《M-chan Wars: Rise and Fall of the Cat Tyrant》


 Historical Log: A path to the Moon

    Many years ago, humanity created the Internet.


    A network with the purpose of sending information at a faster speed than the other methods of message passing at that time.


    As time went by, the technology behind it advanced quickly. From analog circuits to digital fibre lines, the speed at which information travelled went faster and faster.


    Then, a great war happened. It was like none ever before. Long before bullets flew or even nightmares of orbital strikes, a fierce war raged over the Internet.


    Networks went down everywhere. Even the smallest ones had their part as complex viruses attempted to invade national security networks.


    Physical attacks were used by spies to shut down remote terminals, leaving no computer devices unchecked.


    Finally, the warheads flew. Powered by energy sources that were much more lasting than any publicly known source, they flew around the world for two whole nights.


    Leaving no sky unlit by the flames of their thrusters, no fighter jets could readily take them down as they flew over countries without fear of enemy retaliation or scorching their homelands with the toxic material within.


    On third night, a terrorist faction succeeds in their hacking attempt, only to send the warheads plunging down into the Earth.


    Billions perished, and the surface of the Earth as we knew it was wiped clean of humanity.


    However, not all humans died. Those who had access to deep underground shelters hid while those who were in space stopped their conflict there as they watched their once blue world glowing red for years more to come.


    Those who survived thought it was all over. Or at least most of them did.


    As the underground faction and the space faction had no means to communicate, they acted independently.


    Those underground came under the rule of a single government, linking up with the underground network that was extensively built over the years.


    Those in space split into two groups. The first stayed in space stations and the city on the moon. The second chose to explore further into space, hoping to find another planet to live on.


    Like did anyone expect, an elaborate plot was still in the works.


    Those who had chosen to explore into deeper space were on a vessel that was doomed never to return, and the majority who remained on the space station were all part of the plan for world dominance.


    Skillfully hidden technologies were revealed, allowing the Earth to be swiftly restored over half a year to a livable state.


    Any dissidents in the space faction were promptly eliminated in that time, and the humans descend onto the renewed Earth to claim its lands.


    Alas, it was but wishful thinking to believe that such an elaborate plot would go through so smoothly, as the humans from underground began to surface.


    Although only one government was formed initially, led by those who were part of the entire scheme, many who survived were not part of it.


    They gathered power, and by the time the surface of Earth was successfully reformed, they rushed out and took control of large part of the Earth too.


    People in the space faction who were unhappy about the purge that was initially conducted took this chance, and secretly aided this underground faction in their attacks when they surfaced.


    In the end, with military and manpower divided on Earth and in space, the world was successfully divided into two almost equal portions.


    Those who had plotted this entire change became known as the Dominion.


    Those who rebelled after became known as the Republic.


    Tired of war and with lots of work left to do, be it building cities and exploring new territories formed, the two sides made a truce and end the fighting for years to come.


    Once again, things did not go entirely as planned. The terraformed Earth is no longer the same planet as it used to be.


    Within both sides, there are enormous areas that could not be scanned by satellites. Even the Earth itself has grown in mass after research was done.


    Many years of scientific research and development took place before today, and many of these people were influenced by ideas and more importantly, lore.


    Ensure your favorite authors get the support they deserve. Read this novel on the original website.


    The ones who developed the terraforming technology to restore the Earth after its destruction had crazy dreams. Our wildest fantasies, potentially realised after the usage of their technology.


    When both sides established their capitals and took control of key locations, they were ready to explore.


    One such country, formed by an extremely peculiar group of Republicans, is commonly referred to as BT


    They voluntarily sent a large military expedition towards the largest area of unscannable territory on the Republic¡¯s behalf.


    Ending in failure at first, as the entire fleet sailed into stormy seas of immeasurable violence, it was later discovered by a second expedition that the first group did succeed in arriving at the other side.


    By then, over a year had passed, and the original forces that went over established a new country of their own.


    The country is called, Moon Channel.


    Moon Channel, or M-chan for short, is unlike any country that currently exists in the world.


    First, it could not be kept in check by satellites and hence, is hard to coordinate an attack against from outside.


    Second, the soldiers who went there changed. Some become physically stronger to a monstrous extent, while others gained powers that were previously not found in this world.


    Most importantly, its inhabitants are not all human. The fantasies that were once but dreams are now reality, as new species of demi-humans and monsters lived among them.


    Simply put, M-chan is like a virtual reality game that came to life.


    Outraged by this betrayal, BT refused to acknowledge this new country initially, placing embargoes of every sort on them.


    Needless to say, their attempt proved pointless. More time passed, with M-chan being more and more developed, and BT watched on till they realised their method was futile.


    Coming to a compromise, M-chan became a new country of the Republic.


    Establishing a large port city known as Port BT, M-chan and BT develop routes of travel between them and started trades of all kind.


    This story, however, is not about the world as it is now.


    The people of M-chan are no longer regular humans. Like in a game, they discovered that some of them could come back to life by having a new body created. Some other became incredulously powerful and could no longer be killed.


    Calling themselves denizens, those who gained this power referred to it as Chaos.


    There are two main reasons. The first is due to the natives who they discovered. The natives called themselves the banished, and said that the ones who could have these kind of powers to be evil as they wield the power of Chaos.


    The second reason is due to the denizens themselves. As the power manifested differently in each person, with some becoming insanely powerful and other remaining mostly normal, the denizens themselves took its nature into consideration and called it Chaos even before learning about it from the natives.


    As to why the people of M-chan chose to call themselves denizens, is simply because of how they viewed themselves to be. Humans have habits. Some good, and some bad. The people in M-chan belong to the latter.


    In M-chan itself, the people there fought against each other over the most insignificant things. Armed with their newly found powers, no expense was spared as mere words took form of actual happenings.


    From mere skirmishes to chaotic battles, the only reason why a country could be formed in the end was entirely due to the efforts of various denizens who believed that their kind needed a new home where no other could be found.


    And now, one of its greatest war is about to take place, starting from a trivial dispute in a small coffee place to the entirety of M-chan itself.


    Trust me, it¡¯s ridiculous. Do not try to make too much sense out of it. Just put aside your thoughts, and enjoy this crazy ride.


    Oh, and if you scroll right down to this part, it¡¯s fine. The lack of context now will probably be made up for in the future. In lighter hearted information updates, of course.

 Information Chapter #001 - Denizens and the Military

    Welcome to the first information chapter.


    As the actual story relies heavily on how much one knows about this world and Moon Channel, information chapters will be released from time to time instead of a story chapter.


    These chapters serve to enrich your experience, but can be skipped if you are more interested in action and less on how things work or why certain abnormalities exist.


    Present day M-chan:


    As of the time before this war, Moon Channel consists of three groups of denizens.


    The first are natives. Some appear to be completely human, while the rest are demi-humans. That¡¯s right. Humans with animal parts like cat ears and tail. This group have no supernatural abilities whatsoever, and are significantly fewer in numbers compared to the other two groups.


    The second are the generated. More commonly referred to as NPC (Non-playable character). This is due to the particular power of one individual, who is able to create ¡°humans¡±.


    Due to his fetishes, the kind that are created in mass numbers are mostly the various kinds of females found in visual novels. Of course, quite a few are accompanied by their families and ¡°side characters¡±, resulting in a wide variety of males being created as well.


    One point to note is that when any generated dies, they die as normal humans do. Meaning they do not come back to life and basically are never the same as they were before even if ¡°regenerated¡±.


    The third are the former BT military. Also known as true denizens, these people have all gained some ability of some sort. These abilities ranged from physical to mental to supernatural.


    An example for each would be godlike combat ability, superior learning ability, and creating items out of thin air. This said, not all have a particularly ability, meaning apparently redundant ones exist too.


    In terms of population size, the NPCs are the largest group, followed by true denizens, and lastly natives.


    This is true for the current area of land that has been explored and developed by M-chan. There are still places beyond that many have yet to venture to, which may consist of even more types of denizens.


    Types of NPCs:


    As mentioned, the generated are modeled after characters found in visual novels and so on. Or rather, fictional characters with some idealistic traits in their nature.


    Although proven to be changeable over time, their main traits are often more dominant so forcing a change is typically rare.


    Following the Japanese naming convention and short forms, the following types are rather common.


    [*-dere]


    With the asterisk denoting a prefix, ¡°dere¡± is the term ¡°in love¡± with an individual. When in love, the prefix suggest how that NPC will behave towards their target.


    [tsundere]


    ¡°tsun¡± implies the NPC in love will act stubborn towards the target, For example, saying things like ¡°It¡¯s not like I did it for you!¡± and so on.


    [yandere]


    ¡°yan¡± implies obsession. This type is highly dangerous as they are often likely to do crazy things in the name of love, ranging from stalking their target to killing for them and more. This type is looked upon fondly by the military, with experiments on using them for battles.


    [var-dere]


    An M-chan specific term. ¡°var¡± mean variable, or varies. This type have little or no consistency found in common types, making them highly unpredictable when in love. Perhaps due to an error in creation, the military still employs them, but bans them from the love subject.


    [mayadere]


    A specific type of tsundere. This type is known to fall in love with an enemy which they are trying to kill, causing them to change erratically as they have inner conflicts about killing their target or leaving them alive.


    [loli]


    This one refers to a female having the physical appearance of a little girl, regardless of age.


    While the true denizens do consider going for underage girls morally wrong as most do, some are not as young as they appear to be or even under the contention of not being actual people due to them being NPCs.


    Due to their ridiculously large numbers after being ¡°generated¡±, and true denizens infighting of whether to kill off the majority of orphans, most of them have been put under military training to form companies of their own.


    [pettanko]


    Practically means loli. It means flat chested woman in Japanese.


    Stolen story; please report.


    [oppai]


    Meaning breast in Japanese, this term will be commonly used in this war due to the obsession with them of a specific individual.


    This said, to each their own preferences, so true denizens generally do not judge.


    There are many other types of NPCs, but we will stop here for now.


    The following two terms are some other non-related but will be commonly used.


    [hentai]


    Meaning pervert in Japanese, it is also commonly known as animated Japanese pornography.


    [yaoi]


    Meaning gay or male homosexuality, its implications are exactly what you can imagine.


    Religions/Spiritual beliefs:


    All true denizens of M-chan believes in the power of Eros, meaning eroticism.


    Hailing it as a divine power, they believe that all forms of Eros should be accepted, and anyone who believes otherwise to be infidels.


    While the degree of belief varies amongst them, the general consensus remains as long as their specific sore spots are left untouched.


    Consequently, all denizens understands this as well and mostly abide it too.


    Moon Channel¡¯s military:


    Despite being separated from BT, a majority of true denizens have not decided on how they want to live their life in M-chan.


    Hence, most of them remain officially in military ranks or choose to work as freelancers. The latter are known as mercenaries.


    Those who choose to give up their military duties completely and not combat related careers are treated as regular civilians.


    It is also important to note that more than half of the NPCs and even some natives have joined the military as M-chan is still a mostly military controlled country, caused by the disinterest in more commonly used methods of governance.


    Ranks in M-chan:


    [Non-military]


    CIV = Civilian


    MRC = Mercenary


    [Military: Senior officer]


    SC = Supreme Commander (aka Leader of M-chan)


    GEN = General


    LG = Lieutenant General


    MG = Major General


    BG = Brigadier General


    COL = Colonel


    LTC = Lieutenant Colonel


    MAJ = Major


    CPT = Captain


    1LT = First Lieutenant


    2LT = Second Lieutenant


    [Military: Junior officer]


    SWO = Senior Warrant Officer


    MWO = Master Warrant Officer


    WTO = Warrant Officer


    MSG = Master Sergeant


    SSG = Staff Sergeant


    SGT = Sergeant


    CPL = Corporal


    LCP = Lance Corporal


    PFC = Private First Class


    PVT = Private


    [Military]


    REC = Recruit


    Some commonly used jargons:


    Sitrep = Situation Report


    AKO = Alliance Key Officers


    KOM = Key Opposing Minions


    And now, we are ready to begin the tale proper.

 Chapter 0: The Outbreak

    From the records of the grimoire writer¡­


    Day 0:


    It was a fine evening as the city streets were filled with denizens ending their day at work, to either head home or to party the night away.


    In downtown, a cozy coffee shop bustles with life as it begins to serve its nightly range of alcoholic beverages. Mugs were raised, and people happily cheered as they guzzled down the diabetic substance in good company.


    Then it happened.


    An angry NYOW fills the shop, so loud and fierce that not one soul could ignore it. A feline figure raises from a seat by the glass panel of the shop, followed by that of another burly man.


    ¡°I have tolerated the last of your insolence! Nyoo longer will I try to educate you plebeians of the only glory that is oppai main heroines! Today, you will all be assimilated or DIE!!!¡±


    After that declaration, all that could be seen was a punch sent towards the feline figure from the burly man. Before it could hit, loud hissing from all around polluted the silence, followed by thick smoke that sent almost everyone in the city into a state of confusion and panic.


    As if expected, military helicopters and tanks entered the city almost immediately along with supporting troops, but no one had prepared for the gas attack which occurred.


    One by one, those who had inhaled too much of the toxic gas transformed into furry creatures resembling that of humanoid cat. Those who did not fainted, leaving few to resist.


    This toxic gas came to be known as the C-Virus, which had the ability to turn a human, or rather denizen, into a mutated creature known as a CAT. CATs are completely subservient to the one known as the Cat Tyrant.


    The Cat Tyrant, whose original name is Sumeragi VI Tirtha, sought to create a world that matches its ideals, starting from M-chan which had the potential to be anything.


    Having teamed up with various true denizens for reasons beyond us, a terrifying battle took place in the city.


    With many people just having been converted into CATs, the telepathic command given to them was long and mostly served to further confuse rather than to instruct. As a result, most newly converted CATs went on an insane rampage, attacking the incoming military which tried to hold back from harming M-chan denizens.


    Screams filled the streets as anyone still human were attacked by these CATs, who in their madness, could be perceived as animals in heat. Raping anyone they could come across, it wasn¡¯t long till bullets flew in an attempt to stop them.


    Back at the coffee shop where the initial fight began, the entire half a kilometre block ceased to exist as powerful blows were exchanged between two groups of true denizens.


    Any new CATs were promptly exterminated with single punches by the one called the leader of M-chan, Simon Walter, who perceived their hostile intent caused by the Cat Tyrant¡¯s control.


    Any survivors however, could not be saved as the hired hands of the Cat Tyrant mercilessly used explosives and all means of otherworldly contraptions in an attempt to gain the upper hand.


    Support the creativity of authors by visiting the original site for this novel and more.


    In the end, many blows were exchanged. And the Cat Tyrant came out victorious¡­


    Day 1:


    With the initial outbreak being successful and the Cat Tyrant beating Leader Simon, the city known informally as M-chan¡¯s capitol was effectively taken over.


    While its hired minions scoured the streets for any sight of resistance, the converted CATs were brought in for the Cat Tyrant to gain proper control over them as well as to get them organised.


    At this time, brainwashed cat fanatics and saboteurs set off the numerous gas bombs in many other populated regions. The widespread outbreak of the C-Virus could not be contained, and any law enforcement came to a swift end like in some B-rated zombie flick.


    Day 2:


    By this time, the number of CATs outnumbered humans two to one, with any survivor being captured or killed.


    Various outposts that were set up in a hurry still stands strong, with certain hot spots being filled with military forces attempting to fight back against the CATs.


    Day 4:


    Several outpost could hold on no longer, and the blood of virgins was spilled by horrible CAT unlike no other.


    More powerful than regular CATs, countless survivors were briefly overpowered and hastily raped. Such a horrific trail formed that day, with the victims being rounded up by newly formed CAT troops.


    Day 7:


    Several fortified military bases were taken down today, with CAT troops led by the hired hands of the Cat Tyrant.


    These hired hands are also mainly true denizens who chose to become mercenaries and had extraordinary abilities, which explains how the bases were abruptly destroyed with ease.


    Also to be noted is that some drastic actions were taken by panicked commanders who refused to surrender, choosing to blow up their fuel supplies or ammunition, killing both themselves and whichever CAT forces that were around.


    Day 9:


    Almost all battles have come to an end, with most of M-chan being successfully taken over by CAT forces or left ravaged.


    One more military commander went mad, attempting some form of dark magic which failed.


    It is said that the cries and screams of hundreds of young girl soldiers could be heard for several minutes as it occurred, sending the nearby CATs patrols into hiding as well.


    By the time a group of survivors went by to check things out, only a small reservoir of blood and bones could be seen along.


    ¡­


    The record of extra key information ends here.


    Records continues in the military files as stored in the archives¡­

 Chapter 1: Post Outbreak Days

    Day 13:


    With the loss of our battle to the C-Virus, our troops scattered and the Cat Tyrant¡¯s invasion made it into our cities, taking over everything within a week.


    Since then, groups of survivors have gathered together amongst the many ruins. But we''re not safe.


    Day 17:


    A scout reports group of men, lolis and tsunderes being "converted" in the New Church of Cat.


    The men are injected, turning into mindless feline monsters only capable of serving the Tyrant and loving Oppai with insatiable lust. The female are converted into various kinda of Oppai women and are given their inductions by the Tyrant itself.


    As much as we would love to destroy this monster, our own dire situation leaves us but no choice except to escape and hope to regroup someday...


    Day 20:


    A consolidation of data shows the status of various key officers from M-chan Anti-Cat Alliance as well as Oppai Cat...


    SC Simon: MIA; last seen using his ultimate move, Hercules Buster, against Cat at close range.


    MAJ John: Captured; after being affected by the C-Virus, he went into a serious case of hallucination and taken prisoner.


    COL Hitagi: Converted; after his final blast into Cat, he got infected by a lethal strain of the C-Virus. Having been changed, he now hunts us down, giving anyone he pounces on a painfully ass rape before releasing his virus into them, converting them to Cat''s cause.


    MSG Ahyaa: Deserter; shortly after his return to the frontline, he went with the guise of bad navigational skills and disconnected his comms set. He has been missing ever since and presumed to be dead.


    MSG Khairul: Captured; suspected to be a traitor at one point, he proved his loyalty to our fight as he blocked a direct shot of C-Virus meant for COL John. Last seen in chains outside the Church of Cat.


    CPT Kaiki: Alive; Due to his personal conflict against Sanjay, Kaiki has since been a follower to Cat, under the condition of not being converted himself. For his personal gains, he now hunts along with the rest of Cat''s troops, hoping to chance upon the occasional booty...


    CPT Sanjay: KIA; In his attempt to release a lethal strain of the C-Virus, Sanjay blew himself up in the ammo dump of our headquarters, sending everything there along with a force of 500 lolis to the burning hells with him.


    MG Simba: Alive; returning from his mission in the freezing plains of the outer region, MG Simba has recently rejoined us at Port BT. After briefing him on the situation, the general orders us to attempt to re-establish contact with outer regions base, YAN-DA-RAE.


    Other details to be documented as available.


    The tale has been stolen; if detected on Amazon, report the violation.


    Signing off, MRC Lurker.


    Day 26:


    After sending MG Simba and a 425 strong force of lolis, var-deres and men, I remain on M-chan mainland to seek out survivors and set up safe houses.


    I can hear the Nyaa~-ing in the air. And the occasional scream that reverberates from the Church, probably some victim of another of Cat''s horrendous tortures.


    I can only pray that the General returns with a task force of Yanderes to before it''s too late. Additional information as seen below...


    CPT Christian: MIA; in the moments after the release of the C-Virus, the Captain was seen running through the battlefield in tears, picking up bits of lolis and cutting down the minions of cat. He was also seen killing our freshly converted men in hopes of saving their souls but disappeared after getting blasted into the sky by former COL Hitagi.


    Tyrant Sumeragi: Alive; the main cause for the entire conflict. Currently within the higher levels of his Church. He was last seen on public channel announcing the successful execution of Supreme Commander Simon, but with no proof whatsoever.


    2LT Mark: Alive; prior to the release of the C-Virus, 2LT Mark received information of the unforeseen threat. Due to the lack of time, he left a message of MRC Lurker to pass to higher command. The message reads, "Going to find Yandere Task Force. Hold out till my return!"


    And so ends another day in this hellhole...


    Day 32:


    Slightly more than a month has finally passed, though our days to come are looking darker than ever.


    Reports by distant SOS seems to indicate that MG Simba''s convoy was attacked by a school of CAT-fish.


    How did those creatures even mutate...nonetheless, we have managed to secure several safe houses in the region.


    With the return of MRC DarkCloud and MSG Viniance, morale in general has returned with DarkCloud''s eagerness to spill the blood of CATs and MSG Viniance''s female radar.


    Status as seen below...


    MRC DarkCloud: Alive; despite her late return, she has been gearing up on whatever we manage to find and crafting up a good bunch herself. I still cannot get what she plans to do with the metal contraption...


    MSG Viniance: Alive; rejoining us after days of suspected KIA, blood test shows him to be clean¡­ for now. Eager to restore Eros to M-chan, he is a valuable asset to the resistance.


    MRC Lurker: Alive; despite being the key personnel for the entire operation, the man himself is believed to have been infected by the C-Virus. But as signs are lacking other than the occasional "Nyaa~", his value to the force cannot be replaced easily at this point.

 Chapter 2: Resistance Days, Part 1

    Day 34:


    A loud roar from our underground workshop woke us up in the middle of the night. Running down, we saw MRC DarkCloud straddling her completed 12 foot tall light armored mecha.


    Before we had time to rejoice or worry about the noise made however, a scout ran in with horrible news.


    Our safehouse by Port BT just reported pieces of men, lolis and var-dere floating in from the sea. While we were not exactly sure how, but several survivors were found drifting nearby.


    From the information gathered, our attempt to seek help has been lost as the convoy was decimated and the general now missing.


    Status update below:


    MG Simba: KIA; according to the last of the survivors, MG Simba fought bravely on his vessel to the last man/loli. In his final bid, he was seen standing on the engine before blowing the cargo hold of explosives. He will be dearly missed.


    Day 35:


    As regrettable as our loss is, the battle must go on. Today, we lost 2 newly established safe houses. It is rumoured that former COL Hitagi and CPT Kaiki led their respective assaults and left no survivors.


    In spite of these happenings, we were low on resources and needed to go into the inner depths of the cities to retrieve more resources.


    During our escape, MSG Viniance found a terrified loli saying "No more, Captain. I will be a good girl..." and in his attempt to save her, alerted a CAT patrol.


    It was also due to this that we accidentally knocked a case of catnip over a fire, which distracted the cats enough for MRC DarkCloud to use her 10-cuts sword to rip them all to shreds in relative silence.


    With this new found knowledge, we brought back with us as much catnip as we could, hoping this will be the weapon to balance out this conflict.


    We also chanced upon a 2LT Redshirt, who wasn''t killed off during his platoon mission to back up SC Simon in the initial battle.


    With the additional people and weaponry, this might be the first turn in the tide of the battle...


    Day 40:


    Much has happened since. From the time of the departure of our general, MG Simba, we have set up a total of 52 safe houses.


    Of which, 30 of them have been discovered, raided and by chance, a survivor turns up from under a cardboard box. To our surprise, CPT Christian walked right into our safe house recently, with bloodshot eyes and eye bags so dark we thought he was a panda.


    Knocking MRC DarkCloud unconscious before she nearly decapitated him, he declared his quest for revenge and how Cat was going to suffer beyond an eternity.


    While we celebrated the return of a mighty ally, we lost yet another important one. MRC Lurker was last seen out on the roof the night before, smoking a pipe of catnip. As I sat next with him, he talked to me about never giving up the fight as Eros mustn''t be lost to the likes of the Cat Tyrant.


    Not knowing exactly what he was rambling on about later on, I retired for the night only to have MRC DarkCloud announcing the next morning that he left us a note about his "defection to Cat".


    I still do not understand what is going on too well. But I know this is all real.


    Due to his sudden betrayal, I will take over his role in reporting from now on.


    FOR EROS, 2LT Redshirt.


    Day 43:


    At the break of dawn, a high pitched siren screeched over M-chan mainland. Not having slept, I ran outside immediately to see a titan-sized statue rising from the back of the Church of Cat.


    If you spot this narrative on Amazon, know that it has been stolen. Report the violation.


    The statue has the figure of a woman with boobs so huge that I couldn''t imagine something like that till MRC DarkCloud walked up from behind me, saying "That''s bigger than H, ain''t it?"


    When the statue completed its ascend to the surface, a large "screen" appeared from above the Church. Sumeragi VI Tirtha, first Cat Tyrant, made his announcement of the Nyaa~vastator, a device that would convert any in moments.


    Declaring that his super weapon would be completed in 2 weeks, he nyaa~ed so loud that we thought we would have died just from it.


    Fortunately, he choked on a furball and had to be saved by MSG Putra. Concluding his message, we knew the final battle was to be soon. Real soon.


    Status as follows:


    Cpt Christian: Alive; since the initial battle, CPT Christian has ventured through the ruins of the city, brutally tearing apart any CAT found and trying his best to save any lolis he found. Despite saving a few and bringing them to a hideout, they were discovered by COL Hitagi when he was out and he returned to find all but one missing. The last one had experienced so much **** that she was practically dead. Enraged, the Captain went on a rampage till he ran into our forces.


    MRC Lurker: Traitor; having defected to Cat one night, he has not been seen ever since. If there was one thing we would do when we find him, it would be to beat him up so good that he turns back or die.


    More statuses in future...


    Day 45:


    Ever since the announcement of the Nyaa~vastator, CATs have been a lot more active, as if inspired by their leader.


    Our former allies now converted, or otherwise, also ravaged through the mainland as if their time of pleasure is about to end.


    Down to 10 safe houses, our time is running thin. In addition, as we rested at another safe house when returning to resistance HQ, we were discovered by CATs.


    MRC DarkCloud fought bravely against COL Hitagi, but his developed CAT abilities overpowered her speed and weaponry, and he took her from behind. Just as he was about done, MSG Viniance intervened by showing COL Hitagi some anal beads and running off with them, causing Hitagi to chase him.


    CPT Christian fought against CPT Kaiki, who was immune to Catnip grenades as he joined Cat willingly and wasn''t changed. The battle was almost lost till CPT Kaiki began boasting of his exploits and loli abuse count. Enraged, CPT Christian charged at him yelling, "GIGA MOE PILEDRIVER!!!", sending CPT Kaiki blasting off into the skies.


    Upon our return to HQ, morale was beneath rock bottom as our remaining men and lolis began all manners of funny business in view of their impending doom.


    With MRC DarkCloud severely injured in the spine, CPT Christian downing all remaining bottles of Jack Daniels and MSG Viniance potentially KIA-ed, I readied my pistol to end my journey when our ray of hope appeared.


    The voluminous sound of running filled the air as companies of yanderes, mayaderes and men formed up outside our base.


    As we headed out to see what this was about, we saw a man standing tall on a jeep as it drove towards us.


    I still can''t believe it¡­but MG Simba made it back with reinforcements after all. As we received the general, his first order was to stand down and rest.


    We are to brief him tomorrow at 0430 hrs...I still can''t believe...


    Signing off, 2LT Redshirt.

 Chapter 3: Resistance Days, Part 2

    Day 46:


    This is by far the longest day in the course of this battle till now.


    Starting from a briefing to the returned MG Simba in the wee hours of the morning to preparation throughout the day, I finally made time to complete this report an hour before midnight; when Operation Catassacre will commence.


    From top down, the briefing started out rough as we tried our best to bring the general up to speed on the situation. When the general had a clear sitrep, he stated that time was of the essence and that the earlier Cat is denied, the sooner order will return.


    Announcing his plan to lead several strike forces to counter Cat''s rapid advance, we spent the next 8 hours over the geography of M-chan mainland, noting key changes while putting together a feasible plan.


    Despite our efforts, MG Simba noted that our losses by Day 50 will be over 9000 even though we take back 70% of M-chan mainland. As CATs were zombie-like in reproduction, every men lost is a new enemy should Cat play its yarn right.


