporting.


    “Hey, girls,” Aurora waved.


    They quickly introduced themselves—Shera had yet to meet Sky—and then made small talk about all the events. Sky had spent all week trying to wrangle interviews with everyone involved in the peace talk. He had mostly failed, so he ended up chatting with people on the periphery. It sounded like he had gotten plenty of information out of the servants and other peripheral individuals, including the princess’s maidservant.


    The party started to take form. Myra’s friends eventually arrived, and they started talking strategy for couch wars. She once again thought about going rock climbing, but she had too many nerves. She asked Shera if she wanted to do anything, but the girl just stammered out that she’d do whatever Myra did. They got involved in the game of water ball for a bit, though they were both dreadful at it.


    Eventually, the noise of the party began to quiet down in a very familiar way.


    They’re here.


    The three of them, the princess, Violet, and the maidservant walked through the crowd. Myra waved to catch Violet’s attention—


    “Hey, I know you,” the princess said.


    Goosebumps tingled on her neck, and Myra felt a spike of unease.


    “Yeah, I’m sure. You’re that genius commoner. You won that contest.”


    “Oh—”


    “What’s your name again?”


    “Isadora, your highness.”


    “Isadora! That’s right.” She snapped her fingers.


    Iz turned her gaze towards Violet. “I see my request has been granted.” That was… new. It took Myra a second to remember what she was talking about.


    “They have so many enemies because they hurt so many people.”


    “Hmph. Well, they’re certainly controversial. Maybe you should tell it to their faces.”


    “Maybe I will. Would you introduce me?”


    “No.”


    Violet smirked.


    The princess looked confused. “What request?”


    “My request to speak my mind to you,” Iz said.


    “Oh? You got a beef with me?” She balled her fist and popped her joints, seeming excited about the idea. “How about we have a go? Beat me, and you can say whatever you want to me.”


    “A duel? I’m not really a duelist…”


    “Come on!” She teleported out of her dress and into her sports gear like usual. “Hell, beat me, you can have anything you want. I won’t even ask you to put anything on the line in return. Pretty good deal, eh? Seriously, what d’you want to fight for? A mansion? A job? Just, like, money? A husband?” Iz took a step forward. “Oh? Really? A hus—”


    “Your pendant.”


    It’s the same, it’s all the same.


    Violet, do something!


    Myra pleadingly tried to catch her eye to no avail. The green-haired woman looked on impassively.


    “What, you want a bloodstone? I could getcha—”


    “No, I want your pendant.”


    “That’s a really fucking personal thing to demand.”


    “You said I could name whatever I want.”


    And on and on it went.


    And when it came time to start the duel—


    “Vi, you’re officiating.” She tossed the pendant to Violet, who got into her position the way she always did, no hesitation or doubt on her face.


    As Iz started to leave her side, Myra frantically hissed in her ear. “Cheat! Get her with the marbles before the match starts!”


    Iz looked stunned at Myra’s sudden advice, then dashed to her position in the princess’s makeshift dueling ring. Please cheat…


    “All right! We are gathered for the duel between Isadora and Princess Malazhonerra Emerald Raine. At stake by Princess Malazhonerra is her honor, and her mother’s bloodstone pendant. At stake by Isadora is her honor. We shall use the Prerarian Code of Duels.”


    Oh, good. I can feel Iz moving the lava already.


    “Are there any objections to the terms?”


    “I have no objections,” said the princess, popping her knuckles.


    “I have no objections,” said Iz.


    But she’s not fast enough—


    “Then let us enjoy a fair fight, and may the best mage win. 3… 2… 1… Begin.”


    The lava marble accelerated at the same time, but it wasn’t nearly enough. Iz wasn’t underhanded enough. Fuck—


    Iz stumbled backward, splattering blood everywhere in an all-too-familiar sight.


    Fuck, fuck, fuck—


    “And Princess Malazhonerra is victorious!”


    Myra’s feet carried her into the ring before she knew what she was doing. All she knew was that she was pissed. This was the fourth time she’d seen this happen, but it hit her harder than it had even the first.


    “You piece of shit! Fuck you! I challenge you to a rematch!”


    “Who are you talking to?” the princess asked in bafflement. Myra realized that she had pointed her confrontation somewhere in the middle of both of them.


    “Either of you.” She leveled her eyes at Violet, who still refused to make eye contact. “Vi. I want to duel Vi.”


    “Like hell you are!” The princess held her arm in front of her friend. “Lay a fucking finger on her and you’ll be drinking through a tube the rest of your life. If you’re going to duel anybody, it’s going to be me.”


    “Mala,” Violet said. “C’mon, we should go. This already spiraled out of control. If you win again, it’ll just make it all worse. We should leave it here.”


    “... All right.”


    “What, you’re going to say that like this isn’t 100% your fault? As if you all are somehow being forced into escalating the situation? No, fuck both of you.”


    “Fine. Have it your way. Vi, adjudicate again.” She stepped back into the ring.


    Myra gaped. I… I didn’t actually expect that to work.


    They didn’t agree the first time!


    That’s right, I wasn’t nearly as forceful that time…


    Shaking, Myra took her place in the ring.


    “We are gathered for the duel between Myrabelle Prua-Kent and Princess Malazhonerra Emerald Raine. At stake on both sides is your honor. We shall use the Prerarian Code of Duels. Are there any objections to the terms?”


    “I have no objections.”


    “I-I have n-no objections,” Myra said. Oh god, she’s going to cut my stomach up, isn’t she? Myra moved the lava marbles into position, but it was taking her too long. Oh god, I’m going to flub this the same way as Iz.


    “Then let us enjoy a fair fight, and may the best mage win. 3… 2… 1… Begin.”