    With Mercenary DarkCloud Asuno Hatsuko out of combat duties due to spine injury, our leading officers are few in numbers with CPT Christian having taken moderate damage himself. As such, MG Simba has assigned a special squadron with the sole purpose of finding missing Supreme Commander Simon.


    Since it is not certain that Leader will be found in time, the General has also declared M-DEF SS level to be issued to all remaining forces.


    In the event of Day -1 of Nyaa~vastator completion, all forces are to gather up at point Holy Grail, which is the entrance before the Church for one final act of desperation.


    All troops gathered will rush in under the command of the highest ranked officer remaining at 0600hrs in a final bid to stop Cat. As failure will result in the loss of M-chan universe, all troops are authorised to kill Sumeragi Vi Tirtha on sight during the attack.


    Concluding the meeting, we went on to prepping the equipment, briefing the troops and say our final prayers before the all out battle begins.


    I conclude this segment to provide a status report as appended in the following annexes.


    May Eros be with us, 2LT Redshirt


    ------------------------------------------------------------------------------------------------------------------------


    Day 46 Status Report:


    SC Simon: MIA; not having appeared once after his direct confrontation against Tyrant Cat, Leader is believed to have been KIA-ed. After the return of our general, a search party has been formed to find our missing Commander-in-chief, who might bring immediate balance to the Force.


    MG Simba: Alive; having survived the explosion after the CATfish attack, he is rumoured to have rode on the engine of his former vessel through pure hotwiring to reach base YAN-DA-RAE. Establishing connection with our external forces, he has since returned with a Division of 15,000 elites in hopes of turning the battle to our favour. His personal outlook on the matter however, is not positive.


    COL Hitagi: Converted; having been converted directly by Cat in his final burst, the former Yaoi Master now walks on fours, pouncing onto any non-CAT he finds with great ferocity and giving them the buttsecks for their life. He was last seen pulling out from MRC DarkCloud after being lured away by anal beads held by the brave MSG Viniance.


    MAJ John: Captured; due to his initial breakdown after being affected by the lethal C-Virus, MAJ John was last seen being ferried into the inner depths of the Church, never to be seen again. MG Simba theorises the possibility of his sanity returning, making it a key objective should Operation Final Desperation take place.


    CPT Sanjay: Dead; the first critical loss in the Alliance Key Officers (AKO), CPT Sanjay tried to break free from Cat''s will by taking the desperate measure of blowing up his own base of operations. The act could be considered traitorous, but no one is willing to bother in view of the greater danger at this point.


    CPT Christian: Injured; in his recent battle against CPT Kaiki, who defected over to Cat after the release of the C-Virus, he suffered severe injuries but managed to defeated his perverse nemesis who provoked his inner loli by boasting about the numerous lolis he had brutally raped and murdered.


    This story has been stolen from Royal Road. If you read it on Amazon, please report it


    2LT Redshirt: Alive; given orders to cover SC Simon at all costs in the initial battle, 2LT Redshirt watched as his platoon were murdered or mutated into CATs. Spending his subsequent days lost, he struggled to survive in the ruins till he was found by a scavenger squadron led by MRC Lurker. Since then, he has been part of the resistance and recently took over MRC Lurker role after his sudden betrayal.


    2LT Mark: MIA; last seen moments before the end of the initial battle, 2LT Mark was seen abandoning his position in order to look of the Yandere Task Force. With the return of MG Simba, 2LT Mark was seen leading a squadron of Yanderes, presumably the Task Force to search for missing Leader, SC Simon.


    MSG Ahyaa: Deserter; prior to the start of the initial battle, Master Sergeant Ahyaa took his declaration of hatred for COL Hitagi in action by abandoning his position. His current whereabouts are unknown.


    MSG Khairul: Captured; in his attempt to protect MAJ John, Master Sergeant Khairul suffered a lethal shot of C-Virus, making him amongst the first to get converted. Through sheer willpower, he resisted Cat''s influence and was last seen in chains like a mindless doll. His valiant efforts were made futile as MAJ John fell to Cat''s C-Virus shortly after.


    MSG Viniance: MIA; rejoining the Alliance after the initial battle, MSG Viniance has proven himself time and again to be a valuable asset to the resistance. In his last act of valor, he discarded his man''s pride by distracting COL Hitagi from his buttrape of MRC DarkCloud with anal beads. He was last seen running off into the distance with COL Hitagi HOT on his ASS.


    MRC DarkCloud Asuno Hatsuko: Injured; joining up with the resistance on Day 32, she has since contributed greatly to the arsenal with her innovative tool of mass murder. However, her last confrontation with COL Hitagi ended badly as she was overpowered in her retrofitted mecha, causing her to be paralyzed waist down due to a spine injury from violent assrape. Fortunately, she was not infected by the C-Virus due to MSG Viniance timely intervention.


    Tyrant Sumeragi: Alive; the sole perpetrator of this war, Tyrant Cat begun with a false announcement of M-chan mainland history. Due to his usage of all known media resources, citizens were greatly disturbed, which led to the immediate response by the Alliance to arrest the fiend. Cat resisted with feline might and fought fist to paw when SC Simon stepped in to put the Cat down. In its bid for victory, it released the terrible C-Virus, resulting in the scenario today. Currently, he is awaiting the completion of the Nyaa~vastator, which will reported convert everyone into CATs with no exception.


    COL (CAT) Hitagi: Alive; formerly COL of the Alliance and Yaoi Master, he now purrs to the nyaas of Cat tyrant, feeding on milk in the day and hunting men in the night. His double entry is only to emphasize his deadliness as one of the Key Opposing Minions.


    CPT Kaiki: KIA; joining Cat promptly after the release of the C-Virus, he is one of the few around the Tyrant to remain human while serving as a minion. With his personal goal of endless sensual pleasures, he has led many a hunt to fulfill his own urges. His downfall was swiftly delivered after his days of chaos by CPT Christian, who was enraged by his boasts of loli rape. He was last seen flying into the distant skies shouting, "I''M BLASTING OFF AGAIN~!!!"


    MSG Putra: Alive; missing since the initial conflict, he was last seen saving Cat Tyrant from a killer furball in the throat by giving it a kick in the back. He is believed to have teamed up with the fiend to "achieve greater ends". His actual combat abilities have yet to be seen...


    CPL Syafri: Alive; having been working behind the scenes, CPL Syafri has yet to appear in any key events whatsoever. He is rumoured to be the prison warden of the Church of Cat''s inner depths.


    MRC Lurker: Alive; being one of the first to join the initial battle, MRC Lurker was infected by the C-Virus when fighting alongside COL Hitagi in the surprise buttsecks on Cat. Having failed his mission, he went on to forming the resistance while resisting the C-Virus. Discovering the effectiveness of Catnip with MRC DarkCloud and MSG Viniance, they developed the Catnipade; a grenade that releases a cloud of deadly catnip. He then disappeared from resistance HQ overnight, leaving a message stating his betrayal to the Alliance by defecting over to Cat Tyrant. He has been missing ever since.


    ..End of report...

 Chapter 4: Resistance Days, Part 3

    Day 47:


    As per our orders, we set out in various groups.


    Group A - L:


    Silent assault squadrons. With Yanderes in the lead, CAT patrols are taken out swiftly and quietly. Having been ordered not to attract unnecessary attention, all such groups are ordered not to attack CATs led by a KOM (Key Opposing Minion).


    Group M:


    Led by 2LT Mark, this squad has been specifically ordered to find still missing SC Simon. To optimise mobility, the group is armed only with knives and a silenced one-shot. They consist of one commander and five elite Yanderes.


    Group N-W:


    Frontline technical support squadrons. Their main objective is to secure the area recaptured by Group A - L, by picking suitable locations for safe houses, mobile ops centres and supply routes.


    Group X-Z:


    Reserve groups on standby at HQ. In the event HQ comes under siege, these groups are to alert all other groups of the situation, except Group M that is focused on finding Leader.


    As much as I wanted to set out in a group, MG Simba has given me specific orders to remain in HQ to keep things in order. As such, I will remain here till the battle goes past Phase 1. From which, my role will be reassigned.


    May the Eros be with us, 2LT Redshirt.


    -----------------------------------------------------------------------------------------------------------------------


    -10 Days till Nyaa~vastator launch:


    I arose from a huge comfortable cushion this morning, surrounded by women with G-sized Oppai. Disgruntled, I let out a loud NYAA, waking them up and causing them to run out of the room in fear.


    Through the opened door walked in a CAT, greeting me with a salute that I casually waved off. Before having a chance to gather my thoughts, the CAT asked me what kind of milk I would like for breakfast.


    Taken back by that suggestion, I told him that I didn''t need breakfast and asked him for an update on the current situation.


    The CAT replied, "MAJ Lurker nyaa~ The weapon is in its final stages. We are currently having COL Hitagi contribute his final container of Mayo Milk to power the device nyaa~!"


    Shocked at this revelation, I quickly instructed him to leave, saying I will call for him in a few minutes. The CAT obeyed, reminding me of a meeting with CAT high council in a hour.


    Not being able to piece together what just happened, I got up and looked around. Seeing a mirror, I prodded over and took a good look at myself.


    I was me. With fur, two pointy ears and a long tail.


    Smashing the mirror in disgust, I realised that I must have fallen to Cat''s will and fully converted. Despite my mental resistance, I knew I wouldn''t last long and left the resistance before I could damage it from within.


    This text was taken from Royal Road. Help the author by reading the original version there.


    As my head began to throb in pain, I decided to hold back on digging up memories and rather write this down somewhere.


    I do not know how and why. But I seem to have regained my human consciousness...though my speech seems to be completely Nyaa~lified.


    For now, I will attend this meeting. Hopefully I will get some idea of how to stop this madness.


    Nyaa~ MAJ (CAT) Lurker


    -----------------------------------------------------------------------------------------------------------------------


    -10 Days till Nyaa~vastator launch (Night):


    Having made it to the night,the meeting earlier today gave me quite a bit of insight to the current scenario.


    Convening on the Oppai of Cat''s Divine goddess, Tyrant Sumeragi made his physical appearance before his "high council of CATs". Among the 10 others besides Cat and I, only three were familiar faces.


    The first was former Alliance Colonel, Hitagi. With a golden beard covering his furry face, he looked more like a lion than a cat. Disturbingly, his shtick has not lost any of its prowess, remaining long and tall throughout the meeting.


    The second was the one of the two only humans in the council, CPT (CAT) Kaiki. Though no other members brought anyone else, CPT Kaiki alone had two lolis in chains next to him, who he would give an occasional stiff kick to hear them yelp.


    The third was none other than MSG (CAT?) Putra. Why he was in the council was a question itself. Why he joined Cat another.


    Starting the meeting was a CAT in a red hood, who nyaa~ed out the agenda halfway before being interrupted by Cat Tyrant, who said "NYYAAA~vastator nyaa! Is it readi-nyaa~~?!"


    COL (CAT) Hitsun replied with "Why so seriouranyaa~? Let¡¯s have more fun before using it, nyaa?"


    MSG (CAT) Putra followed with "Profits since I have laced the popcorn and drinks with catnip has not stopped raising! Of course we are going to need more CATs to raise my margin!"


    Slamming the table, CPT Kaiki added "Tirtha. No point in rushing now, is there? As the colonel said, let¡¯s take this slow. Who can stop us now? Besides, I have a debt of blasting away to repay Christian. Don''t ruin it for me, right b*tch*s!?" before giving the two girls a kick each in the belly.


    The next slam came from Cat itself, saying "ENYAA~~! If the Nyaa~vastator is nyaa ready, then I don''t give a NYAA!" before storming off.


    Looking at each other blankly, COL (CAT) Hitagi, CPT (CAT) Kaiki and MSG (CAT?) Putra walked off as well, leaving the rest of us to continue the pointless meeting by ourselves.


    While their discord gave me some relief, I knew that the time of reckoning still loomed upon us as the Nyaa~vastator was in its final phase. I will have to help from within...but how?!


    Must stop with the...Nyaa~~~ MAJ (CAT) Lurker

 Chapter 5: Resistance Days, Part 4

    Day 50:


    Phase 1 worked exceedingly well, with us having a minimal loss of 69 men, lolis and var-deres, who were unfortunate enough to run into a CAT patrol led by either COL Hitagi or CPT Kaiki; who to our surprise and anger of CPT Christian, was still alive.


    Having secured 50% of M-chan mainland, it was safe to say continuing on might have led to victory. However, MG Simba was disturbed by the rapid progress we had, suspecting a plot to let our forces spread out too thin before a decisive attack on our HQ.


    Declaring it was time, he rallied the troops in our expanded establishment, announcing the start of Phase 2, the real battle. Though there were whispers about the general going mad, no one dared to oppose him in fear of his potential fury.


    As MRC DarkCloud has managed to modify her previous contraption, she now calls it an exoskeleton, allowing her to move once more despite being paralysed waist down. Swearing to rip Hitagi apart SLOWLY, she proceeds to practise in her "new body".


    And now, as our troops readied themselves from the invasion, I prepare myself for battle as well. Leading a platoon of Mayaderes, I have a feeling the battle will work out better than expected.


    I must note however, I cannot stand the way they look at me with deary eyes at times only to find my locker full of wire traps that would have cost me an arm if not for my bad habit of throwing my books into the locker.


    I''m starting to wonder if the CATs are going to die first or me...


    Is this also moe? - 2LT Redshirt


    -----------------------------------------------------------------------------------------------------------------------


    -7 Days till Nyaa~vastator launch:


    This morning, I found myself walking restlessly around the Church alone after a large breakfast of raw fatty tuna and milk. Not having found a particular answer to overthrow Cat without triggering his suspicion, I was perplexed by the fact that it was going to be less than a week till the Nyaa~vastator is fired.


    Lost in my thoughts, I wandered into the underground segment of the Church where Cat has compiled a large collection of cats and senseless oppai manga.


    As I walked into the Hentai section, I heard a scream coming from a far corner. Running in that direction, I soon found myself before a grand flight of stairs leading further underground.


    Considering my given rank by the Cat Tyrant, I composed myself and walked down the stairs and arrived at a huge mess hall where a bunch of CATs were drinking freshly squeezed milk.


    Looking around, I saw a human shouting at some CATs. Figuring he might be the commandant here, I walked over to attempt to make contact.


    As I approached, he took notice of me, only to shout, "What the hell do you want?!" I stood there surprised till the CATs recognised me, shouting, "Attentionyaa~!" One of the CATs proceed to greeting me but I stopped it before it could, not wanting the pointless gesture.


    Help support creative writers by finding and reading their stories on the original site.


    Asking them to be at ease, I ask the human for his name and purpose here. Laughing at me, he introduced himself as CPL Syafri, the prison warden in charge.


    Asking me in a sarcastic manner if I came down to inspect the prisoners, I firmly replied him with a "Yesaa!" only to him smirk at me. As his superior nonetheless, he leads me down to the cells, many of which were full of prisoners.


    Getting to the point, I ordered him to bring me to the captives from the initial battle. Though he questioned my intents at first, he stopped when I grabbed the whip from his belt and said, "Someone is going to be whipped. Will it be you or the prisoners?"


    He then quicken his pace and promptly led me to a wooden door. Opening it up, we walked in and I saw a few familiar faces. Chained to brick walls were MAJ John, CPT Sanjay and MSG Khairul.


    Among the three of them, only MAJ John had the energy to lift his head up, giving me a cold stare and spitting at the ground. Though I was disappointed not to find SC Simon here, I was also relieved.


    Looking at the warden, I said "Sonyaa~ Looking for a job with better prospects?"


    - MAJ (CAT) Lurker


    -----------------------------------------------------------------------------------------------------------------------


    Day 54:


    OH GOD WHY!!! Today I find myself trapped on the roof of a 70 stories high skyscraper with my platoon of Mayaderes. Not too sure why I took out my d-pad to write this either but we are way too high up to snipe at anything from here.


    My situation aside, ever since MG Simba led the charge 4 days ago, the fighting has only end in meaningless dying for both CATs and us. The general himself has been said to having not stopped fighting since the start and is in the heat of battle even now.


    As for my other comrades, MRC DarkCloud has been on a rampage since the start and a recent report states she has finally found her nemesis, COL Hitagi.


    CPT Christian has also been tougher than ever, leading his company of 200 lolis. It is said that up till now, not a single loli under his command has even been scratched and that he goes into battle all by himself.


    In a recent joint operation with two other squadrons, we came across CPT Kaiki. He has become a monster like no other, overpowering his enemies with a new gas type C-Virus. Though cowardly, I ordered my squad to retreat to prevent unnecessary causalities; which turns out to be the right choice as the other two squads were wiped out by the beast with a gas mask.


    With no word from 2LT Mark again, I wonder how this campaign will turn out after all. And now I have a Mayadere tugging on my...what is that flash of light coming from the Oppai goddess?


    Oh fudge. - 2LT Redshirt

 Chapter 6: Resistance Days, Part 5

    -3 Days till Nyaa~vastator launches:


    From my previous fortunate discovery, I have since been actively taking charge of CAT forces. Part of my eagerness was due to the recent promotion of CPL Syafri to 2LT and having him come under my command.


    Under the pretext of training him for active frontline hunting, I had him resume his post as prison warden in order to treat the captive MAJ John, CPT Sanjay and MSG Khairul in hopes of having them rejoin the Alliance in due course.


    Another reason was to gaining insight on Cat''s internal management. As expected, he rarely gives attention to anything that did not interest him, leaving the rest of the council to do as they deem fit.


    Hence, putting in place ridiculous loopholes like stockpiling barrels of various types of fuel through the Church has been a simple task of issuing the command to do so.


    The rest of the council were too busy in their respective duties and were more than glad to hand over these chores to me. This said, the general in the council has queried me once on my actions already...though it will be too late for him to do anything by the time we strike.


    But my plans were for naught when a CAT ran into my office in the afternoon. Informing that the Tyrant had gone mad, I rushed to the control room of the Nyaa~vastator with a few of the council members.


    Upon reaching, we saw Sumeragi VI Tirtha looking at us with a wide grin, saying "It''s to fire nyaa~~~" and pushed a button.


    A loud screech could be heard for a second, followed by a few second of complete silence. At the end of the silence, we saw the results of the first beam fired. An area the radius of 8 miles has received a direct blast, turning all in that area into CATs or Oppais.


    Letting out a displeased Nyan, Tyrant Cat yells at a CAT engineer, complaining that the beam wasn''t powerful enough before walking off proudly.


    As I recovered from shock, I realised that Cat has to go down. NOW.


    - MAJ (CAT) Lurker


    -----------------------------------------------------------------------------------------------------------------------


    Day 55:


    As I staggered along the streets after waking up from yesterday''s blast, I still could not believe that I survived a fall from a skyscraper. My squad wasn''t as lucky as I was. From the point I got up from till now, I have not seen a single trace of them.


    Shouting has not helped as the noise from fighting somewhere around here washes out my call for survivors. Gritting my teeth, I readied my rifle as I started running down the street.


    Round the corner, I saw MRC DarkCloud fending off a vertical downward strike from COL Hitagi''s Yaoi Shtick. A burning sensation surged through my body as I charged towards them, firing my rounds for all they were worth.


    Hitagi calmly jumps backwards and with a swing of his shtick, hits me across the chest and into a bus stand. As I lay there trying to recover from the hit that probably broke a rib or two, I noticed an ominous cloud approaching. The one that surrounds CPT Kaiki.


    Ensure your favorite authors get the support they deserve. Read this novel on the original website.


    As I lost consciousness, I heard a heroic roar from the distance...


    -----------------------------------------------------------------------------------------------------------------------


    Day 55 Continued:


    Before I regain consciousness, I was having a nightmare of COL Hitagi coming after me with his yaoi shtick when suddenly, a cute young voice resounded painfully in my ear, waking me up.


    I opened my eyes to the bright LED lights above me as I lay inside what seemed to be a makeshift medical tentage. To my left was a typical heart healing medic girl. Looking into her eyes, I went into a daze for a moment till she said it was time for a jab.


    Remembering my training back in cadet school, I quickly got up stating I was fine and ready for battle before running out. The nightmare I had moments ago suddenly felt like a timely warning...


    Making my way out, I found myself in what used to be M-chan district park. On top of a makeshift stage stood a mighty familiar figure. As I walked closer, the man spoke.


    "Citizens of M-chan! Balance will soon be restored! For I have returned from my training. And will lead the Alliance to victory against the Tyrant Cat! FOR LOVE OF MOE, EROS AND ALL FETISHES! FOLLOW ME, YOUR LEADER AND SUPREME COMMANDER, SIMON!"


    I am pretty sure that was thought up in a hurry and was frankly pretty crappy but no one was about to douse the fighting spirit emitted from our returned Leader, SC Simon.


    As he walked to the side of the stage, MG Simba walked onto the stage along with two moe-steel cages containing COL Hitagi & CPT Kaiki. Brought before SC Simon, Hitagi hissed angrily along with Kaiki cussing from inside.


    Sticking out his hairy chest, SC Simon let out a hearty manly "HA!"


    Upon hearing that, COL Hitagi started writhing in agony as the fur on his body starts falling off together with his "tail" returning to its original form.


    On the sight of this miracle, MG Simba announces the temporary charges for the two as follows:


    1. COL Hitagi will be examined upon recovery to see if he has returned, body and mind, to the Alliance.


    2. CPT Kaiki is to be transported back to HQ where he will be confined till the battle ends when he will be tried on Military and Civilian courts respectively for his war crimes.


    Raising up his overly muscular arm once more, SC Simon shouts "NOW TO BATTLE! AND TO VICTORY!"


    As I end this report, this will probably be one of the last that I can write before this battle ends. Gearing up with equipment from the weapons transport, I set out with my newly formed squadron under SC Simon.


    EROS AND A FUTURE! - 2LT Redshirt

 Chapter 7: Resistance Days, Part 6

    -2 Days till Nyaa~vastator launch:


    Summoned by the feline Tyrant an hour after nightfall, the High Council of Oppais Nyaa~ gathered atop the bust of the Oppai statue for an "emergency" meeting.


    As Sumeragi rolled on the bed that was to be his chair while playing with a ball of yarn, we noticed the absence of two of the council members as the doors were shut.


    Standing up from his fluffy bed, the Cat nyaa~ before beginning his speech.


    "As nyaa can see, two of our recent renamed council are absent without valid reasanyaa...so we are in a pitch nya! But replacements are on their way nyaa LTC Carlos?"


    Standing up, the furball of a CAT I once thought to have done nothing around here opened his mouth, calling for the two to come in. As they walked in, I had to cover my mouth to prevent a surprised "NYAA!" from slipping out.


    Taking the two empty seats, the two were exact replicas of COL (CAT) Hitagi and CPT (CAT) Kaiki in their cat forms.


    "Now nyaa. I have anticipated foul play by the former committee that was M-chan leadership nyaa. And so I shall also have my General reveal his true identity as he leads my council before me into battle against the Allianyaa~~~"


    The fat CAT of a general rises from his seat and meddles with the wrist watch on his arm. After a few turns and nyaas, his nanomite disguise fades off, revealing him to be ousted GEN Nathanael Li.


    As I was still recovering from shock, Cat Tyrant ended the meeting with the following, "The Nyaa~vastator will be launched. But before that, my council shall go to battle, nyaa~..."


    Leaving the meeting, I rush back to my office and picking up the phone, I called 2LT Syafri.


    "Syafri. It''s time. Get the Major and his men ready."


    As I prepare for the final(?) battle tomorrow, I wonder how it will all unfold...


    Myan! - MAJ (CAT) Lurker


    -----------------------------------------------------------------------------------------------------------------------


    -1 hour till Day 57:


    Pre-battle Status Report; entries of new key officers


    LTC Aiel: Alive; as part of the force brought back by MG Simba, Lieutenant Colonel Aiel has been appointed Commanding Officer of Resistance HQ, now renamed as Alliance HQ. Providing tactical support, the half colonel will have an overview of the entire battle, allowing him to make crucial decisions for Alliance troops while keeping key personnel on the frontline updated.


    1LT Jonathan: Alive; amongst the first to volunteer himself during the call for battle by MG Simba, First Lieutenant Jonathan was given an immediate promotion from Second Lieutenant for his zealous efforts in retrofitting cargo vessels to high speed transports that allowed the prompt return of the 15,000 troops that now surround Cat''s stronghold. He is now amongst those in the frontline, eager for battle.


    This content has been misappropriated from Royal Road; report any instances of this story if found elsewhere.


    SSG Tony: Alive; as the personal runner of LTC Aiel back in outer region base MAYA-RANS, Staff Sergeant Tony follows his Commanding Officer to battle after being called upon. SSG Tony is now positioned in the Command Centre at Alliance HQ. As the Key Comms Officer, he is to correspond with the key personnel on ground, providing requested support while providing crucial updates on the situation.


    For Eros! - 2LT Redshirt


    -----------------------------------------------------------------------------------------------------------------------


    Minutes before 24 hours till launch of Nyaa~vastator:


    As I look over the various monitors across the spacious room that is CAT Command Centre, the forces of M-chan Alliance gathers around the Church; waiting to barge through the gates as soon as the command is given.


    As for CAT forces, GEN Nathanael Li personally issued the order for all forces to retreat to within the compounds of the Church. As such, only few stragglers remain outside across the M-chan mainland.


    Gritting my teeth, I pray for the success of 2LT Syafri, who I have tasked to lead MAJ John and the insurgent forces to the private quarters of CAT High Council, which are positioned on the upper levels of the statue.


    If undetected, they will be able to make their way up easily to the roof garden of the Oppai goddess, where they will have the chance to take down Cat Tyrant Sumeragi who is "enjoying" the show from there.


    A CAT walks into the room, and approaches me in a haste. "MAJ Lurkenyaa! Please switch a monitor to Public Channel 3! Our god Tirtha is about to make his announcement nyaa~!" Nodding my head, the CAT operating the terminal below me switches a monitor as instructed.


    As the screen shows a hentai of oppai women airing, with a Cat on a Please wait sign on the center of the screen, I took a final look at the report of additional Key Personnel that was passed to me a while back.


    Personnel Update -


    CPT (CAT) Angel: Alive; having been converted a few weeks after the initial battle by COL (CAT) Hitagi, Captain Angel has since been assigned the task of commanding the Church Guardians; a special unit consisting of soldiers that even I do not have information on. When I ask GEN Nathanael, he waved me off, saying it''s under his direct command. CPT Angel now awaits by the gates, eager to draw first blood in the final battle.


    SSG (CAT) Lite: Alive; being converted in the initial outbreak of the C-Virus, Staff Sergeant Lite now guards the lower levels of the Oppai Goddess as the guard commandant. Having been thoroughly brainwashed, he now carries out his duty with an undying persistence, having stopped many infiltration attempts by small groups of rebels during the early takeover by Cat Tyrant.


    Finishing the report, I end this log as Cat Tyrant appears on the screen, ready to address his CATs.


    Nyan! - MAJ (CAT) Lurker

 Chapter 8: Resistance Days, Part 7

    5 minutes before full scale attack by M-chan Alliance:


    - Mem-chan v1.0 booting up -


    - User brainwaves detected -


    - User life signs stable -


    - Initialising mind scan -


    - Mind scan complete; initiating link with Command -


    - Link connected; retrieving user information -


    - Start up complete -


    "...welcome, 2LT Redshirt. Recognised as key personnel. Establishing connection with Key Comms, SSG Tony..."


    Wow. This got weird in a hurry. Having arrived outside the Church a few hours back, we watched as CAT forces retreated behind the giant gates of the Church. Having around 6 hours from operation time, combat personnel took a short break to ready themselves for the day long battle ahead of us...assuming the battle is won before it''s too late.


    SC Simon, along with MG Simba, has since been in the huge tentage that was set up to be the frontline Command Centre.


    COL Hitagi has also returned to battle with us after going through several rigorous mental and physical tests. After a brief conversation with SC Simon, COL Hitagi was given the green light to rejoin us to restore his honour as Yaoi Master and to put the Cat Tyrant down once and for all.