    Myra threw up her barriers at around ‘1.’ It was definitely illegal, but nobody called her on it. When the battle properly began, the princess started with lightning, which was good, because it was what she had seen him do against Ben. Myra had spent a lot of time practicing her barriers, now, so she was pretty sure she could hold up.


    When she didn’t immediately get cut up, she went forward with a plan based roughly around what she’d seen Ben do, which was pretty well suited to her own repertoire of dueling spells. She superheated the air around her, making sure the heat wouldn’t escape where the princess would feel it, and then produced a gust of wind that knocked out the princess’s legs. She teleported directly behind Myra and was shocked by the unexpected heat.


    The princess yelped and stepped out of the ring, except she adjusted the border as she did so. Yup, same as last time.


    But this time, she’s in for another superheated surprise.


    Streaks of vivid orange sailed through the sky, the marbles coming to her rescue. Unfortunately, the result of everything that happened was that the princess was on the other side now, turned around, so she could see the marbles approaching from the side of the courtyard. Myra turned to face her, putting her own back to the marbles.


    With luck, the princess wouldn’t recognize them for what they were. Most people didn’t expect to be ambushed by lava marbles. She would reach out, try to redirect them, and have her psychic aura terminals burnt halfway to hell—


    An image flashed through her mind, an image of the princess dismembered and beheaded. Guilt and deep shame at her own sadism churned in Myra’s stomach. She lost her focus and was caught off guard by a sweep of wind against the back of her legs, same as she’d done to the princess a moment ago. There were gasps from the crowd suddenly, but she didn’t pay them any mind. She couldn’t lose her focus on the most important thing, her aim. The marbles flew overhead, and—


    What—


    Where are they? Where did they go? What the fu—


    Just as the instructor had taught her, she was manipulating the lava marbles via a layer of indirection using the vacuum element, not touching them directly even in auraspace. So when they were stolen from her, when she was all turned around the other way, she didn’t notice. How!? How did she—


    Then there was pain. She screamed, and she resisted every urge to strike out with her telekinesis and hurt herself even more. For a moment, it was like she was dying in the volcano again.


    She wasn’t dying in a volcano. One of the marbles had brushed her leg. It was a marble that was over 1000 °C, admittedly. Maybe it hadn’t even touched her, Myra wasn’t sure. But it had fucked up the front of her left calf. An announcement of the duel’s outcome vaguely made its way through her auditory cortex, but it was drowned out by the pain.


    As the princess passed her, she spat on her face. “That’s what you deserve for targeting my Violet,” she snarled.


    “I didn’t—”


    The princess didn’t listen. She was already walking away.


    Myra tried to get up. Despite her leg, she was hindered more from the emotional battering than anything else. She swiped the spit off her face. Disgusting.


    “Are you all right?” The first one by her side was Zirphilia of all people. Where’s Shera?


    “No. Where are—ow.”


    “Cynthia and your other friends took Isadora to the infirmary.” She helped Myra stand to her feet. “Can you stand—?”


    “Y-yeah. It’s—my leg’s pretty fucked, but I can stand.”


    “You need to get to the infirmary, too.”


    Shera finally joined. “A-a-are y-you all right?” she asked redundantly.


    “What happened? With the lava—”


    “I just got them,” Shera assured her. Oh, that’s what she was doing.


    “No, during the match. I had them behind me, then they were gone—”


    “They just vanished mid-flight. I think she teleported them out and took control.”


    How did she do that without burning herself? Damn, there’s so much basic shit I don’t know…


    Shera had a question of her own. “W-why did she nearly run out of the r-ring?”


    “Oh, I superheated the air. It was contained, so she wouldn’t feel it until she teleported behind me. Ben did the same thing.” I think? Wait, I couldn’t have felt it at the time, right?


    Her memory was a bit jumbled up, but that wasn’t important now.


    Myra took some deep breaths and centered herself. More people were crowding around, and she had to field a few more questions about the match. Aurora and Sky came to offer their support.


    Finally, though, Zirphilia had enough of Myra’s detached question-answering. “You should get to the infirmary,” she said again.


    “I-I-I’ll t-take her.”


    “I’ll come, too,” Zirphilia said.


    “I’ll come.” Aurora offered.


    “Sorry, I—I actually want to be alone with Shera right now.”


    Shera nodded. “Right.” She helped Myra escape the crowd. Myra, of course, wasn’t going to the infirmary.


    Fuck this. I’m finding Violet.


    She ran—decidedly not in the direction of the infirmary. Zirphilia called after her, confused, and Myra was sure she heard Shera following. She nearly ran into a passerby, a large man in a wool cloak. Sort of an odd way to dress for this weather, but Myra barely paid it any attention.


    Her leg wailed in pain as she ran through campus, but her injury didn’t stop her. She followed the path she remembered the group had taken just a couple of loops ago, and she found the spot where the three of them had stopped to talk. Malazhonerra and her maidservant were gone, leaving just Violet Penrilla. She was standing by herself, looking deep in thought.


    “Violet!”


    The young woman looked up in surprise. She bit her lip.


    “How—why? Why didn’t you do anything? After we—”


    Myra felt the air shift, and Violet was gone.


    “—befriended you, and—fuck you! Fuck you, Violet!” Her voice turned to a scream as she realized what happened, and she kicked at the building just behind the spot Violet had been standing. “Fuck you! Aughh!”


    There were footsteps behind her. Shera had caught up with her. “D-did you catch them?” She panted, nearly out of breath. “I thought I saw her—”


    “No. She’s gone. She didn’t want to talk.”
『Add To Library for easy reading』
Popular recommendations
Shadow Slave Beyond the Divorce My Substitute CEO Bride Disregard Fantasy, Acquire Currency The Untouchable Ex-Wife Mirrored Soul