    Not having too much to do myself, I wandered around with a tin of scotch that was given to me by MG Simba himself as a small reward for my work till now. Before having a chance to take a swing however, several armoured trucks arrived at our frontline camp with new gear for us to use in battle.


    The "gear" is actually this mind reading device, that comes in the form of a 4mm thin skinpad. Sticking it to both sides our of our head and pressing on both at the same time for 5 seconds turns the other-worldly device on. And that leads us to this...


    [Uhm...hi. Is this 2LT Redshirt?]


    [Yes Sir! I mean yes HQ. Did this just happen in my head?]


    Unauthorized usage: this narrative is on Amazon without the author''s consent. Report any sightings.


    [Affirmative, Lieutenant Redshirt. Also, try to keep monologues to yourself by switching to voice mode. You can do that by an active thought of passing thoughts only through words you think of speaking. Thank you.]


    [Oh sorry. How embarrassing. What in Eros is this...]


    [I can still hear you, Sir.]


    Thinking of having the words I plan to speak being transmitted only, I turn to see our Leader climbing a makeshift 4 metres tall tower to address the troops gathered.


    Running over, I end my first memory log here.


    - End of memory log 1: 2LT Redshirt -


    -----------------------------------------------------------------------------------------------------------------------


    A minute before the battle begins:


    *Leader Simon is atop a tower addressing the troops*


    SC Simon Walter, Leader of M-chan Alliance: Ladies! Gentlemen!


    *Tyrant Cat is on screen of Public Channel 3 addressing CAT forces*


    Tyrant Sumeragi VI Tirtha, CAT God of Oppai: Nyaa~ians~!


    *View switches between the two as they speak*


    SC Simon: Today! We charge forward! AND WE WILL NOT LOSE!


    SC Simon: Today! We will restore Eros to its acceptance for all love and fetishes!


    SC Simon: MOE! LOVE! EROS! ALLIANCE FORCES! CHARRRRRRRRGGGGGGGGGGEEEEEEEEEEEEEEEEEE!!!!!


    Tyrant Cat: Nyaa~~~! Let''s spill some milk, shalln''t we? NYA-HA-HA-HAHAHAHAHAHAHAHAHAH~~~Meeeooowww~~~!


    *Warcries can be heard from both sides as Alliance Forces charge towards the gate*


    Let the FINAL BATTLE...BEGIN!

 Information Chapter #002 - The Moon

    Welcome to the second information chapter.


    If you have read up to this point, you might have noticed a variety of crazy things happening. Or even a severe lack of tenses management.


    But don¡¯t worry. Being a grammar Nazi should probably be the least of your worries now. That is, if you aren¡¯t denizen material.


    The ¡°Moon¡±:


    Since M-chan means Moon Channel, many denizens tend to refer to it literally as the Moon.


    While this means there will be the occasional confusion with the actual moon in the night sky, the origin of this ¡°country¡± name comes from a joke which will not be further discussed here.


    Now you might be wondering how so many buildings popped up out of nowhere in slightly over a year or how a giant statue come raise up out of the ground.


    Those are but the first amongst many things, which is better explain in the next part.


    The ¡°server¡±:


    As mentioned in the first information chapter, many NPCs were created by the power of a true denizen.


    The actual form of this power comes from what is called the server.


    Laid down quite some distance away from the shores of M-chan mainland, the server has the ability to fully manipulate anything in its wide radius, or at least to the present knowledge of the denizens.


    This means that anything from buildings to people can be created, which is how NPCs came to be.


    Most surprisingly, there is nothing that cannot be moved out of this ¡°sphere of power¡±.


    Basically, once created, an object exists in reality and cannot be trivially destroyed as created by the server.


    While tempted to think of it as an infinite machine that can produce as much as possible and of any form, there are oddly real limitations.


    First, not everyone can use it. There are many theories, but none proven to accurately know if one is capable of controlling the server. In fact, there are only a few who can use it.


    Second, it is limited by its user. Depending on the person using it, only specific objects or people can be successfully created. In general, any attempt to create something that one does not understand causes a server error, causing it to ¡°crash¡± and not work for any duration of time from a minute to a week. As tested to by this point, at least.


    Third, it is ¡°power¡± intensive. By power, this means that the user suffers some form of repercussion each time it is used. This cost comes mainly in physical or mental form. Physical would mean a person becoming hungry or thirsty or even sleepy. Mental means the cost of the ability to thinking, outward behaviour, or even memory.


    Last, it¡¯s known to few. For most of the part, only true denizens know of the existence of the server. And even amongst them, many do not believe it is real.


    At this point, there are many common appliances and seeing a large server room isn¡¯t rare. But when M-chan first started, it was mainly jungle lands or grassy plains. Back then, only the few who saw the server being laid down knew of its true powers.


    In fact, many do not believe in the server due to the fact it did not do anything when they tried to use it, leaving the few who could actually use it to keep the secret.


    But what about large objects forming in the skies from time to time? Well, it¡¯s treated as natural denizen powers at work and nobody really cares otherwise.


    Administrators:


    Continuing from the server, the few who can actually use it have another title, called administrator. Admin for short, the reason for this is simple.


    The true denizen who have full power over the server set limitations before it was left behind.


    These limitations are not known, but is one of the prime suspects as to why it cannot be used by everyone or be made to do everything.


    Back to the point, admins have various levels too.


    Owner: Only the true denizen who owns this power has this level.


    Sudo: The second highest level. They are allowed to do everything within the limitations.


    Moderator: Can do everything within the limits set by the two above levels.


    Observer: Can find out everything that the server has knowledge of. Nothing else.


    Stolen story; please report.Guest: Each one may only do things permitted or granted by higher levels.


    No lower or equal level can demote another of the same level, but those of higher levels may promote those of lower level up to equal rank.


    As such, only four true denizens have the rank of Sudo, with any other restricted to a lower rank or given extra privileges as deemed necessary.


    ¡°Lurkers¡±:


    Unrelated to the server, this topic is more about the true denizens of M-chan.


    As seen, there are many with ridiculous abilities. However, only few go to the extent of using them.


    Since all true denizens originally came from a group of oddballs, there are more true denizens who rather lie in wait, never using their abilities publicly and simply enjoying their days out in M-chan.


    These true denizens are known as lurkers. They exist, generally not bothered by the eccentricities in M-chan.


    They come and go as they will, which is considered supernatural by non true denizens, but casually accepted by other true denizens.


    As a result, they are considered to be no better than NPCs.


    CATs:


    For this war in particular, a new species known as CATs have been created.


    Short for Cat Afflicted Type (CAT), they are the result of people being infected by the C-virus.


    CATs are the literal personification of furries. Meaning they have humanoid form and are predominantly covered in fur along with a tail and cat ears instead of human.


    They can be fully controlled to follow the will of the Cat Tyrant, but have a mind of their own in general as the Cat Tyrant is too lazy or just do not have the ability to control each individual all the time.


    Perhaps due to the Cat Tyrant still being a true denizen, it rarely forces its will on a CAT, choosing to let them do as they want in general.


    This said, most CATs are thoroughly brainwashed by the Cat Tyrant itself to at least think in ways similar to itself.


    Self interest not being one of them as they generally are extremely loyal to the Cat Tyrant.


    The resistance:


    If you have followed the story up to now, the resistance is formed by groups of NPCs and mainly led by true denizens who survived the initial spread of the C-virus.


    Witnessing the horrors of the CATs and their commanders, they swear to keep fighting at all cost or let M-chan be damned otherwise.


    They gradually form up with reinforcements from the outer regions to form the alliance.


    The outer regions:


    M-chan was first discovered by a military expedition force sent by BT, so it is founded by soldiers who chose to develop the land and stay there.


    Due to the initial disapproval and threat of war from BT, M-chan despatched several companies to build bases on various islands discovered between M-chan and BT.


    These bases are self-sufficient as NPCs were sent there too, building up small communities beside the military installations.


    Using usually advanced food production methods, these communities thrive and support the bases there at the same time.


    This said, the conditions in the outer regions are hardly great. Many are often battered by regular storms and contact is typically hard to maintain.


    The soldiers switch out amongst themselves between bases, with many military NPCs preferring not to live on the mainland as their future is rarely promising.


    In fact, certain true denizens with particular hopes and dreams choose to train themselves in these regions.


    The alliance:


    Formed to defeat the Cat Tyrant, the alliance will serve to be a new front for M-chan next step as a nation.


    But this is another story altogether and might be talked about in general detail sometime in a distant future¡­


    Now then. End of exposition dump and back to the story...which is going to be on a weekly basis.

 Chapter 9: Attack of the Alliance, Part 1

    - Memory log 2: 2LT Redshirt -


    With the roar of our Leader giving us the attack order, I find myself among the first charging towards the gates. This is a bit ridiculous as it''s probably impossible for us the get through the gates without aid in blasting them open first.


    Just as that thought begin to fill my mind, two figures zoomed past the first of us at unbelievable speed towards the gates. With a loud BOOM, the gates were ripped from their giant hinges, falling inwards onto whatever unfortunate CAT that remained there.


    As we approached the two, I recognised them to be COL Hitagi and MRC DarkCloud Asuno Hatsuko.


    Looking back at us, the Colonel gave me a spine shivering wink and shouted, "We''ll be going a HEAD first", before the two took off at the same speed as before.


    Rushing in, legions of CATs awaited us as they began their own forward charge. Armed with ridiculous bulky armor and giant clubs, I wondered how they would fare against our advanced weaponry.


    Raising an arm, I order the first wave to halt and begin firing upon the enemies. Without a single hint of hesitation, the CAT legions continued marching towards us. As our formation was completed, I swung my raised arm forward while shouting the command to fire.


    As our bullets gunned down lines after lines of enemies, the legions resumed their forward charge with an unwavering spirit.


    [Frontline HQ. This is 2LT Redshirt. Requesting immediate artillery support on the main gates!]


    Shortly after my request, artillery fire could be heard from behind us. After 2 minutes of bombardment, the legions were reduced to ashes. Preparing to give the order to move now, I took a step back when I saw giant holes appearing in the ground before us as metal gates on the ground opened up, revealing a platform with Giant CAT Mechas on them.


    [Holy shi-] was my last message to frontline HQ as I barely dodge the blast of a rocket launched at us by one of the CAT mechas...


    - User mind signature disrupted...ending log -


    - End of memory log 2: 2LT Redshirt -


    -----------------------------------------------------------------------------------------------------------------------


    Meanwhile, at the private quarter of the higher CAT council:


    - User recognised: Greetings, 2LT Syafri -


    - User recognised: Greetings, MAJ John -


    - User recognised: Greetings, CPT Sanjay -


    - User recognised: Greetings, MSG Khairul -


    - Beginning CAT-mem...Memory log 1 recording: 2LT Syafri -


    Raising my head, I looked at the Alliance officers in front of me; formerly my prisoners but now freed in exchange for a better future in the M-Chan Alliance. Also in the room is a hand-picked squad of 12 CATS who I believe are loyal to only me due to their immense hatred of Tyrant Cat, who has since deprived them of pettankos and lolis by assigning them to prison duties.


    Armed with smuggled anti-CAT weaponry, each of us is now have a laser pistol and a bandolier containing 12 Catnipades. While the pistol is capable of killing, doing so takes a lot more energy than stunning. Hence, we wanted to save as much energy as possible for the assassination of Cat.


    As MAJ John reaches for a sushi knife lying the table, he looks at me and asks, "I know what''s in it for you. But what if we don''t succeed?"


    "Better than an eternity as a prison warden torturing you who likes it more than I do."


    "Good answer. I will let you have the first taste of Cat''s blood later when I slice him open slowly...ALIVE, of course." says the Major as he licks the sharp blade of the knife without cutting himself.


    "I can''t wait to get my hands on that Cat either. It will be HANDS ON for me if I don''t find anything worth torturing it with as we go up...or maybe a broken wine glass would do." adds MSG Khairul.


    Feeling a twitch in my eye, I turned to face the door as I heard footsteps of a CAT approaching from MAJ Lurker''s room. Knocking on the door, the CAT presumes no one to be in and turns the door handle, but stops when I shouted, "What is it?"


    "NYAA! Is that you inside, Sir?" replied the surprised CAT after a brief pause.


    "Yes! Now away with you! I need to groom my tail!"


    "Y-Yes Sir!" replies the cat again as it scurries down the corridor outside.


    Making a sigh of relief, MAJ John grabs me on the shoulder, telling me it''s time.


    "But Lurker''s instructions are...!"


    "Too late. That CAT probably noticed the lack of NYAA~ in your speech. And really now, your voice is not that of a CAT either." says the major as he prepares to leave the room.


    Cursing my inattentiveness, I readied myself as well.


    - End of memory log 1: 2LT Syafri -


    -----------------------------------------------------------------------------------------------------------------------


    - Memory log 1: PVT FML -


    Standing guard outside Frontline Command, I could see the battle raging from here. With artillery shells fired just moments ago, giant CAT-like robots are now rampaging through the battlefield.


    From what I could see, it took a company of Yanderes to take down a single one earlier, with hundreds more baring down on us. Suddenly, I heard a voice shouting "Wait, Leader!" coming from within the tentage.


    This story originates from Royal Road. Ensure the author gets the support they deserve by reading it there.


    Walking out was our mighty Leader Simon, following him was MG Simba. As the Major general tried to persuade our Supreme Commander from joining the battle so soon, our Leader replied with "Our men and lovely ladies are giving their lives away out there. You expect me to cower in a tent? General, I am ordering you to take over my role as Commanding Officer as of now."


    As he stomped off, removing his heavy overcoat, MG Simba turned back looking utter displeased. Noticing our presence, he shouts, "Well what are you waiting for?! Give your leader some cover fire!"


    "Yes, Sir" was the reply given by all of us in the area, who chased after SC Simon.


    - End of memory log 1: PVT FML -


    -----------------------------------------------------------------------------------------------------------------------


    - Memory log 1: CPT (CAT) Angel -


    Standing at the top of the grand stairs leading to the inner halls of the Church, I looked down upon the battlegrounds that was the front lawn of our divine Church.


    Beside me was CPT (CAT) Kaiki, who wanted to be among the first to do battle against an Alliance Key Officer. As our CAT mechas ravaged the battlefield, I wondered if there was even the need for the even greater forces we have on standby.


    It was then which I noticed to figures approaching us at great speed. Lifting my two-handed sword Nyaa~liabur, I readied myself for the enemies approaching.


    Finally reaching the top of the stairs where we stood, the two that appeared were none other than COL Hitagi and MRC DarkCloud Asuno Hatsuko. Raising my hand, I spoke.


    "Neither of you shall get pass. For you will perish my my blade."


    "Hold on there, Angel. I reckon we let the Colonel go. After all, our own Colonel won''t be too happy to hear we disobeyed his orders, right?" says CPT (CAT) Kaiki.


    "So you have a Colonel as well? My shtick is dying to meet his then...after I''m done with YOU TWO!" replies Hitsun.


    As he leapt towards me in the blink of an eye, he stops his attack at the last moment, displaying a face full of rage I have never seen before.


    "What is this...I have a good~ feeling I will be needing all my strength after all. How about it, Hatsuko?"


    "I was almost sad to have been forgotten for a while there. I CAN''T WAIT TO MAKE MINCEMEAT OF THESE TWO MYSELF!" replies MRC DarkCloud as she raises a huge spiked mace in one hand and a bulky mechanised sword-like weapon in the other.


    With that said, COL Hitagi proceeds with smashing downing the giant doors of our Church with his Yaoi Shtick and resumes his journey at unfathomable speed. Turning to face the armoured woman before us, I lowered my sword.


    "Well Kaiki. I think you are enough for the likes of her."


    Before I could have another word, a thin wire leaves a small cuts on my cheek.


    "Enough whining, bitches. I will take the both of you on at the same time and have more than enough energy left to slowly torture that Cat of yours."


    Enraged, I raise my Nyaa~calibur, shouting "MOE JUSTICE! NNNNNNNNNNNNYYYYYYYYYYYAAAAAAAAAAAAAANNNNNNNNNCCCCCCCCCCAAAAAAAAATTTTTTTT!!!!!!!" with CPT (CAT) Kaiki on my side holding his tail in his hand, ready to fire his gas attack.


    - End of memory log 1: CPT (CAT) Angel -


    -----------------------------------------------------------------------------------------------------------------------


    - Memory log 1: LTC Aiel -


    Stationed here at Alliance HQ, I have been tasked with the important job of observing the overall situation while providing feedback critical to the success of our mission to bring down the Cat Tyrant. Though I''m still in a bit of disbelief with regards to this scenario myself, the deaths I have seen in my short time here are by no means to be taken lightly.


    With both my hands, I give myself a quick wake-up slap to focus on the battle before me. As I gave an order to deploy more troops to the frontline, a Sergeant reports to me about the arrival of a prisoner.


    Apparently, CPT Kaiki wanted to talk to me.


    Though I shouldn''t be leaving my position at this point, the prisoner was a former Key Officer of Cat who might have some useful information that we could use.


    "All right. Give me 5 minutes. I will be down shortly." Passing my command down to my second-in-command, MAJ Yuno, I followed the Sergeant down to the holding area.


    Approaching the prisoner, I loudly said, "You are wasting my time, you fiend. Now say your piece before we damn you to your cell till the battle is over."


    Raising his head slowly, CPT Kaiki smirks and proceeds to speak. "Now Sir, why so serious?"


    Before I got a chance to reply, the Sergeant that led me here, shoved me head first towards the prisoner, who releases a deadly explosion of green gas.


    "AHAHAHAHAHAHAHAHA!!!! NOW. Cat will be pleased to hear Alliance HQ reporting to him~" was the last thing I heard before collapsing into a slump.


    - User consciousness fading...terminating logging process -


    - End of memory log 1: LTC Aiel -

 Chapter 10: Attack of the Alliance, Part 2

    - Memory log 1: CPT (CAT) Putra -


    Leaning back on my roller chair, I laughed till my sides hurt from watching a replay of CAT mechas raising from the grounds and blasting the smiles off the faces of the Alliance dogs who had moments ago wiped out legions of CATs.


    A shout then silenced the whole room, demanding me to leave or otherwise observe quietly. The CAT that shouted this was none other than MAJ (CAT) Lurker, who showed up one day at the Church.


    My memory isn''t that great, but I could still remember GEN Nathanael Li facing off against this mysterious intruder. Their battle was an entertaining one that I regret not having recorded as the General''s Vicious Wave attacks broke all my monitoring equipment in the area.


    Though the intruder lost, the general had some weird interest, ordering him to be sent to the Oppai labs, where he was received a full-power memory wipe. Considering he has been faithfully executing his duties, I suppose I could let this one slide...


    Getting up from my chair, I briefly waved my hand at the Major as I left the room, asking him to keep an eye on the situation. Though Cat has kindly offered me the rank of General, I have declined it as that would hamper my movement in this place.


    After all, why stay in one place with all the power in the world when you can be watching exhilarating acts all over the place.


    For now, I guess I will drop by the lab again to see if any particularly high powered battle has begun. After all, those tend to kill off my observers too fast.


    I will then have to send one of my few newly completed obv-bots. But meh...I think I will go and observe one personally though...why watch recordings when I can watch a LIVE SHOW.


    - End of memory log 1: CPT (CAT) Putra -


    -----------------------------------------------------------------------------------------------------------------------


    - Memory log 1: 1LT Jonathan -


    I''m finally in the front of the battlefield I have sought for so long. But why is it that our enemies are so much more overwhelmingly powerful?!


    Having been in the third wave of attackers, I watched as the first wave got decimated followed by the second due to the surprise attack of the CAT mechas.


    Fortunately, I am now leading a company of Yanderes, due to the Officer Commanding getting killed by a giant piece of debris landing on him.


    Although the yanderes are powerful, they have only been so much of a match for the giant monstrosities before us. With only numbers equivalent to the size of a platoon left, it''s only a matter of time before we are all wiped out.


    If only I could master the arts of Yanderes like LTC Aiel. I still can''t grasp how this "power of love" makes a yandere so powerful that all the weapons in the world seem like nothing before it.


    *ZZZZZZZZZZOOOOOOOOOOOOOOOOOOOMMMMMMMMMM sound getting louder in the background*


    What is th-?! *BOMEOHRUIEHFJDIOHTUOEJIKwwsd----------------------*


    Argh...my head...I can''t hear a thing...damn it. I think a missile just exploded nearby. Must get to a shelter...there''s one ahead! But wait. What of my ladies?


    As I looked around me, parts of body parts were strewn all around me. Looking downwards, I finally realised a yandere had jumped onto me, in order to push me away while shielding me from a direct blast using her own body.


    Her lifeless arms finally lost their grip and the remainder of her upper torso dropped to the ground. I could feel myself tearing up uncontrollably as my knees lost strength, causing me to kneeling the ground.


    Crying for a few seconds, my hearing that was momentarily lost returned, and the sounds of the cruel battlefield snap me out of my self-consoling session. Raising to my feet, I looked around for survivors as I dashed for the ruins of a building nearby.


    As I ran, I saw a body of a yandere belonging to my company lying face down on the ground. Judging from the facts all her body has not gotten blown up in anyway yet, I ran over and flipped her over, expecting to see a bloodied or even worse, smashed face.


    Much to my surprise and happiness, she looked fine face up as well. Slinging back my rifle, I quickly princess carried her over into the house. Upon reaching, I tried feeling for a pulse, which was weak but still there. Her breathing however, had stopped.


    Recalling the CPR training I had back in a training demonstration, I quickly followed the standard procedure of chest presses and mouth to mouth resuscitation.


    In my desperation, I forgot to check if her breathing has returned. As I lower my head again in order to resuscitate her, she grabs me around the neck, and proceed to perform a long French kiss. When she finally let go, I fell back onto the ground breathless.


    Looking at me, she licked her lips as she said, "Finally, it''s just me and you."


    - User mental capacity breached...ending log sequence -


    - End of memory log 1: 1LT Jonathan -


    -----------------------------------------------------------------------------------------------------------------------


    - Memory log 1: 1LT Mark -


    Having completed my previous mission of locating SC Simon, who was training himself in body and mind on Mount YATTA since his previous defeat against Cat Tyrant, my squad and I have been reassigned to the premise of Frontline HQ.


    Under MG Simba''s direct command, we have no choice but to remain on standby as the battle rages over the past hour. In hopes of curbing my restlessness, I have been raising flags of yandere squad in preparation of a command to move out by the general.


    As I walked on in the camp to locate my next target, I notice SC Simon briskly walking out of the base. Looking behind him, I saw MG Simba shouting at some guards, ordering them to provide cover for the general.


    Considering he did not specify who in particular, I took it as an order to move out and sortie my yandere squad. As our Leader Simon has changed his pace into one of a sprinting, we took off after him at top speed.


    This is now the time. The time for me to finally make my appearance in battle!


    - End of memory log 1: 1LT Mark -


    -----------------------------------------------------------------------------------------------------------------------


    - Memory log 1: PVT (CAT) Nip -


    NYAA! Assigned to the personal guard squad of COL Hitsun, I now stand at ready with my squad mates under my commander, 2LT (CAT) Yarn. Currently positioned at the top level of our holy Church, the colonel awaits his enemy, who he says is to arrive shortly.


    Stolen content warning: this content belongs on Royal Road. Report any occurrences.


    As it seems nyan, my commander has just received word from the lower floors regarding the rapid ascent of an target, presumably the colonel''s enemy, nyaa!


    But looking at the colonel gives me a bad nyaa...as he plays with his ball of yarn, he uses his finger to make a hole in it and proceed to put his shtick through the newly made hole.


    With a purr, he then pulls it out in a quick motion. As it flies through the air, a shot of mayo milk hits it, covering the once nyavelous ball with its gooey attribute.


    All of a sudden, COL Hitsun''s eyes focused with great intensity, and says "My enemy is here nya." with a wide grin on his face.


    As the arched doors of the grand hall got blown away, the "enemy" walks in slowly. Aiming our weapons at him, he maintains his pace without a sign of noticing our threat.


    Approaching closer, I realised his appearance was of great similarity to COL Hitsun, except in human form. His shtick also stood in a similar erected positioned, ready for the coming battle.


    Stopping 6 feet away from our colonel, he speaks "So this is Cat''s idea of a bad joke huh?"


    "Nyaa~about that. I think the same as well..." replies COL Hitsun in a sensual tone.


    Then at the same time, they both raise their voices, shouting "AFTER ALL, THERE CAN ONLY BE ONE YAOI SHTICK!!!" as they charge towards one another.


    The next moment was nothing more than a blinding light for me...as the two met head on in a clash against one another, causing a shockwave to knock us off our paws nyaa...


    - User consciousness fading...terminating log -


    - End of memory log 1: PVT (CAT) Nip -


    -----------------------------------------------------------------------------------------------------------------------


    - Memory log 3: 2LT Redshirt -


    - User heartbeat detected. Proceeding with electrical boost -


    *BBZZZZZZZTT*


    YEEOWOOW!! Argh...my head...god...where am I now...


    As  I got back up on my feet, the air was filled with smoke from the fires blazing around me. At the sight of this, I look for an opening in the room I was in.


    Spotting a window, I dashed towards it and jumped out. Not a moment too soon, the building explodes behind me as a stray missile hits it. Doing a forward roll as I landed from my second floor dive, I got back up on my feet to get my bearings.


    At this point, I was finally 200 metres away from the grand stairs of the Church. Having struggled to sneak by those CAT mechas after surviving their initial surprise attack, I took refuge in that building earlier in order to wait out the CAT mecha that was guarding the stairs. Unfortunately, another stray missile landed near the said building earlier; and the shockwave from the impact knocked me off my feet, causing me to hit my head somewhere and fainting for a while.


    Making a dash forward, I covered the 200 metres in 30 seconds and started my ascent to the top. Though the top was at least over 400 steps up, I could already see a glimpse of a heated battle taking place at the top, with occasional flashes of light and an ominous gas cloud over the area.


    *THUNK!* *BBBBBBBBBBOOOOOOOOOOOOOOOOOOOOOOOOOOMMMMMMMMMMMMM*


    Performing a quick 180 degree turn, I saw a blown up CAT mecha in flames as a large figure approached me through the flames. Coming closer, I recognised the man to be CPT Christian, the only man who ordered his own company back to Alliance HQ while promising to battle the share of each of his loli.


    Wearing the costume of a brown bear with an unusually large head that has beady eyes and his face at where the mouth was supposed to be, the captain walked over to me, stretching out his arm to offer me a hand. Getting back up, we looked at each other with serious manly expression.


    Nodding at one another, we begun our sprint up the steps. I could feel my body giving way with each step I took, as I have never been through so much in my life before and still being expected of so much more. My chest burned with an indescribable heat and tightened so much I thought my lungs would burst.


    Despite of all this, I kept in pace with CPT Christian and after what felt like a millennium, the two of us cleared the last step and reached the area before the now broken doors of the church.


    "Unforgivable." was what I heard the Captain on my right mumble, before he leapt forward giving the CAT that was spraying some gas non stop a straight punch that sent it flying towards the wall.


    Hearing a loud grinding sound, I turned to see a familiar mechanical contraption battling against a CAT with wings and a giant sword. It was MRC DarkCloud Asuno Hatsuko.


    Noticing our presence, the angel cosplaying CAT jumped backwards, allowing his CAT companion that was smashed against the wall to join up with him. MRC DarkCloud Asuno Hatsuko let out an annoyed "Tsk" before moving over to us.


    "So...these guys are?" I asked while looking at MRC Hatsuno. Before she could reply however, the CAT with wings spoke.


    "I see we have new guests. Looks like Iron Lady over there won''t be dying as fast now." says the CAT.


    "Dying? I was just about to get about with shredding you and your uselessly large sword." snaps MRC DarkCloud.


    "Now now. Before I dispose of these rebels, I will give you all the honour of knowing the names of the two who are about to kill you." says the CAT in an arrogant tone.


    "I am CPT (CAT) Angel and my colleague here is CPT (CAT) Kaiki."


    "No need for introductions. I will kill Kaiki for his vicious acts committed. NO TRIAL REQUIRED." interrupts CPT Christian as he raises his fist.


    Raising my rifle, I fired a burst at CPT (CAT) Angel, who deflects my shot with his sword. Without another word, MRC DarkCloud dashes toward CPT (CAT) Angel while CPT Christian charges at CPT (CAT) Kaiki, leaving me to provide support from the sides.


    Moving behind to a nearby CAT statue, I reloaded my rifle and checked my load-out while waiting for an opportunity to strike.


    - User initiated log completion -


    - End of memory log 3: 2LT Redshirt -

 Chapter 11: Attack of the Alliance, Part 3

    - Memory log 1: CAT Steward -


    Nyaa...given the honourable task of serving our god Sumeragi directly, I now stand on the roof garden waiting on his greatness who sits in the observation pavilion.


    Our god lets out an occasional giggle as well as dissatisfied purrs while watching the battle occur across 32 monitors. As I set down another serving of sashimi with a plate of fresh milk, GEN Nathanael Li walks over to us from the elevator. Without turning around, our god speaks.


    "General Nyaa...why hath thou not sent out our forces as instructed nyaa? I do believe I said to reclaim the land in a single sweep, nya?"


    "Tirtha. The battle doesn''t not play out as simply as that." replies the general.


    "H-how rude nyaa. Watch your tone when speaking to the divine one nyo!"


    "It''s fine nyaa~" says our god as he waves for me to stand down. "I will leave the battle to you as agreed. But fail to entertain me nyaa, and I will be forced to press a button sooner than expected, nyan."


    "Very well. But the battle will not disappoint. Do not expect to be pressing anything sooner than agreed."


    "Nyaa~? So be it. Now if you will excuse nya, I will carry on watching till the time of the summoning." says our god as he motions for the general to take his leave.


    Taking a bow, GEN Nathanael makes his leave after reporting to our god, who resumes his entertainment as I continue serving to its every needs.


    - End of memory log 1: CAT Steward -


    -----------------------------------------------------------------------------------------------------------------------


    - Memory log 1: MG Simba -


    Returning to the map table, I take a grim look at the current situation laid out before me. In the last two hours, we have lost a total of 4,000 men in our relentless assault. With another 4,000 on their way, our strength will return its original 12,000.


    This said, it''s as SC Simon said earlier. We will not be able to push through without our Key Officers taking the lead. However, it is still way too early for Leader to head out by himself despite my warnings. Since our troops also needs to be micromanaged, I cannot do as our Leader has and abandon my command role.


    As I stressed over the possibilities, I receive a message from Alliance HQ.


    ["General Simba. This is Staff Tony. Our aircraft carriers have arrived from the outer regions to provide aerial support!"]


    ["Excellent! Have their strength updated over Battlefield Control immediately!"]


    ["Yes Sir!"]


    From the monitor, we have a total of 10 carriers, each loaded with 12 jets, amounting to a total of 120 aircraft. From that number, a third of it were of the bomber class; another sixth of troop transport and the remainder as fighter class.


    ["Tony. I want 10 bombers over the Church at the soonest possible timing with a fighter escort of 24. Have our Kuudere company board two troop crafts as well on standby 5 clicks from Frontline HQ, ready for deployment in an hour from now. Over and Out."]


    ["As commanded, Sir! Over and Out!"]


    With our air force back in action, the tide of the battle should return to our favor again. Receiving further updates from the field, I return my attention to the situation before me.


    - End of memory log 1: MG Simba -


    -----------------------------------------------------------------------------------------------------------------------


    - Memory log 1: MAJ John -


    Making our way through this labyrinth of living quarters designed by CATs over the past hour, I can see these animals'' warped sense of humour like the poaching of a live fish with a wet towel over its head just to have it alive as it''s served to whoever ordered it.


    As the curved corridor straightens, I can see a grand door ahead. Slowing our pace, we approach the door with quick quiet steps. Forming two rows at each side of the door, I raised my hand with three fingers, indicating a countdown before barging in.


    With a single kick, the doors swung right open, revealing the well lit room within. To my surprise and slightly unexpected boner, we walked into what seems to be a milking room, with at least 20 over Oppai women getting milked by machines attached onto their bodies. Hearing a shocked "Nyaa!", we turned to find a CAT in a lab coat shivering in fear after dropping its clipboard.


    Did you know this text is from a different site? Read the official version to support the creator.


    Walking over to it, I grab it by its neck, asking "Where''s the Tyrant?"


    "Nya...I do-don''t know anything Nyan. I''m only a quality controller as ordered by his greatnyaa~"


    "I will have you know" as I tighten my grip, "that I''m an expert at torture along with my men behind me. Now you better have something better than that for me before I decide you no longer need the ability to speak."


    "NYA! W-wait nyo. I er...I can bring you to the elevator I was in earlier this morning nyaa! Our general was taking iit up to the upper floors with me nya!"


    Releasing the furry abomination, I signalled for MSG Khairul to keep watch over it as I glanced over the room again for any noteworthy objects. As these Oppais would be of no use in our coming battle, I gave the order to move on, having the CAT lead at gunpoint.


    After a 5 minute walk, we reach an insignificant side door, that the CAT opens, revealing a short passageway with maintenance panels along the walls. Passing through it, we exit from the door at the opposite end, bringing us to a posh lift lobby.


    "Nyaa...My access card only allows me to this level nya. Now will you please let me go nyon?"


    "Is that so. Looks like someone has outlived its usefulness."


    "Nyoooo! Have mercy, great one! I''m no threat to ya! Please don''t kill me..." begs the CAT with teary eyes.


    Raising my energy pistol, I zap the CAT three times in the chest and watch it fall into a slump, unconscious.


    "Now, we have some hot wiring work to do. Khairul, go back through that corridor and see if there are any tools within those panels. Sanjay, lock the elevator at this level when it reaches. We will be opening the ventilator hatch of the lift to climb the service ladder. If there is none, then we will figure something out."


    With my men setting out to execute their respective roles, I could feel the moment of reckoning advancing towards me at godspeed.


    - End of memory log 1: MAJ John -


    -----------------------------------------------------------------------------------------------------------------------


    - Memory log 1: MAJ (CAT) Lurker -


    "There''s no preventing this, huh. Launch the NYAACATS! Have them prioritise the bombers!"


    Positioned here at CAT High Command, I am currently supervising the battle under orders of GEN Nathanael. While attempting to deploy the minimum possible troops to counter the Alliance forces in hopes of giving them a chance to break through, I also have to do so prudently so as to avoid suspicions from the other CAT officers.


    Surprisingly, the general himself ordered me to "save our best for last", allowing me the much needed flexibility in holding back the deployment of our forces. This said, I''m shocked by the numerous CAT forces that lay hidden in the underground bunkers. If released now, they would no doubt wipe out the Alliance frontline in a matter of minutes.


    As I timed myself to issue the order of deploying the fifth wave of CAT mechas, a panicked CAT soldier runs into the room, stumbling in front of me with a half baked salute.


    "M-MAJ Lurknyaa! A CAT soldier reports a strange human voice heard from your room, nya! Upon search by a CAT squad, we discover your room to have been ransacked nya! We are currently attempting to find the intruders nyo! What are your orders with regard to this, nyon?"


    "All right. Call off the search parties."


    "MAJ Lurker nyaa~?"


    "It''s fine. I have an idea where these intruders are headed. Captain Catwalker. I hereby order you to stand in as Commanding Officer. I will go and deal with this problem myself."


    As I took a step in order to leave the room, a loud explosion shook the entire building. Turning out, a shaken CAT looks at me with frightened eyes and reports.


    "Major! It''s the Alliance Leader nyaa~...!"


    - End of memory log 1: MAJ (CAT) Lurker -

 Chapter 12: When Denizens Clash

    - Memory log 1: SC Simon -


    Treading upon the burned soil of the battlefield, I removed my overcoat to cover the battered corpse of a loli. Mumbling "It will all end soon", I set my sight on a CAT mecha a kilometre away.


    Feeling a surge of emotions through my body, I let it all burst out in an explosive roar. As the CAT mecha turned its head to me, I charged my O.T.A.K.U powers to its maximum.


    "I''m the embodiment of a thousand NEETs. I stride through the crowded streets of Akiba. Now hear my calling by those before me! FOR I AM HE WHO REPRESENTS ALL WHO HAS FOUND MOE! BESTOW UPON ME, MY LOVE! I AM HERC SIMON!"


    As my noble phantasm now flooded my existence, I could feel every muscle movement in my body. Leaping forward, my feather light self flew towards the CAT mecha and in a single uppercut, it was sent flying through the air before exploding.


    Striking down my first foe, I let out a hearty roar as the remaining hundreds turn to face me, he would destroyed a CAT mecha in a single hit. Leaping forth once more, I took down CAT mechas one after another with ease, reducing their numbers from hundreds to tens.


    As I destroyed the last of the CAT robotic madness, I could hear the distant cheers as 1LT Mark and his squad of yanderes approached me from behind. Before we had a chance to speak, a loud siren rung throughout the area.


    Watching two giant CAT statues breaking free from their concrete shell, thousands of CATs came rushing out from underground passageways, along with more holes appearing in the ground, revealing CAT war machines in all sorts of variety.


    Hearing the sounds of jet engines in the skies, I look up to see an assortment of Alliance fighters and bombers flying towards the Church. Before they could reach their target, a sortie of flying machines in the form of Nyaacats appears from behind the Oppai statue, intercepting our jets.


    Before I had the chance to do anything, I felt a significant presence approaching at great speed. Immediately performing an uppercut, my fist deflects the twin blades of the unknown assailant from above. Jumping away from me after his attack, he lands 10 metres away from me.


    "So Leader. Ready to retire permanently?"


    "No, Nathanael. I will not rest till Eros is returned to its original love for all. Mark, I will leave the mob to you."


    Beginning our one on one fight on this chaotic battlefield, I face off against GEN (CAT) Nathanael with my FISTS OF LOVE AND JUSTICE.


    - End of memory log 1: SC Simon -


    -----------------------------------------------------------------------------------------------------------------------


    - Memory log 1: MSG Ahyaa -


    "This is Eagle 1, enemy flying target spotted. Proceeding to intercept."


    "Eagle 1, exercise caution. The enemy has capabilities not known to us. Take them down promptly."


    Letting out a sigh into my breather, I find myself in the cockpit of a fighter jet as Eagle 4. Having abandoned my position in the initial battle, I made it in time for the last vessel that left Port BT in relative safety.


    Unfortunately, I ran into an old friend of mine in M-chan airforce, who thought I was finally leaving the army to join her. Without the will to resist her forceful antics, I found myself transferring over to outer region naval airbase, Fort TSU-TSUN.


    After receiving a call for help from MG Simba, the two of us were deployed as pilots to board one of the ten aircraft carriers set for reinforcing the Alliance at M-chan mainland.


    ["Ahyaa-kun. AHYAA-KUN! Pay attention, will you?"]


    ["Ah sorry, Mao-san."]


    ["We are in the middle of a battle now. Do you really have that much of a death wish?"]


    ["..."]


    ["I''m switching Comms to silent mode now. Pay attention and try not to die, thank you."]


    "All eagles! Take caution! The enemy fighters seem to have no ranged combat abilities! However, that rainbow tart like main body of theirs have the ability to stick our jets onto them!"


    "HELP! This is Eagle 1! My flight''s been ripped and the fuel is leaking. I think it''s going to...ARGGGGGGHHH!!!!!"


    In an explosion, Eagle 1 that got stuck onto one of the Nyaacats blew up, blowing a hole in the poptart body of the Nyaacat. To our horror, that Nyaacat remained in flight without a sign of slowing down.


    "What in sweet Jes-**ck! It got me! Eaglehead to all fighters! Engage all enemies! Do not let them get to our bombers!"


    Taking evasive action, I narrowly avoided a Nyaacat that almost got me as it flew by.


    Sighing once more, I say "This is going to be a long fight..."


    - End of memory log 1: MSG Ahyaa -


    -----------------------------------------------------------------------------------------------------------------------


    - Memory log 1: CPT Christian -


    Moe. Moe. Moe. Moe. Moe. MOE. MOE. MOE POWAR! Resisting the cursed gas of the enemy, I recite these words in my head as I attempt to avenge the thousands of lolis that have perished under the hands...or stick of this fiend before me.


    "AHAHHAHAHHAAAA...Christian-kun. Just give up already. This gas I''m using right now is the newest strain of C-Virus with 10 times more potency. How you are resisting it, I''m not interested. But you can feel yourself turning already, right?"


    "Never. I will banish you from this world before I fall to any lowly attacks like yours."


    Clenching my fists, I yell out to MRC DarkCloud.


    "Hatsuko! Send him flying over here!"


    In response to my call, MRC DarkCloud spins to give CPT (CAT) Angel a roundhouse kick that sends him flying towards CPT (CAT) Kaiki. Breaking his fall perfectly, he lands on his two feet a metre away from CPT (CAT) Kaiki. With a few shots from 2LT Redshirt at CPT (CAT) Angel''s feet, the CAT backs a few more steps, bringing the two next to each other.


    "Now. THE BOTH OF YOU SHALL PERISH! BEHOLD, MY SANCTUARY! WORLD OF YOUTH, LOLI LAND!"


    Reality distorted around us as the five of us were brought over to my domain that was an amusement park with endless cuteness about. The sound of innocent laughter and sight of beautiful smiles soon filled the place as countless lolis came running over to me.


    As my facial expression changes to that of a happy relaxed one, a loli grabs my hand. Asking who has made me so sad, I reply with a pat on her head, saying that it''s all fine now.


    "May this cuteness rid you if the evil that resides within. My ultimate attack. Eternal gardens of loli haven."


    As countless lolis begin jumping on CPT (CAT) Angel and CPT (CAT) Kaiki, I hear the pitiful cries of Kaiki as his sins are brought out from the depths of his mind. As his whimpering is silenced, I look at the lolis around me once more as they soothed my heart.


    All of a sudden, a pile of lolis are sent flying as a deadly gas cloud exploded from where CPT (CAT) Kaiki stood. Cursing under his breath, he stares at me with intense hatred.


    "Damn you, Christian. Saving this reality marble of yours for last. LET ME RESPOND WITH MY ULTIMATE ATTACK AS WELL!"


    If you spot this story on Amazon, know that it has been stolen. Report the violation.


    Adopting a super saiyan transformation pose, he roars loudly as his body expands to that of a giant man balloon.


    "Now Christian, let''s go to a loliless hell together." with a smirk on his face. "Final attack. MAYO VAPOUR!!!!!"


    Imploding, the bits of his body splatters over my lolis are a mist of unknown origin lowered upon us. A yell catches my attention as one of my loli looks at me with tears streaming from her face. Followed by more screams, I watched as my lolis fade away to nothingness.


    "KAIKI!!!!!" was the last thing I shouted as collapsed onto my knees, coughing out a blob of blood.


    - User critically injured. Ending log to prioritise recovery -


    - End of memory log 1: CPT Christian -


    -----------------------------------------------------------------------------------------------------------------------


    - Memory log 1: MRC DarkCloud -


    As CPT Christian falls to his knees, his domain that is loli land remains despite his lolis mostly having disappeared. With a single one remaining by his side, it was evident he was no longer in any shape to do battle.


    Thinking back, I join the battle for the sake of bloodshed and gore. The complete lack of it recently is much against my taste, not counting the fact I have yet to take revenge on COL Hitagi for his previous sexual assault. With these thoughts in my head, I can feel the emotion of rage taking over.


    Grabbing my sword, Senkatto, I raise it up again as my enemy CPT (CAT) Angel pushes off the few lolis clinging onto his body, causing them to fade away as the others have.


    "I can feel your love, Christian. And it is no doubt as noble as mine. However, the way we serve our liege is not in thought. Hence, battle is the only way we go."


    Leaping forward, I shout "Cut the pointless ramblings! I''m turning you into mincemeat now!" as our blades meet, and my Senkatto lodging his Nyaa~calibur in its brutal mechanical teeth.


    "A pity. You who are filled with nothing but pointless bloodlust and distasteful fetishes."


    "What did you say?" I reply with anger as I pulled out an explosive kunai from the side of my leg armor.


    From behind me, 2LT Redshirt shouts a warning. Looking up I saw an abnormal cloud above our position. Using the fat CAT''s body as a wall, I kicked him to push myself backwards as I narrowly escape a bolt of lightning from the cloud above.


    Letting go off Senkatto in order to dodge that attack, it remains on the CAT''s sword, slowly grinding away at it. The CAT, seemingly undisturbed by his sword being eaten away, lower it to speak once more.


    "Enough of your imprudent acts! You will now submit to me, as you will to our mighty god, Tirtha!"


    Raising his sword with both arms, he shouts "BE BLOWN AWAY! NYYAAAA~~~CALIBURRRRR!!!!"


    As a bright white light rips through CPT Christian''s domain, I feel a hand pushing me on the chest till I was behind a large figure.


    *BBBBBBBBBBBBRRRRRRRRRRRRRRRRRRVVVVVVVVVVRRRRRROOOOOOOOOOOOMMMMMMMMMMMMM~~~*


    - End of memory log 1: MRC DarkCloud -


    -----------------------------------------------------------------------------------------------------------------------


    - Memory log 2: CPT (CAT) Putra -


    Sitting on the top of a broken pillar, I watch as COL (CAT) Hitsun faced off against his human self, COL Hitagi. Taking a mouthful of popcorn, I nearly choked when the two fired multiple shots of bukkake mayo at each other, only to have each shot countering each other.


    Considering it was almost exactly the same person fighting each other, I can''t imagine the battle to end in anything other than a stalemate. As I got up and prepared to leave, COL Hitagi stops for a bit to speak.


    "As expected of me, defeating you won''t be easy at all. Looks like I will have to give this my ALL!"


    In unison, the two grabs onto their Yaoi Shtick and begins stroking it furiously. Having seen enough hentai to know where this is going, I jumped from the pillar to the roof of the Church, through a hole they had made earlier, in hopes of watching their climax while avoiding a sticky ending.


    At the same time, they both shouted "Take this! MAXIMUM PLEASURE! UNISEX MAYO MILK BLAST!!!!"


    Their high pressured shot burst from their Yaoi Shticks in a head on collision, converting into an explosion of Mayo Milk from the point of impact. Ducking low, I lowered my body to the section of roof I was standing on as the entire top floor of the Church is obliterated.


    Riding a wave of the white sticky substance, I skillfully surf my way back onto the now half-metre deep shallow pool of Mayo Milk that covers the floor of the now desecrated prayer hall that was the top floor of the Church.


    Looking around, only one CAT figure remained standing. From the looks of it, the clone has beaten its original.


    "Congrats~ Hitsunyan. Looks like you are now the one and only Hitagi."


    Turning to face me, COL (CAT) Hitsun replies, "My original had overestimated his own power and fell to an attack of hi-HRRNNGHHH!!!"


    Before he could finish his sentence, a figure covered in the white substance jumped out from the shallow pool and with a single shove, COL (CAT) Hitsun was now deeply penetrated by the mysterious white figure.


    "ULTIMATE COMBO! SENNEN NO YOROKOBI!" yells the mysterious figure.


    The loud yell causes the white substance on his face to be blown away, revealing him to be COL Hitagi.


    "You- nyan~" mumbles COL (CAT) Hitsun as he attempts to break free.


    "Now, I have always wonder how doing myself would feel like...I guess it''s pretty good after all!" says COL Hitagi as he makes a thrust into his clone.


    Despite feeling disgusted at the sight of this, I could feel my inner dragon raising to the decadent sight before me. As COL Hitagi increased his thrusts per second, I could see that COL (CAT) Hitsun was being to feel it as well.


    The two were now huffing and purring like cats in heat. Sensing the end was near, I looked around for cover again but saw none. Cursing my voyeuristic nature, I stood my ground as the climax approached.


    "Now, me. In? Or out?" says COL Hitagi to his other self. With an ahegao on his face, it was evident that COL (CAT) Hitsun no longer heard a word from his surroundings.


    "In it is then." says COL Hitagi in his final thrust, yelling "MAXIMUM YAOI SELFCEST!!!!"


    The body of COL (CAT) Hitsun begins to expand rapidly before blowing up into a thousand bits, with the Yaoi Milk now bursting out in all directions. Standing tall with his Yaoi Shtick still throbbing, he turns to face me.


    "So Putra-chin~~~. Are you going to be my next opponent?"


    "Haha...no thanks. I rather watch the battle as it goes...now if you will excuse me, I have another show to watch after I change my clothes."


    Before he could reply, I leaped off the edge of the floor and onto an observer bot that flies me back to my quarters.


    - End of memory log 2: CPT (CAT) Putra -

 Chapter 13: The Cat Tyrant

    - Memory log 2: CAT Steward -


    Nyon! As our god partakes in his fifth serving of morning tea, I walk back to the kitchen area to prepare for lunch. After giving some instructions to the chefs, I make my way back to the pavilion.


    As I approached, I notice a group of CATs surrounding our god, along with four humans.


    "NYAA! What you you doing nyaa! Stop your insolent behaviour immediately!" as I ran over.


    Before I could reach, one of them turned and fired a shot at me, causing me to fall over in pain. Our god raises from his seat, and turns to face the infidels.


    "Nyaa~No need for all this hostility. Why don''t you beg for mercy now? I''m very forgiving, don''t you nyon? Let''s start with you, John."


    Without a word, the man called John lobs a grenade into the pavilion, which promptly explodes into a gas cloud.


    "TIRTHA-SANYAA!"


    Moving my paw to my pocket, I quickly press a button that alerts the guards on the floor below. Barely having pressed the button, I was shocked to see a human in front of me.


    "Lookie here, Major. We have a VERY naughty CAT." he says as he pulls out a wrench.


    "Khairul. I will leave the CAT to you. A Cat Tyrant is about to go through my full TREATMENT real soon." replies MAJ John.


    As I stared with great fear, the human brings down the wrench upon my poor furry body over and over...


    - User consciousness fading...terminating log process -


    - End of memory log 2: CAT Steward -


    -----------------------------------------------------------------------------------------------------------------------


    - Memory log 2: 2LT Syafri -


    As MSG Khairul bashed the CAT serving the Cat Tyrant over and over with a wrench, slowly smashing the pound of flesh apart, I turned away in order to retain my composure.


    With the gas cloud clearing, the figure of the Cat Tyrant Sumeragi could be seen once more. MAJ John walks towards Cat to see if it has fallen to their curse of catnip.


    Before he reaches, the Cat swings its tail and strikes the Major across the chest, causing him to fly ten feets back. Upon seeing this, I shout the order to fire. After the CATs emptied their magazines, I walk towards the pavilion to see if the Tyrant has finally been killed.


    Just as I took a step inside the pavilion, I heard MAJ John shout, "Get back! It''s a trap!" As I had turned to face the Major, I did not have the chance to look in front of me.


    Thinking back, that was probably a stupid thing to do. Looking forward once more, I notice a tail stabbing in the stomach. Stumbling backwards, the tail withdrew itself from my body as I collapse.


    As my vision fades, I watch as CPT Sanjay rushes forward to fight the Cat Tyrant...


    - User consciousness fading...ending log process -


    - End of memory log 2: 2LT Syafri -


    -----------------------------------------------------------------------------------------------------------------------


    - Memory log 2: 1LT Jonathan -


    Hearing some ruckus aside from the noisy bombardment that was occurring, I stuck my head out a window from the ruins earlier to see SC Simon beating down the CAT mechas with ease.


    At the sight of this, I knew it was my duty as a soldier to provide support to our Leader in any possible way. With Yandere Tia-san clinging closely to me, we set off after Leader who is at least a kilometre away now.


    Suddenly, a group of shadows zip by us, apparently also chasing after Leader. Despite my efforts to catch up, I also managed to do so after running non-stop for around half an hour, when I heard a siren ringing across the battlefield.


    In a matter of moments, massive numbers of enemy forces appears all around us, with SC Simon now facing against an unknown enemy wielding dual blades. Recognising my old friend 1LT Mark in the distance, we run over to his position in order to back him up.


    My attempt was in vain as an explosion sends Mark and his squad flying in various directions. At the sight of this, I could feel my frustration building up again as I was powerless in the situation before me.


    Before I got a chance to devalue myself again, MSG Tia pulls me back by the collar, barely avoiding a stray bullet. Falling over onto my backside, she kneels down and bends forward towards me.


    With her face barely a centimetre close to mine, she say "Sir. Don''t you really want to see what a Yandere can do?"


    Gathering my resolve, I replied with a firm yes. Hearing my reply, she gives me a peck on the cheek before saying, "Recharge complete~Now to make a species go extinct."


    - User initiated log completion -


    - End of memory log 2: 1LT Jonathan -


    -----------------------------------------------------------------------------------------------------------------------


    - Memory log 1: MSG Khairul -


    Seeing the bloody mess before me, I could finally feel my urge for gore subsiding. Turning around, I realise that in my excitement, I lost all sense of awareness for my surroundings as 2LT Syafri now kneels down in a slump with a gaping hole through his torso.


    If you discover this narrative on Amazon, be aware that it has been stolen. Please report the violation.


    As CPT Sanjay attempts to fend off the berserk Cat, I move over to help MAJ john back up on his feet. The CATs that followed us now fled in fear as their commander is outwardly dead. Taking aim, I fire a few shots at Cat Tyrant in succession.


    Unfortunately, the Cat has become something more devious in existence now, as my shots bounces harmlessly off it.


    "Khairul! Lethal mode now!"


    Switching over the lethal mode, MAJ John and I take aim once more in hopes of subduing the Tyrant. As CPT Sanjay gets his metal pole he picked up earlier knocked from his hands, we began firing on Cat continuously till we were out of ammunition. Unfazed, the Cat looked at us with lifeless eyes.


    "Nyaa...what bad kittens you have been...first, you ruin my meal. Then you make a mess in be sacred garden. My displeasure is at its limit nyo...so away with you all."


    Waving its paw, cracks began appearing all over the ground.


    "CAT!!! YOU WON''T GET AWAY WITH THIS! WE WILL RIP YOU APART SLOWLY!!!" shouts MAJ John.


    "Nyo...that''s what they always say." before turning its back on us.


    As the ground breaks apart, we fall into the depths below, not knowing when we will reach the ground and our supposed end.


    - User consciousness fading...ending log process -


    - End of memory log 1: MSG Khairul -


    -----------------------------------------------------------------------------------------------------------------------


    - Memory log 2: MAJ (CAT) Lurker -


    Despite my earlier attempt to leave CAT Command Centre, the appearance of SC Simon forced me to resume my command role as his appearance marked the execution of GEN (CAT) Nathanael''s order for deployment of second tier troops.


    The Alliance aerial bomb run has also been stopped by our ridiculously overpowered Nyaacats that now circles the skies of our vicinity. With CAT forces slowly pushing outwards again, it''s but a matter of time till we break through the siege.


    "Majoryaa! Incoming signal! It''s a Comms request from Alliance HQ, nyo!"


    "Put them through. Let''s hear what the enemy has to say."


    As the static clears from the monitor, I was shocked to see CPT Kaiki appear on it.


    "You...didn''t the resistance capture you?"


    "Now now, Lurker-kun. Don''t go killing me off just yet! Wait till you get a grasp on this! Alliance HQ is now OURS! HAHAHHAHHAAAA!!!"


    "...It''s Cat, wasn''t it?"


    "BUT OF COURSE! What else could have convinced me to go under the knife just to have the C-Virus gas system built into me?"


    "Then the clone was for laughs, I guess?"


    "You gas? Of course you do. That''s why I''m now walking freely in their HQ. Anyway~ you can give the order for full deployment now. Them M-channers will never expect to get cornered from both sides when they see this!"


    "The order is not for you to make, Captain. The general has also restricted the order for full deployment to himself and our god Tirtha."


    "Is that so...well I think it''s about time your little plot failed miserably, so Cat will gladly give the order?"


    "What are you-" I asked as a CAT soldier stumbles into the room.


    "SIR NYAA! OUR GOD IS!"


    "WHAT IS IT NOW?!" I demanded.


    "Our god just walked angrily into the Fire Command room nya! He...he has ordered us to ready for immediate fire!"


    "WHAT?!"


    "AHAHHAHAHAHAHAHAHAHAHAHAAA. Well then. Looks like Cat''s going to do it after all. Have fun trying to stop him now, Luuurrrkkeeerr-kkun." says CPT Kaiki in a mocking tone before the Comms channel closes.


    Running over to the Fire Command Room a floor above, I got in just in time to see Cat smashing down on the button. At the sight of this, I immediately pushed a button on the remote in my pocket, detonating several packs of C4 that I had planted over key locations of the Nyaa~vastator earlier.


    "NYAA! What is this?! MY DEVICE DOES NOT SELF DESTRUCT!" shouts the Tyrant in its rage. "Fix it NYON! I WANT TO FIRE MY NYAAS~~~" before rolling about on the platform.


    Walking up to pacify the childish Cat, it jumps back up before I get close enough to do so.


    "MAJ Lurker, is it nya. Full deployment."


    "Your greatness, the enemy is already..."


    "NOW!"


    "BUT MY LIEGE!"


    "SHOULD I RELIEVE NYAA OF YOUR COMMAND? This battle is needlessly long! I WANT TO WATCH ITS BRIEF BRUTAL END NYON!"


    "So be it. You there, escort his Majesty back to his garden. The rest of you! Fix this up quickly."


    As I left the room, I cursed under my breath as I attempt to think up of a plan to salvage the situation.


    - End of memory log 2: MAJ (CAT) Lurker -

 Chapter 14: Raining CATs on dogs

    - Memory log 2: MG Simba -


    As I expected. Without the technical support from M-chan servers, our forces are sitting ducks out there. Even with our Dere-powered forces are no match for the eccentricities of the sci-fi universe.


    Even our aerial forces cannot match the Nyaacats that have been deployed. Only if we had access to our underground bunkers of BT Dark Technologies. With no doubt then, we will be able to retake the mainland and murder a Cat repeatedly with no effort at all.


    Unfortunately, that is not an option I have at the moment. With the 4,000 troops just arriving, I''m having them prepare for our new strategy for moving through the enemy lines in order to infiltrate the massive compound before us.


    *BEEP* *BEEP* *BEEP*


    "What''s with that beeping?!"


    "Sir! It''s the radar! It''s detecting strange abnormalities coming from the statue!"


    "Is it now? Can you tell me more?"


    "Sir. It''s nothing I have seen before. I can''t..."


    "Incompetence! I will take a look myself!"


    Stepping out of the Command Post, I looked in the direction of the CAT Church and Oppai statue that now blocked the rising morning sun behind it. Suddenly, several booms of loud cannon fire can be heard from the Oppai statue.


    Moments later, I notice several small metal balls flying in the direction of our base. As it came closer, it became bigger and bigger till it looked like some giant metal pillar.


    "RAISE THE ALARMS!!!! WE ARE UNDER ATTACK!" I hollered as our onlooking troops sprung into action.


    From what I could see, it was a matter of seconds before the first of those "things" landed. Realising one was targeted right at our Command Post, I jumped to the side just to get out of its path, with it crushing the tentage behind me.


    As I got back up on my feet, a section of the pillar opened up, revealing a company of CATs that were stuffed into it. As the CATs streamed out of the pillar, I took off my coat and grabbed my handgun.


    Backing in the direction that I remember to be the armoury, I fired a few shots at them. With the chaos of battle now brought directly to us, there is no longer any capability of command left to bog me down.


    "GENTLEMEN! It''s time for battle."


    - End of memory log 2: MG Simba -


    -----------------------------------------------------------------------------------------------------------------------


    - Memory log 2: LTC Aiel -


    "So..." says CPT Kaiki while rolling towards me on his chair, "any other performance you require of me? Want me to act like your bitch over there next?"


    "No. That will be enough for now. Take him down to his cell. I think we will be seeing the last of you for a while now."


    Spitting in a disgruntled manner, CPT Kaiki stays on his chair as the guards handcuffs him before bringing him out of the Command Room. As our staff resume their positions, MAJ Yuno creeps up from behind, giving me a surprise hug.


    "Dar-ling~. Did I do well again today~?" she whispers into my ear while weighing down on my shoulders with her arms.


    "Ahem. Yuno. There''s a time and place for everything. And speaking of which, did you disobey my order by leaving your position?"


    "Erhhh~but then the baddie would have gotten you. Trap you and slowly...slowly torture you..."


    "Maybe. Erm. Good work anyway. But next time, please don''t do it again."


    "Whatever you say, darling~!" as she releases her arms, allowing me to have breathe in relative safety again.


    Turning around, SSG Tony looks up to me with the hint of a smirk, but straightens up before beginning to speak.


    "Sir. Is this really a good idea?"


    "Well, at this point, everything in the message is true to the finest detail. Even now when we lost contact with Frontline HQ and MG Simba."


    "But the encrypted message did come from CAT High Command. Unless we have a snitch, it''s unlikely for our covert forces to have made it into such a position, isn''t it?"


    "This is a highly abnormal scenario. As such, going by one''s instincts would probably do a lot more good than anything else."


    "Mhmm...just like deciding to meet with a captive traitor directly?" adds MAJ Yuno from my side.


    "T-That was it too!"


    "And if I didn''t decide to follow you, you would have escaped safely and be back in command now?"


    "I would have! ...eventually."


    Giving me a smile with a hint of murderous intent, I finally gave up on arguing and pat her on her head.


    "All right. You did a great job. Now we have a job to do as well. Let''s give the Cat a jab it never expected."


    - End of memory log 2: LTC Aiel -


    -----------------------------------------------------------------------------------------------------------------------


    - Memory log 4: 2LT Redshirt -


    "CAPTAIN! MISS HATSUKO!" were the words I attempt to shout as CPT (CAT) Angel fires his ultimate attack, NYAA~CALIBUR.


    As a bright light filled the area, the last thing I saw was CPT Christian move in a flash from his kneeling position to standing in front of MRC DarkCloud. As the light became too bright for me to bear, I perform a 180 twist into a squatting position in order to protect my eyes.


    Keeping my eyes shut, I waited for a few moments till the light no longer shines through my eyelids. Resuming my previous stance, I looked to see what happened to the Captain and Miss Hatsuko.


    CPT Christian remained in his standing posture for about two seconds before falling forward as he spews a rainbow coloured stream from his mouth. Hitting the ground, a pool of rainbow coloured liquid formed around him. As MRC DarkCloud took a step back, CPT (CAT) Angel begins to speak.


    "Behold, my innocent will. G-Rated."


    "What...?!" replies MRC DarkCloud as she raised an eyebrow.


    "Isn''t the wonders of censorship and family friendly entertainment just so moe~~~ That is my special ability, G-Rated."


    "Soon this will become EXTREMELY R-Rated!" shouts MRC DarkCloud as she kicks the body of CPT Christian, sending him flying at CPT (CAT) Angel.


    Raising his sword, CPT (CAT) Angel cuts CPT Christian into two, causing an unexplainable amount of candy to burst from his body.


    "Isn¡¯t this just poi-" says CPT (CAT) Angel before he is interrupted by a series of explosions from explosive kunais thrown by MRC DarkCloud.


    "RED! NADES NOW!" she shouts as she runs in the direction of her mace that she had dropped earlier.


    Unauthorized duplication: this narrative has been taken without consent. Report sightings.


    Grabbing a Catnipade, I fling it at CPT (CAT) Angel, causing a gas cloud of catnip to form around him. As CPT Christian was defeated, his domain finally lost form as cracks filled the area rapidly.


    Reaching her mace, MRC DarkCloud lifts it up with some effort as her exoskeleton suit sparked dangerously. Realising the gas cloud should have moderately dissipated by now, I returned my focus to CPT (CAT) Angel, who was in the middle of raising his sword high for some attack.


    Raising my rifle, I fired at his arm to no avail. Fortunately, a stray round landed on his sword that appeared to disrupt his attack, causing him to twitch his CAT ears in anger. Having bought MRC DarkCloud some time, she now stood before the enemy CAT, swinging her mace upwards.


    As the giant spiked mace smashed against the side of CPT (CAT) Angel, MRC DarkCloud draws a hidden blade from her utility belt and throws it into Senkattou''s vicious grinding blades. Triggering some form of hidden mechanism, MRC DarkCloud jumps backwards to narrowly escape a direct blast as both her weapons exploded.


    Blown back by the force, she flew several metres, tumbling over the ground at least five times as her exoskeleton broke off in a few places. CPT (CAT) Angel, for some reason, was also blown away in the opposite direction into the sky.


    As he flew into the cracked skies of CPT Christian''s collapsing domain, the world finally breaks down and we are returned to our previous location before the Church.


    With our remaining enemy sent flying, CPT Christian''s body pieces itself back together as it returns to a realistic bloodied form. Looking over to MRC DarkCloud, she has already gotten back up despite clearly having taken significant damage as she wobbled on her feet with her exoskeleton making loud straining noises.


    Before I could run over to assist her, a blob falling from the sky above lands a few metres away, splattering some white substance around the place. As the two of us stared at the spot of where the blob landed, I realised a bunch of small unusual shadows over the area around us. Looking upwards, I see a few smaller blobs falling from above.


    "Miss Hatsuko! Watch out!" was the only thing I could shout as MRC DarkCloud throws an explosive kunai upwards, causing an explosion that sends the blob splattering all over the place, with a few drops landing on me.


    Running over to check on her safety, I stopped a metre away from her as she kneels on ground with her calves forming a V shape. As the explosion only stopped so much of the large blob from landing directly on her, the remainder has splattered over various parts of her body.


    Forgetting myself, I gazed at the awkwardly erotic sight before me till a murderous aura causes me to veer my head to the side in fear.


    Shivering in anger, she breathes in deeply before shouting, "HHHHHHHHHHHHIIIIIIIIIIIIIIIIIIITTTTAAAAAAGGGGGGGGGGIIIIIIIIIIIII!!!!!!!!!!!!!!"


    - User initiated log completion -


    - End of memory log 4: 2LT Redshirt -


    -----------------------------------------------------------------------------------------------------------------------


    - Memory log 2: SC Simon -


    "LIEUTENANT!"


    Warding off another strike of Vicious Blades from GEN (CAT) Nathanael, I turn my attention to 1LT Mark who was just sent flying due to a missile blast. However, the enemy before me wasn¡¯t one who I could treat lightly, taking advantage of my momentary drop in guard to close in, unleashing the fury of another combo upon me.


    "Simon. You have weakened. Has the years of being a NEET finally get to that physique of yours, or perhaps it''s the Fast Food nature of an Otaku?"


    "S-SHUT UP! You are no better, falling to the dark side within the dark side of Baka Tsuki!"


    "Silence! The darkness has always been my calling. On the contrary, you are the one faking his darkness while basking in the light!"


    "You do not even make sense anymore. Where has your love for pure Light Novels gone to!"


    Stretching my arms backward, I thrust my fists forward together at GEN (CAT) Nathanael. As he jumps backward in a futile attempt to dodge my attack, I released my fist and slap my palms together, producing a windlash that sends him flying a mile away.


    Turning around, I strained my eyes as I looked through the chaotic battlefield for signs of Mark or his yandere squad.


    "LEADER! BEHIND YOU!" comes from a direction from left as a warning of an attack.


    Jumping 50 feet into the air, I evade the sneak attack from GEN Nathanael. In response to my escape, Nathanael follows up with a special attack that I recognise to be Blade Tornado, a move that he completed after our joint training on Mount Erosica. Unable to move in mid air, his attack hits me head on in its endless slashes, causing me to slowly lose strength as I faint.


    "That is as far as the great leader of M-chan goes, huh."


    At this moment, a missile explodes behind him. Looking beneath me, I saw a girl swinging skillfully around a CAT mecha, causing it to misfire at specific locations. A sense of inspiration surged through my mind. Tightening my muscles, I let out a hearty roar, negating Blade Tornado.


    "This will be your shortcoming, NATH!" I shouted as I fall through the air, preparing for a groundbreaking move.


    Realising my intent, GEN (CAT) Nathanael leaps upwards using his ultimate defensive move, Eternal Sword Barrier.


    "ADDDMMMMMMIIIIIINNNNNNNNN JUSTICE!!!!!"


    "ETERNAL SWORDS! BARRIER GUARD!!!"


    In an epic collision, the two of us exchanged an infinite number of blows within the frame of a standard television animation. With my superior might prevailing, I finally deal a straight punch as the frame progressed to the next. Sending GEN (CAT) Nathanael into the ground, I land with a soft step.


    "Nathanael. These wounds you have dealt will be the scars I carry. Let this be the reminder of the bond we share." I say as a hundred small cuts appears slowly over my body.


    With the CAT mecha from earlier finally collapsing to the ground, the girl who I recognise to be a yandere soldier and an unknown male Alliance Officer runs towards me.


    "Sir! This is 1LT Jonathan! Are you all right?"


    "Jonathan, is it. I''m fine. More importantly, I see you have attained the ability to control a Yandere''s true power."


    "Thank you, Sir! But what of the enemy you were battling against earlier?"


    "Escaped, it seems." as I glance over to the now empty hole in the ground where I sent GEN (CAT) Nathanael flying to.


    Suddenly, several loud cannon blasts resound from the Oppai goddess behind me. Watching in horror as several large pillars flew in the direction of our Frontline base, I knew the enemy has become deadly serious.


    "Lieutenant! Another squad led by 1LT Mark was split up in this area. I order you to regroup with them before retreating to base. I will dispose of these menaces."


    Not giving him a chance to reply, I leap forward at the nearest CAT contraption, letting out a roar of manliness.


    - End of memory log 2: SC Simon -

 Chapter 15: Dodgy Intermissions

    - Memory log 1: MSG Viniance -


    Having been rescued by a CAT Officer, I now wait under the directions of my saviour in a large empty room that comprises of a ridiculously soft bouncy cushion for the ground. Thinking that this was just another hideout he arranged for me, I didn''t expect people falling from the endless dark ceiling above.


    Due to their landing, I was sent flying into the air as the five of us bounced off the soft cushion non-stop for around five minutes. When we finally stopped, I made my way over to nearest one at the fastest possible.


    Reaching his side, I found the man to be my former section mate in Basic Training, MAJ John. Checking for injuries, I found none other than a whole load of new scars all over his body. Shaking him for a bit, he begins to stir to a surprising awakening.


    "AAAAAAAAATTENT-SHUN!" he yelled as he sat up.


    "Ah...damn it. I heard you the first time." replies the voice from the direction of another guy as he gets up.


    Making their way over, the two crawl over the soft ground. Curious, I decide to crawl over to where the last guy landed. As I reached closer, the telltale sign from the amount of blood soaked up by the cushion reveals a corpse with a gaping hole through its torso.


    "BLARGH!" as I covered my mouth to prevent myself from puking.


    "Viniance, is it. Don''t mind our former escort. Got done in by Cat itself. We will avenge him later."


    Remembering what my given instructions were, I wave at the other three to get over here.


    "Sir! There is a way!"


    "A way to what?"


    "A way to resurrect him!"


    "Really now?"


    As they crawled over to help me with the body, I wonder just how much more madness will I have to go through before the end of this.


    - End of memory log 1: MSG Viniance -


    -----------------------------------------------------------------------------------------------------------------------


    - Memory log 1: GEN (CAT) Nathanael -


    The battle has reached its peak. With Full Deployment in effect, Cat must now be enjoying its short-lived entertainment from the roof garden.


    Even this I know, the Tyrant will soon tire of. This said, I know he has other plans up his plump furry arms. I must head back now that I have managed to distract Simon long enough.


    Using my superior agility, I made my way up the stairs in a second, passing by an Alliance Officer assisting a drenched female in a power suit.


    Avoiding the suspicious puddles over all the place, I arrive in the inner area and soon after, the grand lift lobby. Getting in a lift, my return to CAT Command is disrupted as the lift stops on the floor of the living quarters.


    "Good morning, General. How was your battle against old leader Simon?"


    "A bit disappointing. But that is expected of a mere warm up."


    "Oh. Well I''m sure you heard the cannons fire. Seems like Cat is off its knockers again haha."


    "So he is. Putra, I believe you have gotten your fair share of amusement by now?"


    "Not quite, Nathy. I''m not particularly pleased when Hitagi blasted away without due consideration. It''s an insult to a man to get sprayed on, no?"


    "Only when a man behaves like one."


    "AHAHHAHAHAHHAHAAAAaaa...you really know how to crack me up sometimes. But sorry, I will have you know that I''m not Simon."


    "..."


    "Don''t need to be all mopey now, Li-kun. Tell you what. I will tell you Cat''s true plan."


    "I already know."


    "Do you? Well, I suppose you might. Oh lookie, this is my stop. Got to release all them AV capturing bots now. Don''t want to miss on any potential good bit of action!"


    As the lift doors opens, CPT (CAT) Putra does a moonwalk as his exit while I make a light speed jab at the Door Close button.


    - End of memory log 1: GEN (CAT) Nathanael -


    -----------------------------------------------------------------------------------------------------------------------


    - Memory log 3: MG Simba -


    Unauthorized use of content: if you find this story on Amazon, report the violation.


    Having fought my way around the base in order to help as many of our remaining soldiers, I now find myself surrounded by countless numbers of CATs.


    "General! They got us surrounded! Your orders?" asks a male soldier, as he grips onto the metal pole he picked earlier as tightly as he could with his shaky arms.


    "Steady, men! Today is a bad day for a bad end."


    Clenching my fists, I realised that the only way to get out of this was to resort to my final move that I wanted to save just for the Tyrant.


    "Here''s the plan. As soon as I clear a path, run through it as fast as you can. It will be every men, women, and children for themselves from here on out."


    Closing my eyes for a short moment to clear my mind, I shouted "LET''S DO THIS!" at the loudest possible as the surrounding CATs charged at us.


    "M-CHAN! BESTOW UPON ME MY RIGHTS ONCE MORE! TO RESTORE THAT WHICH IS EROS!"


    Light particles gathered around me, taking form in my hands is a giant hammer. Before it fully forms, I swing it in a full circle before smashing it into the ground before me.


    "Bant. Hammer."


    With the charging CATs disappearing into thin air with a small billboard of light forming the words "User Banned", the rest of the CATs bends backward in fear as a passage forms from more CATs disappearing in the direction I struck towards.


    - End of memory log 3: MG Simba -


    -----------------------------------------------------------------------------------------------------------------------


    - Memory log 2: MSG Viniance -


    Placing the body of 2LT Syafri into a regeneration chamber, I proceed to lead MAJ John and the rest to an armoury as shown to me a few days before. Entering the armoury, the group was as surprised as I was at the amount of gear and arsenal that was laid out on tables and shelves all around.


    As we picked out our desired equipment, MAJ John asks about how I knew they would end up there. After a few minutes of explanation, the conversation took an undesired turn for me.


    "You were rescued by Lurker like us, you say. How did you even up there?" queried MAJ John.


    "I rather not talk about it. Let''s just say it started with my arse in danger."


    "Now you are just begging to get questioned. Hitagi was chasing you, wasn''t it." asks CPT Sanjay.


    "He''s THAT infamous, huh."


    "And of course any man in M-chan for more than a day would know that. I take it you were either the nearest object with a sizable hole or attempting some dumb heroic stunt."


    "You are surprisingly good at guessing this."


    "With Hitsun, it''s typically one of the two. More importantly, how did you get away?"


    "After running for over an hour at top speed, he was dangerously close as I risked it by running into an adult shop along the street. Turns out some CATs were having some NTR action with a human male and his girl."


    "He always hated Nerotare like that. Though he usually resumes the chase soon after."


    "I jumped onto a van loaded with many barrels of petroleum at the other side of the shop and it drove off shortly after I hid myself among the barrels."


    "Which led you to conveniently being found by Lurker in a coincidence later. Brilliant plot." notes MSG Khairul with a disturbing grin.


    Before we could go on any further, the doors slides opens. With almost instant reaction, the three of them had their guns blazing at the doorway. Emptying their clips, a voice interrupts them before they could reload. Proving to be a friendly, MAJ (CAT) Lurker walks into armoury, shutting the door behind him.


    "Firstly, you are very lucky I positioned the soldiers on all other floors except this one. Next, there has been so much internal disturbances that no one is alert enough to respond to that sudden barrage of noise."


    "Lurker-kun, I''m grateful for the timely assistance. But now my men and I have a Cat to slowly rip apart. So if you will excuse me..."


    "John. That isn''t necessary anymore."


    "Care to repeat yourself?" as he raises his recently acquired SAW-MK2.


    "You and your newly formed team have more important tasks to handle. And be glad, you will probably find this to be much more interesting than gutting a Cat."


    - End of memory log 2: MSG Viniance -

 Chapter 16: Feline Play

    - Memory log 2: GEN (CAT) Nathanael -


    Returning to CAT Command Centre, I find the Commanding Officer, MAJ Lurker, absent from his duties.


    "Who''s in charge here now?"


    "Sir! It is I, CPT (CAT) Catwalker nyo." before giving me a salute.


    "At ease. Where is Lurker?"


    "The Major went off to stop our god from firing the Nyaa~vastator. He has yet to return since nyaa."


    "And it seems he won''t be. I will take over from here. Brief me on the overall situation, Captain."


    "Sir! With full deployment in effect, our forces are overwhe-" before he gets interrupted by a loud Nyaa from a CAT manning a Comms channel.


    "What is it?" I asked before the Captain could protest.


    "Generaaa! A report has come in from the CAT commander attacking their Frontline HQ nyon! MG Simba is using some otherworldly power to terminate our forces in an instant nya!"


    "Law Enforcer, is it. Tell the commander on site to resume his attack. Simba will not be able to keep it up for long."


    "Yes, nyan!"


    Having Catwalker resume his report, I glance over the various monitors, anticipating the enemy''s next move.


    - End of memory log 2: GEN (CAT) Nathanael -


    -----------------------------------------------------------------------------------------------------------------------


    - Memory log 3: LTC Aiel -


    Temporarily leaving command to one of my subordinates as all contact with the frontline was now lost, I walk down to the prison cells to look for the imprisoned CPT Kaiki once more.


    With MAJ Yuno and squad of Kuuderes following behind, I now stand before the prison bars that separates me from the war criminal. Looking up at me with a disturbing smile, he raises an eyebrow when he sees the guards behind me.


    "Aiel! I guess you finally stopped relying on your tiny pair and got yourself a number of ladies to watch your butt now, huh."


    "Kaiki. Before I waste you right now, I suggest you perk up and listen clearly to what I am about to offer you."


    "Ohhh...." Catching his interest, he sits upright before saying, "Go on. Let''s hear what generous offer you have for me."


    "Under a section of M-chan''s unspoken law, any Alliance Officer ranked MG or higher has the right to declare an amnesty to a criminal on the grounds of irrefutable heroic deed."


    "You can cut the mish mash. Get to the point."


    "The point is," as I lean forward to show my seriousness, "perform the task that I''m about to give you and I will reflect this deed of yours to Simba, who will in most likelihood grant you the said removal of your charges."


    "Hmm. Hmm. Mighty good deal it sounds. And if the General chooses not to?"


    "Then you always have the choice of running before the battle ends."


    "HAHAHHAAHAHAA!!! Marvelous. Now if you will free me from these chains and equip me with a pistol and a ride, I will do whatever you ask."


    "Release him." signalling to the guard to free CPT Kaiki as I walk off.


    "And before I forget, MAJ Yuno here will brief you on your mission and ensure you keep your end of the deal first."


    "Oh. I will have these beautiful ladies for escort? Excellent."


    For some reason, I felt unusually bitter when Kaiki said that.


    - End of memory log 3: LTC Aiel -


    -----------------------------------------------------------------------------------------------------------------------


    - Memory log 2: 1LT Mark -


    - User heartbeat detected. Proceeding with electrical boost -


    Regaining consciousness, the first thing that I saw or rather, felt was air being blown into my mouth. Wanting to stop this unknown source of air, I jerked up my body upwards in an attempt to sit up only to knock hard against someone''s forehead.


    "Iitaaiii..." is the only thing I heard as I started to faint once more due to the throbbing headache I got from the hard collision.


    Before I could fully lose consciousness, a wave of slaps hits me violently. Sensing my life to be in grave danger, I pushed myself upwards while sitting up to avoid the attack. As I sat up, I felt my head pushing itself up between two soft fleshy pillars.


    "Aaarrhhhhnnn~~~..." was all the sound needed for me to realise which typical harem protagonist action I have just performed.


    Forcing my eyes open, the sight of 4 yanderes staring from above me with bloodthirsty rage affirmed my suspicions. Not wanting to make another rash mistake, I raised both hands up as I leaned forward before standing up. Turning around, I looked at the yandere who I just raised an unexpected flag with.


    Before any of them could say anything, I straighten out my hands into ¡°Stop hand signs¡± and asked where we were now.


    If you discover this tale on Amazon, be aware that it has been unlawfully taken from Royal Road. Please report it.


    "Lieutenant Mark, we are currently in the underground cellar of a former tavern."


    "We brought you here for shelter and tried to revive you as you wouldn''t get up after being caught in the earlier blast."


    "You were only gripping tightly onto your chest as we carried you here so we figured you might have had a heart attack!"


    "Since CPR was the best treatment we had to offer, we even decided on the order of giving you air!"


    "If you did not wake up for a few more seconds, we were planning to give you air from both..."


    "Okay wait. That''s about more than enough of what I really need to know." while giving myself a facepalm for the cliche I was now in..


    "Now if you would move aside, we need to punish the naughty girl who got extra service..."


    "Stop right there. I will reward the rest of you after this battle ends, okay? Please save your anger for the enemies..." as I resigned to the fate of having to amicably resolve this eventually.


    With a synchronous "Yes Sir!", I ask for our current displacement from SC Simon. Being a mere kilometre away, we promptly returned to the previous location of Leader to find a familiar face fighting off CAT forces that surrounded him and a female soldier.


    Using Formation Y, we dispose of CATs and several of their contraptions within minutes, rescuing the two from potential demise. Running over, he calls out to me and affirms his identity as my old friend 1LT Jonathan.


    "I thought you were posted to the outer regions?" I asked.


    "And I thought you were safely living it out in mainland."


    "Quite evidently not the case as you can see."


    "As always. Now SC Simon has ordered us to retreat back to base. But with the number of CAT forces falling from the skies and popping from the ground, it''s probably more of backing up."


    "We better get started then." I said as we begin running in the general direction of Frontline HQ.


    - End of memory log 2: 1LT Mark -


    -----------------------------------------------------------------------------------------------------------------------


    - Memory log 2: MSG Ahyaa -


    "Eagle 4! ON YOUR SIX! ON YOUR SIX!"


    Jerking the grip stick back as hard as I could, I held my breath as my jet goes upside down and back up, positioning me behind a sneaky Nyaacat. Firing all missiles, I score a lucky hit that cracks the creature''s pastry body, turning into bits of a smashed pop tart as it falls harmlessly.


    "I-I''m hit! I''M HIT!"


    "TAU 1 HERE! NEED IMMEDIATE COVER!"


    "This is Eagle 2, focus on evasive manoeuvres! Take them out when you get the chance!"


    "Easier said than done, Madam! I can''t get this...oh god it''s in front of---*static*"


    Watching as another one of my fellow pilots are taken down by a Nyaacat, that deviously planted itself in a position where no pilot would have had time to react from.


    With frightening durability and uncanny speed, their coordinated movement completed their domination in aerospace without the need for ranged weaponry. As our numbers dwindled, we now consist of 9 fighters and only 3 bombers.


    Zipping through a tight passage between 2 Nyaacats that tried to crush me, I emerge to spot Eagle 2, piloted by 1LT Mao, in a tight situation around several Nyaacats.


    Surprisingly, she dodges every stray bullet from the bombers attempting to support us while evading each of the Nyaacats that attempts to flank her into demise. Distracted by her elegant flight pattern, I nearly failed to notice a Nyaacat that attempts to ram me head on.


    Tilting my jet to the side for a bit, I notice a strange Nyaacat that was out of the lot moving forward at an even higher speed than normal. Realising its forward path would most likely result in a direct collision with 1LT Mao as she was distracted by surrounding Nyaacats, I desperately look for a solution.


    Spotting a Nyaacat on my trail, I released the air brakes and fired my back thrusters while tilting right, causing the Nyaacat to zip past me while scraping lightly the underbelly of my aircraft. Having its full attention now, I changed my course to head for 1LT Mao''s position.


    "MAO-SAN! COASTER DIVE PATTERN!!" as I close in on her from the side.


    Hearing my command, she immediately turns in my direction as we execute a 45 degree dive downwards just a metre away from crashing into one another.


    Not being able to react in time to our sudden manoeuvre, the Nyaacat chasing me collides head on with the Nyaacat that was about to hit her. As they two got stuck onto each other, they collide with three more Nyaacats before receiving a direct blast of missiles from Mao-san.


    "G-good job there. But remember who''s in command here!" says Mao-san, flying off to help another fighter before I could say anything.


    - End of memory log 2: MSG Ahyaa -

 Information Chapter #003 - Summarised History

    Welcome to the--nah, we won¡¯t be going with that standard entry this round.


    So if you have made it this far, you probably noticed that the story is pretty much whacko with a sprinkle of uh...typical kid¡¯s adult story.


    Sounds weird? Tell me about it. Remember all those cartoons with really big explosions and the city getting blown up? We always gloss over the fact that someone should really have actually died when all those things happen and just mention all about how the heroic kids saved the day and all. Better still, no one dies.


    Then we have slightly more realistic ones that tells you that people actually got hurt or died because they were not careful enough. But let¡¯s face it, no real kids story have time for some deep drama.


    And of course, adult because of all the talk of violence, sex, and morally dubious acts.


    Honestly, I got nothing for you all in this chapter, ironically.


    There was some talk (not here, obviously) about doing some character sheets for the more prominent characters, but not in a long shot, from what I see.


    Plus we are about two thirds done now...oops, spoiler?


    ¡­


    Oh wait, there is a script here¡­


    It says to briefly cover the history of M-chan. Like the more realistic one.


    Okay then. For anyone expecting a continuation of the story, please tune in next week for an actual update.


    For anyone else who is bored enough or genuinely interested, do read on.


    Q: Is BT, as written as Baka Tsuki, really that one which most LN translation seekers should know of related to this story?


    A. What do you think?


    Q. Why is there so much rape and violence?


    A. Because there is?


    Q. How did this turn into a Q&A?


    A. Because someone swapped out the remaining script. Let¡¯s get back on track.


    How this story came about:


    Before Royal Road, the original version of the M-chan Wars was completed sometime in early 2013, if I still remember correctly.


    So yes, whatever that is being posted here now belongs to some complete document of the wars.


    Now, there is no plagiarising going on as it was all written by me (mostly, ideas came from all over) so not need to worry about that.


    Basically, this war is pretty much the most complete thing that can be legibly read so its contents are edited for major errors, meaning you shouldn¡¯t see any more lines that completely make no sense or is obviously a typo.


    This does not include abnormal usage of tenses, as you might have noticed.


    As for the true origin of this tale, the original document does have a more conclusive list of credits and whatnot. But I will leave it to you to find it if you are really interested to know more.


    This content has been unlawfully taken from Royal Road; report any instances of this story if found elsewhere.


    Credits aside, this all started from someone ¡°shitposting¡± like a madman, attracting even more men responding and finally, a complete whacko who made it all into an out of world comprehensive text that is somewhat ashamed to call itself a light LN. (No, there is only webnovels, not light LNs)


    Going on, like how nonsense go a long way in places like 2chan, 4chan, and in a more formal concept, reddit and so on, the pieces all came together and this was once a really active tale that has story updates of a length similar to webcomic One Punch Man of today but a lot faster because I was technically free (and motivated) back then.


    Okay, enough about this. Let¡¯s talk about the people of the Moon.


    M-channers:


    In its early days, the Moon was a place of sharing information, as with most groups. The main focus was on LNs, and obviously very specific doujins and games.


    From time to time, highly opinionated members would spew their fair share of nonsense, turning an ordinary post into a hot comment stack of flaming turd.


    This process is known as derailment, often followed with pictures of train accidents with the train goes way off track.


    But of course, the rape train never stops. Leading us to trains that do not run on tracks, and derailment is a way normal course for any train on the Moon.


    Point is, many other smaller skirmishes occurred in early M-chan days prior to this war, where a significant number took place in over the norm and got blown out of proportions.


    As M-channers would put it, no BBQ party can end with clean up if a grenade is thrown onto the pit after the first hot dog.


    Time and the Moon:


    Like with every good community, nothing lasts forever.


    As of today, M-chan can be considered as dead. The empty shell that remains is nothing more than a gravestone in the cemetery of the Internet.


    So why write all this?


    Well, because I can, I suppose.


    This said, every grave has its tale. And no cause is lost as long as there is one fool to fight for it. (Ripping off a certain movie, yes)


    No worries though. Whatever is left today still does bits of what it used to do. Except the people who remain are like old men doing old things, waiting to pass on.


    TL;DR: (It means Too Long; Didn¡¯t Read)


    I will not waste anymore of your time and mine, concluding this little bit.


    If anyone has any question (I doubt it), do post here and it might get addressed.


    To the end and hopefully, the next war for Eros.


    - asm -

 Chapter 17: Convoluted Puppetry

    - Memory log 2: CPT (CAT) Angel -


    *Huff* *Puff* *Huff* *Cough*


    Running down the street, I make my way through a distant town from the Church as I return to my position after getting blown away by earlier. Due to my ability G-Rated, I escaped the fatal attack by getting blasted away in a comical manner. Although I did not land too far initially, G-Rated prevented violent splatters by converting them into harmless bounces which leads to my current predicament.


    Having been baptised by our CAT Majesty, Sumeragi VI Tirtha, my body has become chubby with the fluffiest fur I have ever felt. As a result, I now find myself unable to make quick movements over long distances, as even my slowing running pace turns into a cool down walk.


    As I damned my incapacity for cardiovascular activities, my pointy ears twitched with great ferocity as I listen to the sound of vehicles approaching from behind me around two kilometres away. Stopping to catch my breath, I ready myself for the likely foe that approaches.


    When the vehicles came into sight, I recognised them to be Light Troop Transports using by the Alliance to move their soldiers over great distances over a short time. Spotting me as I gripped onto my Nyaa~calibur, they slow down and pull up at about 50 metres from me. To my surprise, CPT Kaiki alighted from the first transport and casually walks towards me.


    "What is the meaning of this nyo. What are you doing in an enemy vehicle?" I queried as he closes in.


    "Angel-kun. Why so tense? Rejoice! For the Alliance has fallen and these vehicles here are but the first of reinforcements from our side attacking from behind~"


    "Is that so? I haven''t heard anything about this from our CAT god." eyeing him cautiously.


    "The enemy wouldn''t let a person they consider to be a felon walk freely, now would they?" shrugging his shoulders.


    "Your point is made." I replied before lowering my sword but not my guard. "Now let us go. Our god''s sacred grounds has been compromised."


    "Hold on a moment there, big guy. I''m afraid we''re fully loaded so you are going to have to walk."


    "Have some of your men disembark then. My return takes precedence."


    Before he could reply, a female Alliance Officer gets off the vehicle and briskly walks over towards us. Looking at CPT Kaiki once more, he sighs as I draw my Nyaa~calibur.


    "What is the meaning of THIS?! Have you betrayed his furriness expectations of you?"


    "Hey now. The two of us had a mutual agreement to work together as long as our goals were aligned. He expects nothing more~"


    "Kaiki. I always knew you couldn''t be trusted."


    "Tch. You have wasted enough of my time. Now be a good pussy and move aside so that we can do in that fool of a Cat."


    "What did you say." were the only words I found myself capable of mumbling as I felt an uncontrollable anger burst out within me. Though my ability only changes to a varied form when something I cannot tolerate happens, I was surprised to find myself turning at the thought of Cat getting killed despite not doing so when my fight earlier ended in an indirect defeat.


    As the last of my rational mind fades away, I watched as CPT Kaiki look at me in disgust before backing away in fear.


    Awkwardly, my final vision was that of me hitting the floor after the female Alliance Officer disappears from my sight...


    - User consciousness fading...terminating log process -


    - End of memory log 2: CPT (CAT) Angel -


    -----------------------------------------------------------------------------------------------------------------------


    - Memory log 3: MAJ (CAT) Lurker -


    Arriving in the lower levels of the Oppai statue, a company of CATs followed their commander and me as we walk to the Lower Guard Command Post. As we reach the stairs leading to the Command Post, SSG Lite walks down with great pace in order to receive us.


    "Major. Lieutenant. I have more than enough fine men with me guarding the entrance to the higher levels. May I ask what is the purpose of your visit?"


    "Staff Lite, it is precisely that you have fine men and are a great leader yourself that I''m reassigning you to guard the upper levels now."


    "Excuse me? I believe I was directed by the General to hold this area and there hasn''t been any reports of intrusion on the upper levels."


    "Then you are not duly informed, Lite. The upper levels have been breached and the CAT god has been disturbed by human plebeians."


    "Is that so. I apologise for my failure in letting some slip past, Sir. Allow me the chance to redeem my honour."


    "That you have. Lead your men to the levels beneath the roof garden."


    "But we will need some time to study the layout of the upper levels as we have never been there before."


    "Don''t worry. I will personally assist in setting up your manning of the upper levels. Also, have your men arm themselves with anti-air and close quarters gear."


    "Sir. Not to question your command but anti-air equipment?"


    "Yes. We believe the enemies might make it through by aerial means. Having your men use the anti-air weaponry to take them down before they do."


    "Affirmative, Sir. Just one more thing. Is First Lieutenant Nyaadere to take over this position?"


    "Well, he sure isn''t here for show."


    "If I may Sir, I recommend leaving some of my men here to assist in manning this position as they have been-"


    "That won''t be necessary, Lite. The upper levels need all our elite guards that we have." I reply before SSG Lite could finish.


    A case of literary theft: this tale is not rightfully on Amazon; if you see it, report the violation.


    "But-"


    "Lieutenant Nyaadere here will assume this position as ordered and figure the rest out."


    "Yes nyaa~ Now why don''t you be on your way as commanded, Staff Lite." adds 1LT Nyaadere in an attempt to assure me of his competence.


    "Yes Sir!" replies SSG Lite and he walks off heavily in subtle display of reluctance.


    "Nyaadere. Try not to fail his furriness this time."


    "Yes nyaa!" replies the CAT Officer.


    Following SSG Lite as he moves out, I pray for the success in the following parts of our plan.


    - End of memory log 3: MAJ (CAT) Lurker-


    -----------------------------------------------------------------------------------------------------------------------


    - Memory log 1: CPT Kaiki -


    Reaching the outskirts of the large battlefield, there is the area before the gates of the Church. Our transports skilfully avoids the CATs'' presence by driving inside through the wide crack on the hardened earth of the war zone.


    Driving in deeper, I figured our luck was running thin as Alliance forces were hardly present with CAT forces in overwhelming numbers. As I fiddled with my Military Blade in contemplation of defecting once more, the lady officer assigned by Aiel puts her pistol at my head as if she was reading my mind.


    Having not even the choice of thinking about the matter at this point, I suggest abandoning the transports in one of the nearby ruins of living quarters that was previously used as a town for the lowest ranking CATs.


    Nodding in acceptance of my suggestion, I instruct our loli driver to head towards the nearest potential garage. As we got off the transports and made final preparations to join the battle, I could feel the aura of SC Simon permeating through the area, an indication of his Hercules mode working at top form.


    After MAJ Yuno instructs the second squad of Kuuderes to split into groups to distract CAT forces, we set off with a small group of our own with CPT (CAT) Angel being rolled along on in cage. Completing a 15 minute three kilometres odd run, we closed in on our objective.


    With two CAT mechas holding onto him, a CAT tank blasts away at Alliance Leader Simon. When the tank runs out of shells, the pompous man yells "Is that all you monsters got?" before breaking free by ripping the mechas'' arms off. Making short work of the damaged mechas and tank, he turns his attention to us.


    "Kaiki. I remember giving an order to have you confined as a war criminal till your court martial. Seems like you want me to personally send you off, don''t you?"


    "Please, mighty Simon. Even a dog has its day, much less a Cat. Besides, you never really thought you could lord over M-chan forever, now did you?"


    "Time to put the animals in their place then. Come. I will take all of you on right now."


    "Hold your blonde steed there. Let me introduce you to the sleeping beast here that we awakened just a while back just for you."


    "A measly CAT. Even a handicap of having all of you at once won''t make a difference, much less one of you."


    "Oh...but you will find this...more than fulfilling." as I jabbed the sleeping CAT with a syringe of concentrated Catnip.


    Back away quickly, we watched as CPT (CAT) Angel rose to his feet, changing his brown fur to a deep black as his body and sword slims down greatly in size. Opening his glistening red eyes, he focuses on SC Simon who emits his manly battle aura.


    Leaping straight at him, the cage that contained him is cut up into many slices without him making so much as a visible move to cause that. Realising its power, SC Simon executes a punch just in time to ward off the first attack and the two immediately follows up with an exchange of light speed moves.


    Before we could have the pleasure of watching the intense battle before us, gun fire from behind us catches my attention. Turning around, I spot the small group of Alliance soldiers that was the source. Taking down a CAT mecha, they head over towards our position.


    "Look like some fighting is on its way. Isn''t that right, Yuno-chan?"


    "Time to do our share of work then. Ah, and if you call me that again, my dear Aiel won''t have to hassle over your problem with any general~"


    "Ohh...scary. Just the kind of thing that turns me on." I add as the group of soldiers reach us.


    "Madam! Sir! 1LT Jonathan here. Next to me is 1LT Mark and behind are our Yanderes. We are here to back Leader Simon up."


    "Ah yes. Well Lieutenant, as you can see the Supreme Commander over there is fighting against something we cannot hope to assist with. Besides, we are here to back him up in a different way."


    "Pardon my crudeness, but what do you mean by that?" asks 1LT Mark.


    "By what~?"


    "Everything." as he raise his rifle.


    "Haven''t they taught you not to point that thing at friendlies?"


    "All I remember is the order to have you sent back to HQ for imprisonment."


    "Oh my. Looks like the gig is up then." raising my own tactical shotgun to aim at them.


    Diving to the right as 1LT Mark took the first shot, I executed a barrel roll as I fired special electrical rounds at them, which would cause a lasting stun or not death for the faint hearted.


    Pulling two yanderes back as he dodges, they successfully evade my attack as well. Looking at MAJ Yuno, she stares down coldly at me before giving the order to attack.


    "Well well. This is gonna be fun."


    - End of memory log 1: CPT Kaiki -

 Chapter 18: Eros within the Chaos

    - Memory log 4: MG Simba -


    "Arhhhhhhhh!!!!"


    "General! Go on without-ARGH!"


    "Blasted creatures. Have another round then. BAN HAMMER!"


    Wiping out another group of pursuers, a new group appears from round the corner and resumes their pursuit. With the number of survivors before me reduced from over 20 to a mere 4 now, I figured that it won''t be long before they are all wiped out as well.


    With the base in shambles and a new pillar occasionally landing, we have yet to make it out of the extensive base that we set up for a full scale assault. Using up a lot of my ability Ban Hammer, I could feel the limits imposed upon me by the system closing in on my powers as it dwindled.


    At this rate, I will not be able to use Ban Hammer for the confrontation against Cat itself. I wonder if Simon has enough power by himself to banish the feline fiend from this world.


    In a moment''s folly, I failed to keep track of the groups of CATs flanking us as they finally surround us once more. With their commander yelling the command to fire, I watched as the last four are mowed down in front of my eyes.


    "YOU BASTARDS!!!" I yelled as I unleashed a wave of Ban Hammer.


    Wiping out the first line of CATs, I felt a tightening force pressing down on me as the limit of administrative actions are reached, ending my attack prematurely. Kneeling on the ground, I gritted my teeth in anger but realised that I was now powerless in the present situation.


    Looking up, I look at the CAT commander talking to its deputy as they stood on a CAT mecha. Through lip reading, I could roughly understand what they were saying.


    "Do we capture their general?" asks the CAT commander.


    "Nya! There seems to be some interference and I cannot reach Command."


    "It would be wise to do so...but we have no orders nyon."


    "Sir nyo! Command''s last orders were to kill all on sight. I recommend killing him first and using his corpse as a sign of our victory nyo!"


    "Mmeeooww...that is an idea there. All right. It''s in line with our last orders anyway."


    Really now. And I was pretty sure no one would be dumb enough to kill off an enemy high commanding officer that they have secured without first torturing them for information. These CATs are darn stupid after all.


    Keeping that thoughts in mind, I stood up once more as they aimed weapons at me. Closing my eyes, I resigned myself to the bad end before me till I heard sounds of fighting closing in once more.


    Opening my eyes, I watched as the CAT commander frantically ordered his men to fire at the oncoming armored tank. Before the CAT mecha could fire a missile, the tank fires its double barrel main cannons.


    Blowing up the mecha and killing the CAT commanders in the process, I ducked down as its sub machine gun turrets mowed down the fleeing CATs. When it finally stops firing, I got back up to see a jeep driving up to my side.


    "General Simba! How have you been?"


    "Better. Now how long are you going to stand above me, Colonel."


    "My apologies, Sir." as LTC Aiel jumps off the jeep''s back.


    "So I suppose you will be starting with an explanation as to why you are here."


    "About that. A serious issue popped up and coming to the frontline would be for the better good."


    "Figures you didn''t have the balls to say that you were coming to save us. Now give me an update."


    "Righty-o. But before that Sir, please add this sticker over your Mem-chan pads."


    "Aiel, I''m going to hold back on telling you how wrong that sounds but you better have the name changed when we are done with this."


    Placing the stickers onto the pads, I could hear some static before a beep came with the request for a Comms channel to open.


    ["...General. Do you read me?"]


    ["Loud and clear."]


    ["Sir. Additional land and air forces have arrived from the other regions. As we have lost contact with the earlier deployed aircraft, we currently have a total of 150 fighters, 64 bombers and 30 troop transport class."]


    ["Good. Have the transports loaded up with full assault teams. What of the earlier two I asked you to ready?"]


    ["They have been on standby and are ready to go, Sir."]


    ["All right. I want them deployed right onto the Oppai statue. Also launch all aircraft to provide support. Bombers are to strike the massive groups of CAT forces. Once the remaining transports are ready, deploy them at the statue as well."]


    ["As you command. As for land forces, we have-"]


    ["Deploy all of them to support Frontline HQ. We have been badly hit and the troops here are in dire need of assistance. That will be all."]


    ["Affirmative! Over and out."]


    Looking at LTC Aiel, I was tempted to demand an explanation but realised he would be of better use elsewhere. Jerking my head to the right, I motioned to him my implicit approval of his subsequent actions.


    "Thank you, General Davis!" he shouts before jumping back up onto the jeep and having it drive off.


    - End of memory log 4: MG Simba -


    -----------------------------------------------------------------------------------------------------------------------


    - Memory log 3: MSG Ahyaa -


    "Oh god darn it."


    Making an attempt to assist the last bomber remaining, I risked myself by making a dangerous manoeuvre only to watch the bomber blow up as a Nyaacat crashes into it. As the critter broke into uncountable bits, I lamented over the fact that we have just failed in our mission.


    "All remaining fighters, regroup as we fall back. There''s no point in fighting a lost battle."


    "Madam, I don''t think they are planning on let us go." replies another pilot.


    "We will lose them in the city area. For now, concentrate on getting away. Ahyaa, get in touch with HQ and report our situation."


    Seeing as I was the only one without a Nyaacat on me at the moment, I flipped the switch to attempt a connection to HQ. To my dismay, all I got was endless static before it went dead silent after a few seconds.


    "Lieutenant Mao. Looks like Comms is down as well. HQ ain''t picking up from here."


    "I see. For now, let''s head for the-AHYAA! BEHIND YOU!"


    In response to her sudden warning, I jerked the grip stick at my fullest as I performed a loop just in time to evade a Nyaacat flying towards me from behind at full speed. Hearing a loud creaking noise, I try to move the grip stick in vain after my last stunt.


    Realising that I was doomed, I looked over to the other three fighters that remained. Looking at the fuel gauge for the first time in this battle, I discovered that there was no way to make it back to Alliance HQ, even without having to evade those monsters.


    Estimating that even with our boosted thrusters, we would at most be able to provide support for Frontline HQ for a couple of minutes before needing to make a forced landing. Clenching my teeth, I made a decision that I would have never considered before.


    "Mao-san. Please head over to Frontline HQ with the rest. I think they will be needing our help with the number of pillars dropped over there."


    "Ahyaa-kun. What are you-"


    "JUST DO IT! I...I will get these things off your tails. They seem to prefer chasing us when we go in a straight line."


    This narrative has been purloined without the author''s approval. Report any appearances on Amazon.


    "AHYA-"


    Knowing I wouldn''t be able to bear her reply, I shut off communications before grabbing onto the grip stick again. Using everything I had in me, I forced the grip stick to the right to turn in the direction of the Oppai statue and jammed it forward.


    In my last shove, the grip stick could take no more and broke. Seeing as my fate was sealed, I smashed the glass panel and pressed the red button behind it.


    The extra thrusters roared to life as they sapped whatever remaining fuel and energy left in this jet, sending the jet flying forward at beyond the normal maximum speed.


    Grabbing my pocket mirror, I could see the other jets being rapidly smaller as the Nyaacats clouded my back view in an attempt to catch me.


    "That''s right. Come to momma."


    Looking forward once more, I noticed I might have miscalculated a little as my current vector would result in a head on collision between the Oppai of the statue.


    - End of memory log 3: MSG Ahyaa -


    -----------------------------------------------------------------------------------------------------------------------


    - Memory log 1: CPT Sanjay -


    *DING* "Basement 12. Basement 12." *RUMBLE*


    Leaving the comforts of the posh elevator, I walk into the cold electronic systems hall. Glancing off the side of the metal grid panel I am on, I could see the floor at about half a metre below.


    "So this is what they mean by inner workings, huh."


    Recalling the directions given by Lurker, I begin running towards the core server room, where the entirety of M-chan mainland is controlled from. Without so much as an obstacle, I soon found myself before a blast door.


    Keying the given pin number and scanning the access pass I was given, the door opens and reveals a 15 metre odd long corridor. Placing my handgun in its holster, I grabbed two smoke grenades and readied myself for the challenge to come.


    Halfway through the corridor, the door I entered from slams shut and the laser array defence activates. Cursing under my breath about its actual existence, I released the safety pins and flung the two smoke grenades ahead.


    "This better work! AAAAAAAAAAHHHHHHHHHH!!!!!" I shouted as I dived into the smoke that floods the area of corridor where the lasers passes through now.


    Making it through to the other side, I waste no time and press on the button panel by the side. Feeling something unlatch itself, I could feel the entire corridor begin turning.


    "What the-" was all I could say as I saw the optical smoke clear, revealing the laser array coming back in my direction.


    Pulling out another pair of grenades, I tossed them forth once more and leapt through the smoke cover. As the smoke had less time to form this round, I could feel several spots of laser hitting me lightly as I made my way through.


    Dashing back to the original entrance, I waited for about 5 seconds before it opens up to my relief. Not wasting any time, I run through the doorway and shut it behind me.


    Collapsing onto the ground, I sigh a breath of relief before feeling some pain coming from several spots that were lightly torched by the lasers earlier. After affirming that I have not lost any body parts, I got back up to complete my mission.


    "Well, this is peculiar. And I was expecting something that spawned out of Psycho Pass or Resident Evil again."


    Before me was a dimly lit hall with monitors on all sides and multiple racks of servers that hummed softly within their glass casing. Making my way down the middle path, I reach the circular platform that was the control panel for M-chan mainframe.


    "Now let''s restore balance to the force." as I key in the commands to return administrative rights to the previous list of users.


    Hitting the Enter key, a siren went off in the entire place. With a wicked "NYAHAHAHAHAHA", the monitors changed to the imagery of Cat.


    "NYAA~Looks like we have a rat. While I can''t prevent the list from being changed nya, I can set the maximum delay of 20 minutes. So if you get killed by the security bots nyo, then the inserted command will be undone! NYAHHAHAHAHA!!"


    With the Cat disappearing from the screens, I could hear the shutters in the dark ceiling above opening as security bots swamped the room.


    "Time for the years of training to pay off." I said to myself as I steadied myself to survive for the next 20 minutes.


    - End of memory log 1: CPT Sanjay -


    -----------------------------------------------------------------------------------------------------------------------


    - Memory log 2: MAJ John -


    "Khairul! Set up another load of charges on the second shutter! Viniance! I need the delay chains linked up in 5!"


    Busying myself with the placing of miniature remote mines over multiple barrels of petrol sitting all over the place, I must say that I am impressed by the elaborate setup that was made by Lurker beforehand.


    With MSG Khairul completing the C4 placement and MSG Viniance making the final touches on the linked delay fuse, we gathered at a sidedoor of the underground facility.


    "You know, with the amount of equipment just lying around in these hangers, it''s a wonder Cat didn''t try harder to use them." comments MSG Viniance.


    "The fickle tyrant has its way with things after all."


    "Lurker did say Cat didn''t want to bother with the hacking because it didn''t like the design to begin with." adds MSG Khairul.


    "What that Cat does is not of my concern. Let''s get on with the explosions so that we can start the killing."


    "But the intention is to have the shutters opened for the autonomous machines to take flight, right? Won''t they all be blown up?" asks MSG Viniance.


    "Not an issue. Even on standby, their auto response shielding should block off most of the damage. Plus the additional blast resistant sheets should help a bit."


    "LET THE FIREWORKS BEGIN!" shouts MSG Khairul as he presses down onto the detonator.


    Taking to our feet, we ran upwards as fast as we could. About a minute later, we could feel the tremor as explosion after explosion went off beneath us.


    "Viniance! Which is the nearest armoury from here?!"


    "Another floor up! It''s the security room near the grand lift lobby!"


    Busting out the door of the stairwell a level above, we surprised a group of 5 armed CATs from behind. Before they could react, we gunned them down with our handguns.


    "Weapons!" squeals MSG Khairul with delight as he runs over to pick up a pair of rifles from the dead CATS.


    Looking over at me, I declined his offer to dual wield rifles by unslinging the heavy machine gun on my back. Moving through a series of corridors, MSG Viniance leads us out of another sidedoor.


    Walking into the posh hall that was the grand lift lobby, our company of enemy CATs soon turned up from other hidden sidedoors.


    Making a quick dash for a counter, we dived for cover as a rain of bullets poured down on us. Pulling out a Catnipade each, we looked at each other before tossing them out.


    "Let the fun times begin." as we got up and fired with everything we got.


    - End of memory log 2: MAJ John -


    <hr />


    We have a slightly longer chapter today, and I will also announce first that there will be no update next week.


    The reason is mainly personal and related to real life, but it''s partly due to another piece in the works.

 Chapter 19: The Tyrants Twist

    - Memory log 4: MAJ (CAT) Lurker -


    "Putra. What is the meaning of this."


    "Nothing much, Lurker-kun. Just wondering when you were going to show up and here you are."


    As I stared at the man leaning back on a chair in a sloppy manner before me, he gives me a cynical look before getting off his chair.


    "This is all but a waste of time, Lurker. Cat will achieve his goals and M-chan will forever be changed. Now if you will excuse me, His furriness awaits." he says while walking pass me.


    With the onlooking CATs in the Nyaa~vastator control room watching us, CPT (CAT) Putra walks off with an exaggerated laugh. With him gone, the rest of the CATs return to their work as one of them walks up to me.


    "Sir nyo. What can we do for you?"


    "As you will." as I put my handgun to its head and fire.


    With the CAT falling backwards onto the floor dead, the rest of them looks at me in horror as they begun to run.


    "MAJOR! Why-" asks another CAT before he is silenced by a head shot.


    Gunning them down one after the other, the other CATs fall one after the other without making it to the door. Stepping out of the control room, the other CATs work on the Nyaa~vastator look at me in wonder of what happened in the control room.


    Reloading, I begin firing on them as well. Despite their attempts to call for help or get out, they failed as the jamming devices have already been placed around the area along with the doors being locked and controlled by the remote in my pocket.


    As the guards have been reassigned from the room, there was nothing that could stop me in the massacre of CATs. Confirming the number of dead CATs, I replaced my handgun into its holster as my first job here is done.


    Grabbing a Fire Axe from a fire emergency box, I proceed to release the securing latches of the Nyaa~vastator, cutting open gas pipes around the room by smashing them with the axe.


    With the last of the latch released, I then set the power grid to overload on firing the device before leaving the area.


    - End of memory log 4: MAJ (CAT) Lurker -


    -----------------------------------------------------------------------------------------------------------------------


    - Memory log 5: 2LT Redshirt -


    Chancing upon an abandoned workshop on our retreat from the Church, I now wait as MRC DarkCloud works over a workbench and a furnace that she started up using some weird weak explosive device that caused the surrounding material to heat up to ridiculous temperatures.


    Completing some component she was working on for the past half an hour, she sits down on a stool before powering down her armor. Staring at me, I realised her intention to remove her armor to make some quick repairs on it. Running to the corner of the room, I sit down on the floor behind a wooden table.


    "If you look over here, you will die a slow painful death. Well, it''s not that I mind either way."


    "Haha. I value my life too much for that which I have already seen."


    "Gaining some character there at last. But I must say you have quite the death wish just for that."


    "Heh." was all I could manage as I felt the strings of tension that kept me going loosen up and I fell into a deep sleep. Though it must have been short, I couldn¡¯t help but dream of my entire life up till now.


    By the time MRC DarkCloud came over to wake me up with a wicked blade lightly cutting at my throat, an hour or slightly more had already passed. Putting behind this weird dream death flag, we left the workshop to continue our retreat back to Frontline HQ.


    "Red. Looks like there''s some fighting ahead."


    "Seems like it. But you aren''t in any shape to do battle now."


    "Good enough actually." before her armour begins to hover again and zooms off ahead of me.


    Running for a bit, I recognise our Leader in the distance fighting against some fast moving black shade. MRC DarkCloud moves in to attack the creature and soon, the both of them are in combat against the speedy thing.


    Shouting "FIST OF THUNDER", SC Simon knocks the creature away with a powerful punch, causing it to land 20 metres away stunned. Looking at the thing in one place for the first time, I could see it for the ferocious dark fur beast it was.


    "GGGRRRRRRrrrr....RRRRRRAAAAAAA!!!!!! TIRTHA-SAMA!!!!!!!!!!!!!!" roars the beast before it resumes its attack on Leader Simon and MRC DarkCloud.


    Not daring to fire in fear of hitting a friendly, I stood there and watching helplessly as they fought a high speed battle. It wasn''t too long before the makeshift weapon crafted by MRC DarkCloud shattered when she wards off another claw attack.


    Being knocked back by the previous attack, the beast follows up with a series of attacks that sends her flying. Giving SC Simon a high kick after dodging his punch, the beast slows down and poises itself for some special attack as dark particles gathered around it.


    Spotting my chance, I fired at the eyes of the beast hoping to blind it at least. To my horror, the bullets bounced off an invisible field half a metre away from it with a few grazing me on the arms.


    Having charged up its attack, it leaps forward to pounce upon the recovering MRC DarkCloud before she could get to her feet. The next few moments flashes by as I watch SC Simon jump in front of her, catching the beast''s drill attack with his hands.


    As he held onto the creature''s spinning claws, his hands begins to bleed for the first time I have ever seen. With my calling beckoning me to take action, I sprint forward towards them.


    This content has been misappropriated from Royal Road; report any instances of this story if found elsewhere.


    "YYYYYYYYYYYYYYYYYAAAAAAAAAAAAAAAAAAHHHHHHHHHHHHHHH!!!!!!!!!" I shouted as I rammed into the beast from the side with a shoulder tackle.


    - User consciousness lost...awaiting nerve response -


    - User brainwave detected...re-initiating log process -


    With my...vision slowly returning, I tilt my head up to see SC Simon and MRC DarkCloud looking in shock. Wondering what they were looking at, I lower my head to see ivory black claws sticking out of my chest.


    Without feeling a thing, I watch as the claws pull backwards as my body collapsed onto the ground. As a pool of blood forms beneath me, I look up once more to see them fighting the beast again as my vision fades...for the last time...


    - User heart signature not detected -


    - User consciousness fading...terminating log process-


    - End of memory log 5: 2LT Redshirt -


    -----------------------------------------------------------------------------------------------------------------------


    - Memory log 2: CPT Kaiki -


    "Meh. Looks like I''m not needed anymore."


    With MAJ Yuno getting up close against 1LT Mark & 1LT Jonathan, she has since been single-handedly beating the two down after removing their weapons by force. Moving over to SC Simon''s location about half a kilometre from here, I arrive to find him with 2LT Redshirt and MRC DarkCloud.


    "Hey now. Don''t give Perez all the fun now-" I said to myself before stopping as RedShirt tackles Angel from the side, sending the both of tumbling over a distance.


    CPT (CAT) Angel gets up soon enough, looking enraged from the disturbance as 2LT Redshirt lay on the ground with multiple cuts opening up over his body. Before anyone could make a move, Angel uses his claws to impale Redshirt through the chest, lifting his body in front of him.


    "Oh boy. So much for the grand plan." I said as Angel tosses the body aside and leaps forth to fight Simon and DarkCloud again.


    "HEY! SIMON! YOU SURE YOU HAVE TIME FOR THIS?" I shouted as Simon knocks Angel with an explosive punch.


    Looking up in the direction of the sky that I point at, dark clouds begins forming over the entire sky, blocking out the sunlight that shone down upon us just moments ago.


    "Your point, Kaiki."


    "Sumeragi hasn''t been waiting around. This is the beginning of his true plans. I mean come on. Great evil diabolical tyrant going around with nothing more than endless raping and making of great breasts?"


    "WHAT IS IT PLANNING?!" he questions as he uses an even greater force in his latest punch, sending Angel tumbling over the ground.


    "A cleansing. That was what I last heard. Remember Noah''s ark that escaped the 49 days of flooding? Imagine a sea of flames instead. When it''s done, he will use the MAINFRAME TO REBUILD IT ALL!"


    "Unnecessary elaborate scheme. Why." asks Leader with a really serious look on his face.


    Grinning from side to side, I give my reply. "Because it''s cool, he said. Oh wait. I mean HOT! HAHHAHAHAHAHAAAAAA!!!!"


    As CPT (CAT) Angel recovers from the previous attack, he leaps forth at SC Simon once more to attack. Without turning to face him, Simon smashes him into the ground with a hammer fist from above.


    "Oh~~...scary"


    - End of memory log 2: CPT Kaiki -


    -----------------------------------------------------------------------------------------------------------------------


    - Memory log 3: SC Simon -


    What am I to think now. So the Cat''s intentions are of fickle origin? All these fighting, for nothing more than a cruel play?


    Feeling the presence of the annoying creature that I haven''t used my full force on coming at me again, I swiftly raise my fist and and hammering down on the beast, feeling a few of its ribs smashed in the process.


    Looking up at the peak that was the top of the Oppai statue, I glared with a wave of indescribable emotions overwhelmed me. As I focused at the location of the enemy of M-chan, shouting voices bring me back to the situation before me.


    "LEADER! We have subdued a group of the traitors!" shouts a young Alliance Officer running towards me with 1LT Mark.


    With a group of yanderes holding down some kuuderes and a female Alliance officer in the distance, I could see that the odds were once again in our favour. That said, I wondered if they alone could take the two remaining down.


    "Mark, DarkCloud, and the new guy. I will leave matters here to you all. Kaiki. The tyrant will not succeed."


    "How so?" asks Kaiki in a mocking manner.


    Without replying, I turn to face the Oppai statue once more. Letting out my manliest warcry, I jumped up towards the top of the Oppai statue.


    "CCCCCCCCCCCCCCCCCCCAAAAAAAAAAAAAAAAATTTTTTTTTTTTTTTTTTTT!!!!!!!!!!!!!!!" I shouted as I flew towards the top that consists of nothing but a few floating platforms.


    "Nyaaa~~Super Saiyan mode, Leader?" says the Cat as it stands on the highest platform.


    "DISAPPEAR FOREVER, PUSSY!" as I threw a ball of manliness at him.


    - End of memory log 3: SC Simon -

 Chapter 20: Beast of the Tyrant

    - Memory log 3: 1LT Jonathan -


    I fell back as the force of SC Simon''s out of this world jump towards the top of the Oppai statue knock me and 1LT Mark off our feet.


    "Wow. That''s our leader all right."


    "Keep your admiration for later. Look like Kaiki has one up us." says 1LT Mark as I look at CPT Kaiki pointing his shotgun at us from his kneeling position.


    Before I could say a word, I hear some shouting coming from behind. Turning to look, I watched as the female Alliance Officer we took down earlier walks over with her kudderes restraining our yanderes.


    "Kaiki. Enough playing. Get up, the both of you."


    "Ah darn it...and for a moment there I thought we were about to have some fun." replies CPT Kaiki in protest.


    "What is going on here?" I ask in an attempt to understand the situation.


    "Before we go on, I am Major Yuno. Kaiki here and us were on a special mission to have Leader Simon focus on the enemy only he could fight."


    "That clears a whole bunch of questions up. Now how about letting our yanderes go." says 1LT Mark in response.


    Waving her hand, the kuuderes release our yanderes, allowing them rejoin us.


    "Now then. Look like we still have a beast on the loose." says CPT Kaiki and he motions at the dark black fur beast that stands up from the hole in the ground.


    Without giving it a chance to completely get up, a female in an armoured suit leaps at the creature and kicks it at the back of its head. As it''s sent flying towards the ground, MAJ Yuno gives the order to fire.


    "Now boys and ladies behind, the thing over there would be former CPT Angel, a CAT Officer." says CPT Kaiki who walked over to our side during the distraction.


    "How do we kill it?" asks 1LT Mark.


    "Fine question. That''s what we are about to find out."


    As the last bullet is fired from the Kuuderes'' weapons, we watched as the beast gets up unharmed by the previous attack. Letting out a monstrous cry, the beast looks in our direction in renewed vigor.


    - End of memory log 3: 1LT Jonathan -


    -----------------------------------------------------------------------------------------------------------------------


    - Memory log 3: 1LT Mark -


    Reaching the kuuderes in a single leap, we watched as a kuudere is caught and literally torn apart into pieces with parts flying in all directions in a matter of seconds.


    In immediate response, MAJ Yuno engages the beast with a series of martial art moves to fend off the creature. Ordering the kuuderes back, MRC DarkCloud joins her in battle against the beast.


    "Now boys, I doubt your yanderes will be doing any good out here. Better run back and make love as they always say." says CPT Kaiki.


    "A man doesn''t cower in fear...though I can''t imagine keeping up with more than 5 moves against that thing." I reply as 1LT Jonathan is too shocked by the suggestion to respond.


    "I would love to help too. But I think more Catnip would do more harm than good. Besides, can''t do much with firearms against that thing, even less with our ladies there doing all that CQC."


    "That''s actually a sound explanation."


    "I have never made an unsound one before, if you think about it carefully."


    "B-but we can''t just stand here, right?" adds 1LT Jonathan.


    "You are right. Miss DarkCloud might have something. But she''s too busy fighting right now."


    "I will the nice guy and let her know then, huh." says CPT Kaiki before running towards the fighting, firing a shot that hits CPT (CAT) Angel and MRC DarkCloud.


    After he gets pounced on by MRC DarkCloud with a fist at his face, she joins us to discuss a plan.


    "You have an idea to take that thing there down?" asks MRC DarkCloud.


    "Not at the moment. I was hoping you have some final weapon stashed away."


    "You were betting on something like that? That''s a pretty bad joke."


    "Well, do you?" I persisted.


    "...I do. But there''s no way it will work unless the thing is right in front of me right after I charged it up."


    "We will go with that then. Jonathan! It''s time for your top score in Close Combat to shine now."


    "What are you saying? That thing is just WAY too fast!" replies 1LT Jonathan.


    "Better do or die then." I reply before dropping my combat vest and running over to MAJ Yuno and CPT (CAT) Angel.


    "MAJOR! Please get back!" I yelled before throwing a Catnipade that was about to explode.


    Jumping back, the gas cloud of Catnip covering the beast and as expected, it turns its attention towards me. Running backwards, I watched as the beast soon made its way before me as we exchanged several blows in an instant.


    Love this novel? Read it on Royal Road to ensure the author gets credit.


    Deflecting a direct punch, I could feel the bone in my arm breaking from the residual impact alone. Performing a backflip, I shouted for Jonathan to take over.


    Despite his usual inability to perform at most things, one of his key points was his insane Close Combat Skills. Dodging the attacks while stepping back, He exchanges a few blows with CPT (CAT) Angel.


    Dealing the beast an uppercut followed by a roundhouse kick, he sends the beast staggering backwards. Turning around, he runs towards MRC DarkCloud in the final stretch with the creature on his tail.


    As we had planned, the creature fails to notice MRC DarkCloud when 1LT Jonathan stops before her and dives to the side. Holding a long glowing blade, she cuts at the beast that lands in front of her.


    "YYYYYYYYYYYYEEEEEEEEEEAAAAAAAAAAPPPPPPPPPPPPAAAAAAAARRRRRRRGGGGHHHHHH!!!"


    Falling onto its back, the beast has its four limbs sliced off cleanly from its body. Running over to MRC DarkCloud''s side, her long glowing blade vanishes into thin air.


    "Mutsushi...a really boring weapon." she mumbles as the creature writhes in pain before us.


    Before we could make our next move, CPT (CAT) Angel roars in agony once more as it flopped itself over. Using only its torso, it leaps away in great strides as we watched in shock and disgust.


    - End of memory log 3: 1LT Mark -


    -----------------------------------------------------------------------------------------------------------------------


    - Memory log 3: CPT (CAT) Putra -


    *BOOOOOOOOOMMMMMMM!!!*


    "Hmm...Cat-san. The tea today tastes a bit funny."


    "Nyon? Must be the new mix my servant was preparing for me earlier."


    "Yes. It''s lacking something."


    "Maybe because he died before completing it?"


    "...well I think I have had enough. After all, Simon himself is finally here."


    As the smoke from the explosion that blew up the platform about clears, Leader Simon comes into sight once more. With Tyrant Sumeragi floating in the air now as well, it looks like an aerial fist fight was about to ensue.


    "SIMON! Old friend. Don''t mind me here. I''m just here for the show." as the two of them stares at each other.


    Without giving me a reply, he leaps at Cat and attacks with a punch that is caught by Cat''s tails. Exchanging a bunch of blows and words that I was too disinterested to take note of, I watch them for a few minutes before hearing gunfire from the direction of the kitchen platform.


    Staying seated in my chair, I chewed on a slice of sandwich as MAJ (CAT) Lurker walks up to join me on the observation platform I am on.


    "Putra. You really have a strong fetish for voyeurism, don''t you?"


    "Ha. Well, I can''t really be too bothered when someone else is going around with all the scheming and plotting."


    "So be it. You can watch the downfall of a Tyrant."


    Walking past me, he takes aim at Cat and fires till the last bullet. His shots however, were blocked by Cat''s tails.


    "Nyaa~can''t you see I''m busy with Leader now? Why don''t you wait till we are done?" replies Cat as SC Simon fires off another ball of manhood at him.


    "No, your great furriness. Don''t you want to fire the Nyaa~vastator at long last?" revealing the remote from his pocket.


    "NYO! I DO! I DO! GIMME THAT REMOTE NYAA~!" says Sumeragi as he flies towards us with hands stretched out.


    "WELL HERE YOU GO!" shouts MAJ (CAT) Lurker as he presses on the button himself.


    "NYAA?!" says Cat as a huge explosion sets off, causing my table of afternoon tea to be knocked over onto the floor.


    "That''s right, TIRTHA! I''m no longer your slave! That was your Nyaa~vastator blowing up completely. Your reign of terror is over!"


    "Nyan~ Putra-chin, what is this CAT here saying? Of course it''s part of my plan."


    Not being able to hold myself back any longer, I burst out in laughter as MAJ (CAT) lurker demands an explanation.


    "AHAHAHAHHAHAHAHAAA!!!! Lurker-kun. I told you, didn''t I? Besides, why ask our god when you can figure it out yourself? You are good at that, right?"


    "WHAT IS GOING ON HERE?" asks SC Simon in his manly tone.


    "Hahaha...right. Leader doesn''t know, right? Can you hear that rumbling? The remains of the Nyaa~vastator will soon crash down onto M-chan mainland!"


    "Putra-chin. Don''t go revealing my plans before I do nya." interrupts Cat Sumeragi.


    Taking a short bow, I return to my seat as Sumeragi explains how he has placed a virus in the Nyaa~vastator so that upon its destruction, it would destroy M-chan mainland by corrupting the data as it rolls over the land.


    - End of memory log 3: CPT (CAT) Putra -

 Chapter 21: Yarn of Fiery Ends

    - Memory log 4: LTC Aiel -


    Descending on the battlefield swiftly on our light and fast jeeps, three companies consisting of Specialist OTAKUs, Mayaderes and Mahou Shoujos led by me mowed down the numerous CAT forces that dominated the battlefield.


    Rescuing groups of Alliance soldiers that were part of the original invasion, I ordered our men to scatter out evenly to resume our retaking of the battlefield as I proceed on to search for MAJ Yuno and CPT Kaiki.


    Analysing the battlefield data from earlier, the last known location where SC Simon was believed to be fighting should be in the area a few kilometres before the grand stairs of the Church.


    Driving deeper into the battlefield with a small convoy, we started encountering roaming CAT forces. Using my ability, Critical Point, my recoilless energy weapon allows me to make accurate shots that destroy even their mechas with ease.


    In my excitement, I did not notice the CAT mecha hovering half a kilometre away preparing to fire its missiles. All of a sudden, the mecha explodes without us attacking it.


    Slowing down to take a look at what happened, I saw a familiar figure appearing behind the smoke. In a brief sprint, the figure makes its way over to our jeep.


    "Aiel-kun. Inattentive as always. How are you going to repay me for using my Yaoi Shtick to save you, hmm?"


    "Anything other than with a butt if that¡¯s what you are asking, Hitagi."


    "I will settle for Ahyaa."


    "Done." I replied, snapping at his offer.


    "So what are you doing out here? Weren''t you supposed to be tucked in safely at HQ?" asks COL Hitagi.


    "I need to pick up a group of handpicked subordinates of mine. Will you be coming along?"


    Before Hitagi could reply, another loud explosion in the direction of the Oppai statue caught our attention. With a huge hole blown in the face of the Oppai statue, a giant flaming ball comes dropping down and crashes onto the Church.


    "I would be glad to COME along, but I''m not sticking my Yaoi Shtick in any where else other than my usual accommodation." answers COL Hitagi.


    - End of memory log 4: LTC Aiel -


    -----------------------------------------------------------------------------------------------------------------------


    - Memory log 4: 1LT Jonathan -


    Returning to the building where the Light Armoured Transports were parked earlier, we waited for about 5 minutes for the remaining kuuderes that were sent out as distraction earlier to return after firing the signal flare.


    At the request of MRC DarkCloud, we brought along the corpse of 2LT Redshirt back on a stretcher that was brought along by a kuudere medic. Not quite sure who he is though. I only have a vague memory of seeing him back in training.


    With CPT Kaiki disappearing in the midst of the earlier battle, 1LT Mark was now blaming himself for not keeping a close watch over the convict. As I wandered a bit, a familiar presence appeared from behind and covers my eyes.


    "Uh...Tia-san. Do you mind?"


    "It''s Tia, Jon. And we are having a break now."


    "Hai...but we need to focus, okay?"


    "Of course~" as she removes her hands from my eyes. "I''m just inviting you to sit in the back with me later."


    "What about all the other kuuderes?"


    "Do they even matter? If you mind, I could-"


    "No. It''s fine. Uh...look! Time''s up. The Major is telling us to get on the transports."


    Grabbing her by the hand, we ran over to the transports'' where I asked her to get on first. As the last few kuuderes arrived, Mark and I proceed to close the doors and got onto the front seats of the second transport.


    "Jon, huh. You do realise you are in for it later, don''t you?" says 1LT Mark.


    "How did you know?!" I cried out in surprise.


    "One of my yanderes happened to be around. You can say I have plenty of ears and eyes around."


    "Darn it."


    "By the way, you haven''t noticed that the driver kuudere swapped positions with your yandere yet, have you."


    "What the?!" as I turned to my left to see MSG Tia driving the transport while making a "Tee-Hee" face at me.


    A case of theft: this story is not rightfully on Amazon; if you spot it, report the violation.


    As we made our way away from the battlefield, a loud explosion occurs behind us. 1LT Mark looks out the window and watches for a bit before he updates us.


    "Sergeant. You might want to put the pedal to the medal." says 1LT Mark.


    "Why?" I asked.


    "We have a growing ball of fire rolling down in our general direction."


    Revving up the vehicle, we took off at top speed. Less than 5 minutes later, we spotted several jeeps ahead of us. Joining up with us, we turned on Comms to find it working once more.


    "Hello. Hello. Do you read me?"


    "Yes. This is First Lieutenant Mark."


    "Hi Mark. I''m Lieutenant Colonel Aiel. Is there a Major Yuno among you?"


    "Yes Sir. She is in the other transport. Comms from their vehicle should be coming on soon."


    "Good. Can you brief me on what happened to you all as we move?"


    "Affirmative, Sir. Where do you want me to start from?"


    As the two engaged in radio conversation, I couldn''t help but look anxiously at the growing fireball rumbling towards us in the side mirror.


    - End of memory log 4: 1LT Jonathan -


    -----------------------------------------------------------------------------------------------------------------------


    - Memory log 5: MG Simba -


    "Sir! Our air force should be with us in a minute! ETA for deployment of paratroopers on the statue is 6 minutes!"


    "Good. Have some fighters investigate that growing fireball as well."


    Taking command at our makeshift outpost consisting of several foldable tables and benches, I draw new territorial lines and markings down on the map as Alliance forces rapidly pushes back CAT forces.


    "G-GENERAL! You won''t believe this!"


    "What is it, Corporal." as I walk over to the signal man operating a mobile systems within a briefcase.


    "Sir! Our systems are reading massive numbers of signatures coming from friendly mechanised units at a location under the Oppai Statue!"


    "These are...EXCELLENT! If I''m correct, this war is ours for the taking. Who is in command at Alliance HQ now?!"


    "A moment Sir. Alliance HQ, do you read?"


    "*Bzzt* Affirmative. This is Alliance HQ. We read you loud and clear." replies the loli on the other side with a high pitch voice.


    "Miss. I need to know who is in command now." I ask before the man could continue.


    "Uhm...ah! Major General Yuu has just taken over command."


    "Good. This is Major General Simba. Please connect Yuu onto the Comms channel."


    "Y-yes sir!" as the small screen changes to display Alliance HQ.


    "Simba. It''s been a long time." says MG Yuu.


    "Indeed. But now is not the time. We are lacking the equipment required to establish a link to M-chan ART."


    "Way ahead of you. There we have it. I will have you linked to the mainframe."


    "Much appreciated." as the screen transmitted visual data from the link.


    With our aerial forces flying past the base, I smiled broadly as the screen shows M-chan servers returning to our control. My happiness was short-lived as a ninja appears next to me.


    "General. The growing ball of fire from earlier is about to hit us in a minute."


    Feeling a slight rise in temperature, I turned to see the fireball earlier now the size of an average mountain. Moving much faster than before, our retreating forces are going to be destroyed by it if it wasn''t stopped.


    A great power surges through my body as I stared at the flaming ball of destruction, preparing for my ultimate attack. Hovering up 20 feet into the air, I voiced the command that amplifies itself over the lands of M-chan.


    "BEGONE! THIS IS REALITY! FOR I AM AN ADMINISTRATOR!"


    - End of memory log 5: MG Simba -

 Chapter 22: Robots, CATs, & Admins, Part 1

    - Memory log 3: GEN (CAT) Nathanael -


    "General! We are reading multiple signals coming from below! They are not friendly nyon!"


    "Our battalions deployed via the Nyaa~pods are not responding nya!"


    "Our last CAT mecha in the field has just lost connection nyaa!"


    "Sir! Codename Ball of Yarn has vanished nyon! Reason unknownya!"


    "Enemy bombers are striking our main groups! Requesting Nyaacat cover nyan!"


    "Negative! Nyaacats are engaging drones coming from the bottom of the statue nyo!"


    "Enemy troop planes inbound nya! They are paradropping onto the statue!"


    "Field command requesting backup nyaa!"


    "I have Comms requesting for orders nyo!"


    "Erm...General nyaa..." asks CPT (CAT) Catwalker as he steps forward from behind.


    "ENOUGH! Gentlemen, it has been an honor working with you. Captain, please guide the staff here to a safe room."


    "Yes, NYO!" replies CPT (CAT) Catwalker with a salute as the other CATs in the room stands up to follow suit.


    As they clear the room, I watch the monitors as remaining CAT forces are either annihilated or entrapped by Alliance forces. Slamming down on the full retreat button, I draw my swords as a drone hover up in front of the glass panel of CAT command.


    "Let''s end this." I said as I jumped at the glass panel, slicing it into pieces.


    Stepping on the drone outside, I cut it down as I made another jump for the numerous drones that floats in the air around the statue.


    - End of memory log 3: GEN (CAT) Nathanael -


    -----------------------------------------------------------------------------------------------------------------------


    - Memory log 1: SSG Tony -


    Looking at the dark clouds that covered the entire sky, I held onto the door of the jeep as it approaches Frontline HQ. With barely any sunlight left, spotlights and lamps have been set up around the encampment as we drove into the battered base.


    Pulling up by a fallen pillar, I asked a passing soldier for the location of the command post. Saying that the place has changed quite a bit due to the pillars causing so much environmental destruction, he hops on to guide us to the command post.


    Making our way past a fallen pillar and a group of captive CATs, I saw groups of wounded men and women as they lay on sheets or stretchers with wounds of all sorts. Medics and Medical officers were hurrying from person to person trying to provide whatever relief they could.


    As I laid my eyes on people with lost limbs and guts falling out of their stomach, I veered my head to the side in order not to lose my composure and puke. On the other side, three planes have made an emergency landing with two male pilots trying to console a female one who was crying.


    "For the love of Eros, what tragedy." I say while attempting to hold back my tears.


    "Erh. You haven''t seen all of it. The more horribly injured ones have already been placed in body bags after they asked to be put out." says the soldier who got on board.


    "Do you mind holding back on that?" coughing as I said that.


    "Heh. Well I guess staying in the back might have been better for you, huh. Anyway, take a right after that burning tent and go straight down. Tell the general I said hi."


    Jumping off, he runs off to help some troops as they carried their injured or dead in. Making the right turn, I could see MG Simba on the left side of the road surrounded by a setup of tables and a group of familiar Alliance officers.


    "Good evening, Sirs and Madams! Staff Tony reporting for duty!" I shouted as I ran over to them with two heavy briefcases.


    "Good to have you, Staff. We need your support for the support operations to come." replies MG Simba.


    Unlawfully taken from Royal Road, this story should be reported if seen on Amazon.


    With two other Comms officers helping me with the setup, LTC Aiel walks up to me.


    "How''s Alliance HQ faring now?"


    "Everything is in order when I left. They should be sending medical supplies as well as our reserves to back the frontline up soon."


    "I hope the sights have not scared you too much, Tony. And remember, you are now part of the frontline. Keep up the good work!" patting my back as he walks off.


    Completing the setup, I resumed my role in coordination of troops and supply lines as MG Simba continues the discussion with the other officers. After a short while, they walk over to me with the General in the front.


    "Tony. I need you to take command here for about a minute or two. I have decided to have the lot behind me back Leader Simon up."


    "Yes, Sir!" I replied quickly.


    "Ahem, just a moment!" interrupts one of the officers at the back. "How are we going to get there so fast?"


    The entire groups laughs as they walk off, leaving the officer with a "What''s going on, I''m serious" face.


    Grabbed by the guy on his left as they chased after the rest, I could hear the words "Jonathan, sometimes you just ask the silliest questions."


    - End of memory log 1: SSG Tony -


    -----------------------------------------------------------------------------------------------------------------------


    - Memory log 3: MSG Viniance -


    Diving for cover behind a dislodged metal panel on the wall, I reload my handguns and rifle while they rained bullets over my position.


    "GUYS! I COULD USE SOME COVER FIRE OVER HERE!"


    "SO COULD I!" shouts MSG Khairul from a doorway in the corridor.


    "WHERE''S JOHN?!"


    "I THINK HE GOT INTO THE ROOM EARLIER!"


    Holding our positions, we waited for an opportunity to return fire but soon realise that the firing has completely stopped after the last machine gun ceased fire. Peering out, I watch as MAJ John walks down the middle of the corridor.


    "What are you waiting for boys, Christmas?" says MAJ John.


    "What the hell just...and what''s that hanging from your neck?" I asked.


    "Oh. Don''t you recognise intestines when you see them?"


    "And why the fuck do you have that around your neck?"


    "I used it to straggle a bunch of CATS earlier. They pinned down my weapons so I had to work with the half blown carcass nearby."


    Placing my palm on my face while MSG Khairul claps at MAJ John''s feat, we made our way to their next stairwell only to find that it has at least the next three floors of stair blown to nothing.


    "Well okay. I don''t suppose we will be getting up now. If we are taking the lifts, we are going to want to double up."


    "Naw. I think we have another option here." replies MAJ John.


    Pointing at the gaping hole that opens most of half the corridor, I saw a bunch of dangling thick cables hanging down from above.


    "Aw god no. You are fucking kidding me."


    "Looks like Viniance here has reached his limits." says MSG Khairul as he follows MAJ John over to the cables.


    "They are good enough to climb up. And if I''m correct, this leads up a broken boob of the statue." says MAJ John as he begins to climb.


    "Great. I always wanted to climb on a boob 120 stories up in the sky." I cursed as we made our ascent.


    - End of memory log 3: MSG Viniance -

 Chapter 23: Robots, CATs, & Admins, Part 2

    - Memory log 2: MSG Khairul -


    Despite the winds at this height nearly causing us to fall a few times, along with MSG Viniance complaining, we soon reached the top of the boob where a massive table and several stone chairs with cushion stood upon a platform between both breasts.


    Looking around, we saw a door in the middle of the chest along with an ejection seat and an injured pilot sitting up nearby. Running over to him, we recognised him to be MSG Ahyaa.


    "Ahyaano, when did you join the air force?" asks MAJ John.


    Grimacing at him, Ahyaa replies, "Is this really the time for that name?!" before coughing out some blood.


    Running to aid him, I move his hands away to see his bleeding wound in his side. Getting him to lay down, I grabbed the medical kit lying next to him that I presume he took before ejecting.


    With MSG Viniance helping me with whatever medical equipment we had, I opened his stab wound and pulled out the metal fragment that was embedded inside. Not seeing anything else stuck inside, I proceed to wash his wound and stitch him up before wrapping his belly area with bandages.


    Giving a hearty smack on his wound that causes Ahyaa to yelp in pain, I turn out to see MAJ John finishing his smoke. Walking over to us, he nods his head in acknowledgement of my work and motions for us to continue.


    "Wait up." says MSG Ahyaa as he gets up and staggers after us.


    "Look, prissy. We are going to fight more CAT forces so we really don''t have the time to watch over a patched up piece of work. Just hide somewhere and wait till we''re done." replies MAJ John.


    "I ain''t hanging around to be killed in some corner so I will be sticking with you. Besides, I can at least fire from a cover." argues MSG Ahyaa.


    "Do what you want." replies MAJ John as we walk through the door.


    "Erm, Khairul." says Ahyaa as he walks up next to me. "Thanks. You knew what you were doing, right?"


    "I am medic trained and about to get a doctor''s licence. Other than that, I pretty much guessed." causing Ahyaa to show a worried look.


    Walking down the corridor to find the next armoury, we stopped by the corner leading to a significant wider corridor as voices could be heard yelling.


    "Staff Sergeant Lite! I require access to the elevators in order to report to our god!" shouts a sweet female voice.


    "Miss Tohka. You may be one of Tirtha''s elite Nekomimi squad, but I have orders to secure the upper levels and that includes prevention of non-key CAT officers from passing." replies a male voice.


    "That man is dangerous yet you still let him go up! And why are we Nekomimis not considered as key CAT officers?!"


    "Major Lurker is going up to guard his furriness. Plus our god has never given you any official rank despite calling you his elite squad."


    "GAH! I don''t care! If you won''t let me through, I will fight my way through!"


    "And how do you propose you do that, my men here will have you gunned down over 5 times before you can even cut a single of us."


    "NOT WITHOUT OUR HELP OF COURSE!" shouts MAJ John as he jumps out into the open, tossing a few Catnipades in the direction of the voices while doing so.


    - End of memory log 2: MSG Khairul -


    -----------------------------------------------------------------------------------------------------------------------


    - Memory log 3: MAJ John -


    Throwing a bunch of Catnipades at the makeshift barricade, I took advantage of the CATs that would be reluctant to fire in this situation to close in on them. As expected, even with SSG (CAT) Lite shouting to fire, the recovering CATs held back as I ran up behind the Nekomimi and grab her by the waist to use as a body shield.


    "YOU COWARD!" shouts SSG (CAT) Lite as he draws his combat knife in order to fight me.


    "I apologise to Miss Tohka here but you haven''t left me much of a choice!"


    Reaching the barricade, I release my grip on the Nekomimi to meet SSG (CAT) Lite''s blade with my own. With the rest behind me providing fire support as they made their way here, the CATs struggle to get a chance to return fire without getting shot first.


    "By my orders, none of you will be leaving this place alive!" shouts Lite.


    "By my own will, I say you lot better stand down before someone gets killed again!"


    "The only one dying is you!" he shouts as he unleashes a fury of stabs.


    Taking the moment, I waited till his stabs stopped just before throwing my knife at his chest where it meets its mark. With their commander fallen, the CATs raised their paws in surrender before any of them gets shot dead.


    My victory was short-lived as I turned around to find a long sword aimed at my throat. The Nekomimi Tohka had recovered in the time I was fighting SSG (CAT) Lite and readied herself to fight me. With my men pointing their guns at her back, she begins to speak.


    "So the horrible Alliance have made their way up. And an officer too! Tell your men behind to stand down or the both of us shall perish here!" demands the Nekomimi.


    "My, my. And what horrible acts have we done actually?" I queried.


    "You have rebelled against the kindness of our god and murdered countless CATs along with my sisters!"


    "Don''t be mistaken, lady. The most we have done is some butchering of CATs. Now it''s your GOD that has allowed the brutal hunting of human survivors!"


    "Silence! You will not speak ill of our Cat god anymore. Now tell your men to stand down or we perish together!"


    "As you wish. I would love to commit a double suicide with such a hot chick like yourself."


    "You perverse bastard...take this!" she shouts as she plunges her sword forward.


    Just that instant before, I plunged myself backward as fast as I could. Leaning back till I was half my standing height, I narrowly evade the long blade that would have went through my throat or head if I was just a moment slower.


    Looking at me in surprise, I swing my leaning body to the left before she could react and with agile foot techniques, positioned myself behind the Nekomimi with my arms tightly wrapped around her neck.


    "Now once more. Do you give up? Or should I have your head turned to face?" I whispered into her ear.


    A case of theft: this story is not rightfully on Amazon; if you spot it, report the violation.


    "You sick bastard. I will never-HRNNGH! W-Where is your leg rubbing?!" she says as tears formed in her eyes.


    "Oh. I also have the second option of letting you experience first-hand the reason why they called me...Pleasure Bringer." whispering the last part even closer to her ear.


    "I...I give up..." she mumbles as she drops her sword.


    "How about we hear that again? A little louder this time."


    "I-I SURRENDER!" she shouts as tears streamed down her face.


    Letting her go, I bended over to pick up the sword as the rest behind me runs over.


    "H-Hey. You didn''t have to go that far." says MSG Ahyaa in a annoyed voice.


    "This is real war, Prissy. If I don''t break their will, they might try to shoot us from behind."


    Moving on to tie up the rest of the CATs as MSG Viniance consoles the Nekomimi before tying her hands and feet up, the three of them gathered before me as we waited for the lift to come.


    "With all the bombing going on, it might be better to take the stairs?" says MSG Viniance.


    "I would agree but with the hell being blown out of the place, I don''t think that''s going to matter much. Besides, the Alliance seems to be winning."


    "How do you know?" asks MSG Ahyaa.


    "For starters, there were plenty of ARUs taking down the Nyaacats earlier. And if you haven''t noticed, all that gunfire coming from below definitely isn''t us."


    "So the Alliance troops finally made it here?" asks MSG Khairul.


    "Yes. But not by land. I saw a few of them dropping in earlier. I suppose a whole bunch more must have landed while we were taking the place apart."


    "With them around, we can get back to murdering a Cat." adds MSG Khairul as the lift arrives.


    "This time, we stroll out guns blazing." I said, corking the heavy machine gun I took from the CAT garrison as we walked into the lift.


    - End of memory log 3: MAJ John -


    -----------------------------------------------------------------------------------------------------------------------


    - Memory log 4: GEN (CAT) Nathanael -


    "Hmph."


    Slicing down another drone, I make my final jump before landing on the ground that is about 4 kilometres from the Church. Replacing my two swords into their sheaths, I look in the direction of the Frontline HQ to examine the charred land that was destroyed by the flaming Nyaa~vastator earlier.


    Turning in the opposite direction, I glare at the black furry creature that writhes in pain on the ground a few metres away from me. Letting out a pitiful howl, the stumps where its limbs used to be begun growing outwards.


    Seconds later, it lies there on the ground with brand new limbs. Grunting a distorted meow, it twitches its limbs before beginning to get up. Drawing my swords once more, I took up my stance as the beast that was CPT (CAT) Angel turns to face me.


    "Pitiable. I did warn you about getting angry in your current altered form."


    "Nrrghhh..." says CPT (CAT) Angel before regaining its ability to speak. "General...how''s our god..."


    "Reaping the seeds he sowed. Now calm yourself down and you will return normal."


    "Calm?! WHEN OUR FURRINESS IS ENDANGERED?! AND WHAT OF YOU, GENERAL? WHY ARE YOU NOT BY HIS FURRINESS?!"


    "Angel. There are more important things at hand now. M-chan must be restored."


    "NNNNOOOOOOOOOOOOO!!!!!!!! You. YOU HAVE BETRAY HIS GODLINESS!!!!!!!!!!"


    "Oh boy. Time to put a cat down." was all I could mumble to myself as CPT (CAT) Angel leaped at me with his long sharp claws.


    Evading his first few slashes, I send him flying back using a windlash made by my swords. For the first minute, I thought the beast attacks without a specific rhythm or pattern.


    Not wanting to risk coming into contact with his beastly form, I kept my distance as I continued to look for something that would give me the edge in battle.


    In his current state, his ability G-Rated has morphed into its worst variant, Universally Banned. As a single touch could have all possibilities of outcome, I couldn''t risk him getting lucky with an attack that might rip off an arm or even worse, kill me instantly.


    Considering that I didn''t have much other than my swords and techniques, I have to outwit him somehow. Becoming more aggressive by the moment, I narrowly dodge his last attack before sending him flying back with a Blade Tornado.


    Breathing heavily, my stamina for such level of fighting was reaching its limits. It cannot be helped then. I will just have to risk it in the next move! As the beast leaps forth once more, I held my breath and waited till it was half a metre away.


    Performing a backflip over the beast, I land behind it and made a feint of firing away a Blade Tornado. Having anticipated my move, it smashes at the ground causing the dirt to form a dust cloud.


    Before the dust cloud clears, it charges up its killer move, Rated for Excessive Violence, and leaps at me to make a hit. Having guessed his next move correctly, it flies above me as I ducked into the hole I made in the ground a moment earlier.


    "Fiction Technique: Saint''s Seven Sins"


    Hitting the soft underbelly of the beast, CPT (CAT) Angel is sent flying high into the air as I leaped upwards and continued my combination of attacks. Landing onto the ground with a slam, the black beast whimpers in the unimaginable pain it received from my special move.


    Walking over to CPT (CAT) Angel, I pull out a syringe filled with the vaccine for the C-Virus. Injecting the serum into him, I watch as he finally calms down with fur falling from his body. Feeling for the other two syringes, I sheathed my swords once more as I took a bow.


    "Perez. it has been an honour to fight you. May we do battle again when you return to being human."


    Pulling out a handkerchief, I placed it over his privates before walking off in the direction of Mount YATTA.


    - End of memory log 4: GEN (CAT) Nathanael -

 Chapter 24: Nyahs of the Ending

    - Memory log 4: CPT (CAT) Putra -


    "NYAAHAHAHAHAHAHAHAHA~~Why don''t you give up, Simon? You cannot beat me in my own domain nyaa~"


    "Impudent Cat." replies SC Simon, "Eros will never fall to the likes of you."


    "But it will~ Nyahahahahahaa~~~" says the Tyrant Sumeragi.


    "Tirtha-san~" I shouted, "It''s almost time now."


    "Ah Putra-chin, thanks for the reminder nyaa~" as it raises a paw upwards. "Now descend upon us! NYAA WORLD!"


    With the winds violently stirring and sucking gently upwards, the dark clouds above spins into a spiral and clears out a section of the sky, revealing a night sky with a dark red moon.


    "What in the name of..." mutters SC Simon aloud as Cat Tyrant does a short "nyaa~nyah~nyaa~nyah~nyaah~" dance in mid air.


    "Let me explain then nyaa~...other Putra-chin, we have a guest behind you."


    Turning around, I finally noticed the CAT running up to the platform I was on. Remembering him to be SSG (CAT) Lite, he runs up to MAJ (CAT) Lurker who is still down on his knees before looking over at me.


    "Captain Putra. What is the meaning of this?"


    "Meaning? Nothing much. Just enjoying the show before me, that''s all."


    "Captain. I have four Alliance officers on their way up in the lift right now. If not for the fact I ordered the lifts to be slowed down, they would have long gotten here before I could run up here."


    "Relax now~I mean look at you. That stab wound in your chest won''t get any better if you are this agitated."


    "What are you saying?! There is no time for rest! We need to get ready to stop them!"


    "Tsk tsk tsk. You are too stressed out here. Come, take a seat next to me and just enjoy the show."


    "Who is that up there?" SSG (CAT) Lite asks after finally noticing SC Simon.


    "Just the Alliance leader. Now do as I say and watch the show."


    "You must be mad. I''m stopping him before he can hurt his furriness." says Lite as he pulls out a handgun.


    "Oh no, you don''t." I say as I activate my skill, stopping him in his tracks.


    "What is this?!"


    "It''s called Form of Voyeurism, Stalker. It will hold you in place for as long as I will it to."


    "Damn it! Let me go!"


    "Nope. And oh, I will have you shut up now. Don''t want to ruin the audio effects. Sumeragi~, you can continue now!"


    "Thank you, my underling. Neow, where was I. Right about...what''s that coming from behind you nya?"


    "You are not making me fall for the same old behind your back trick, you dumb cat." replies SC Simon, who appears pissed for waiting for so long.


    "Nyo really. Looks like one of our pillar nyaa." says Cat as it squints its eyes.


    Standing up, I walk to the side of the platform for a clearer view. What seems to be a pillar was flying straight in our direction. To be exact, it was aimed straight at Cat.


    Reaching in great speed, SC Simon and Tyrant Sumeragi jumps out of its path as a group of people leap out from the passing pillar, landing onto several of the floating platforms.


    "Oh joy. The whole company is here now." I commented as I recognised them to be the various Alliance Officers who having been fighting against our forces up till now.


    At the same time, the lift finally arrives and four Alliance Officers came running out before looking up at the sky in surprise.


    "Nyah~excellent Putra-chin. Now record my speech as I unveil the Main Heroine plan nyaa!" shouts Sumeragi in excitement.


    "Main Heroine plan?" says SC Simon as he raises an eyebrow at Cat.


    "It hath been too long since main heroines have been casted aside as plots develop into harems nyah! The worst ones are those where the main heroine is clearly seen but endlessly bogged down by other heroines NYO! The time hath come NYAN! I SHALL MAKE M-CHAN INTO A MAIN HEROINE ONLY WORLD NYAA!!"


    "Really now. That''s it? All this for some lame crap like this?" disses SC Simon for the first time.


    "IT''S NYOT LAME NYAH!"


    "But it is. I mean. One main heroine. In the entire world. You got to be fucking kidding me."


    "NOT LIKE THAT NYAH! Let me finish! I will have the world separated into many areas nyah! Each with its own main heroine and character. When they get together as planned, the next pair will be moved in nyaa! IT''S PURRFECT!"


    "HMPTH. You almost made me laugh with that last one."


    "Not just all NYAH! All novels, anime and any form of storytelling will only end that way nyah! Girls will also never have to worry about being flat anymore! Everyone will be at least a C-cup NYAA!"


    "Actually, I think it''s time your bad joke came to its end." replies SC Simon as his face becomes serious again.


    "And how is nyaa going to stop me? It''s too~ late~ nyan~hahahahaHAHAHAHA!!!"


    "Like this." before he takes in a deep breath.


    - End of memory log 4: CPT (CAT) Putra -


    -----------------------------------------------------------------------------------------------------------------------


    - Memory log 5: MAJ (CAT) Lurker -


    What have I been doing. Were all my efforts in vain? Has the Cat Tyrant succeeded in its vicious goal of limiting Eros after all?


    With questions of these sorts repeating over and over in my head, I was at a complete loss. Not being able to take in anything that happens around me, I remained in my kneeling position till a manly voluminous roar shook me to my senses.


    Getting up on my feet again, I could feel my clouded vision clearing up as fur drops from my body, returning me to the human form I originally was. Looking up in the sky, I saw SC Simon bursting with manliness as he faces the Cat Tyrant Sumeragi.


    Stolen novel; please report.


    "Arrhh~~I would love to have a piece of that ass." cries out a voice from a lower platform.


    Turning to him, I recognised him to be COL Hitagi. Alongside with him are 1LT Mark and another First Lieutenant along with 6 yanderes behind them. Turning to another platform, there are LTC Aiel, MAJ Yuno and MRC DarkCloud with MAJ John, MSG Khairul, MSG Viniance and MSG Ahyaa running up to join them.


    "What the hell, Cat? No Yaoi at all? You are asking for a butt ram, ain''t you?"


    "And no Guro. I will turn you into full course of meat and organs."


    "What about lolis?! Even flat chests have their charm!"


    "You can''t blame us if it takes time to grow, right?!"


    "Main Heroine? If I''m that, then it''s fine by me."


    "Erm...Yuno-san. I don''t think this is the time to be agreeing with the enemy."


    "Yes~darling! After all, he likes my Cs as they are, don''t you?"


    "Hey wait. What do you mean by no other routes? There are many other equally good sub characters worth exploring and ending with!"


    "WATASHI NO IMOUTOOOOOOOOO!!!! AISHITEIRU!!!!"


    "Genres like NTR, Rape, Monsters and whatever the Japanese mind can think of has potential as well you know."


    "THAT''S RIGHT, CAT! WHO ARE YOU TO DENY THE TRUE POSSIBILITIES OF EROS!?" I shouted at the feline Tyrant.


    "Nyaa...How uncouth. Well anyway, it''s too late. The ritual is about complete. Soon, my new world will descend over M-chan! NYAAHAHAHAHAHAA!!!"


    "Not if we can stop it. Are you ready, members of M-chan?" says SC Simon.


    "About time, Boss man."


    "Looks like we will get to find out who¡¯s the true tyrant now."


    "Enough chatter! LET''S FIGHT!!!"


    Grabbing my handgun from the floor, I reloaded as MAJ John and men fires their machine guns and rifles at the Tyrant. Blocking the attacks with its nine tails, it is forced to move when COL Hitagi jumps up to attack it from behind.


    "Sumeryan~Don''t run. I will slide it into you S.L.O.W.L.Y~~~" says COL Hitagi with a loud cooing voice.


    "Nyo thanks. I''m not into men nyan." replies Tyrant Sumeragi coldly.


    "THEN LET ME SEE YOUR GUTS!" shouts MRC DarkCloud as she flies up to attack up close with an energy blade.


    Dodging her first attack, she whips out two SMGs from behind her back and fires in succession as Cat falls downward a few metres after absorbing that attack.


    Along with the rest on the platforms, we fire at Cat using handguns, machine guns and energy weapons to the effect of preventing him from reacting to COL Hitagi and MRC DarkCloud''s double attack.


    "YAOI THRUSTING!!!!"


    "YAAAAHHHHHHHHHH!!!"


    Cutting off eight of Cat''s tails, the feline fiend screams as it tosses away in agonising pain across the sky.


    "NYYAAAA!!!! How could this be! Putra-chin! WHAT IS GOING ON NYAH?!"


    Shrugging his shoulders, CPT (CAT) Putra smiles as he carries on looking at Cat without a hint of planning to help it whatsoever.


    "It''s fine nyah. I will just use the administrative powers to fix myself up and complete the ritual NYAA!"


    "Not happening today, you pussy." says SC Simon from behind him.


    "NYAHA?!" says Cat Sumeragi as it backs away from Leader.


    "Haven''t you noticed? I''M OVERLORD ONCE MORE!" roars SC Simon as the Tyrant backs away in fear.


    "Now really. If I have to say something before banishing your furry backside, it will be ["Why the fuck is it you again...?"]" says Leader Simon and he completes his charging for his ultimate attack.


    "There goes the attention whore, huh." says MRC DarkCloud aloud as she shrugs her shoulders.


    "It really likes getting done in good." comments COL Hitagi as his Yaoi Shtick returns to his pants for the first time in ages.


    "NYYAAAAHHAAA!!! This cannot be happening! My purrfect world! I WILL NOT BE DENNNIIIYYYAAAAHHH!!!!" shouts Tyrant Sumeragi as it goes into a panic.


    "Nope. Get the hell out of here." says SC Simon and his muscular arms lunges forward.


    "HERCULES!!! BUSTER!!!!!!!!!!!!" roars Leader Simon as his attack hits the Cat Tyrant.


    "NNNNNNYYYOOOO!!!!!!!!" screams the Cat as it''s sent flying up towards the dark red moon.


    As the Cat Tyrant Sumeragi disappears from sight, the dark clouds form up over the sky as we wondered what would happen next.


    - End of memory log 5: MAJ (CAT) Lurker -


    -----------------------------------------------------------------------------------------------------------------------


    - Memory log 1: Tyrant Sumeragi -


    Nyah? What is happening? I''m flying into the sky?!


    Cannot...move...must resist Simon''s...NYAA!!!


    Why are memories of my life flashing by?! Nyoh?! It can''t be!


    IMPOSSIBLE! I CANNOT DIE NYAA! I CANNOT BE DEFEATED!


    I still have to...complete my Main Heroine haven where only melons exist nyaa~


    Ah...the light...it''s coming...


    *BEEEEEEPPP!!!!*


    *Silence*


    - User consciousness has faded... -


    - Error: User not found. Terminating log process -


    - End of memory log 1: Tyrant Sumeragi -

 Chapter 25: Post-war Ramblings, Part 1

    Historical archive of Post M-chan war log 1:


    I can still remember the day M-chan mainland was reclaimed by the Alliance. Despite the horrible aftermath, that moment itself was truly glorious.


    With the Cat Tyrant Sumeragi finally being banished from M-chan, his dark ritual ended along with him as we heard a loud shattering sound across the world as the gloomy dark clouds dissipated, returning the late evening sun to us.


    The loud cheers of Alliance forces within the statue could be heard for miles as LTC Aiel used his miniature Comms set to inform MG Simba of our victory.


    Having our own moment at the top come to an end, we came to the next problem. Getting down.


    Although Leader Simon, COL Hitagi and MRC DarkCloud were flying moments ago, they had used up all their energy and was unable to fly anymore.


    With MSG Ahyaa refusing to give up his butt to recharge COL Hitagi, we were stranded as infiltration teams had cut power to the upper floors and the only stairs up was conveniently blown up as we were fighting.


    Fortunately, several drones detected Leader Simon''s presence at the top as they flew up to the top of the former Oppai statue, allowing us to ride them down to ground level and back to Frontline HQ.


    On my way down, I got acquainted with 1LT Jonathan. With MSG Tia holding onto his arm tightly the entire ride down, it was a bit awkward to speak in depth with him as we made small talk the entire way.


    Just before we arrived at Frontline HQ, he finally asked the question he was holding back. Not exactly too sure on where to start on topic of when I got involved, I replied with "It''s a really long story" and left it at that as we landed.


    Though a handful of soldiers had gathered to receive us, I could tell that the situation was still serious as more scurrying about the place was going on rather than pure excitement.


    Everyone was glad that the war was over. But it did not change the fact a lot of people were in dire need of medical aid. Not to mention the reconstruction of mainland later.


    With the CAT army officially getting disbanded, I returned to being a Mercenary like Miss Hatsuko. In spite of her own injuries, she got her armor recharged before taking off to the battlefield to find survivors. Though I couldn''t quite figure how a camera would help.


    For COL Hitagi, he fainted shortly after returning from over-exhaustion and dehydration. Placed on a bench at some part of the camp with a blanket, we left him there to rest with an IV drip.


    Everyone else were equally tired, but after a short rest and some refreshments, we were hard at work with the relief efforts once more.


    SC Simon worked on his manly roar, converting CATs that did not returned to their human forms earlier. MSG Khairul joined the medical crew and helped out wherever he could.


    As for MAJ John and MSG Viniance, they took over a spare jeep and truck along with five other soldiers to search the battlefield for survivors.


    LTC Aiel and MAJ Yuno joined up with MG Simba to coordinate the movement of casualties to makeshift medical camps or hospitals, depending on their severity, as well as plenty of administrative and supply matters that required attention.


    While helping out with the distribution of supplies to various parts of the camp and meals, MSG Ahyaa ran into 1LT Mao who returns from a search for survivors, that ended with him getting a slap followed by a hug. Subsequent details were too cheesy for me.


    Along with 1LT Mark and 1LT Jonathan, I returned to the former CAT Church and Oppai Statue where we found the almost stark naked CPT Angel who the yanderes almost killed on sight as well as the surprisingly gravely injured but not dead CPT Christian.


    With the subsequent days passing on like that, it wasn''t till 2 weeks later when we finally ended search and rescue operations and started considering reconstruction efforts.


    Concluding this part of the log with the first few days after the war, I shall sign off here.


    Eros forever. - MRC Lurker


    -----------------------------------------------------------------------------------------------------------------------


    Historical archive of Post M-chan war log 2:


    3 months after Cat Tyrant Sumeragi VI Tirtha was banished from Moon Channel, the main land has been significantly restored with the aid from the outer regions, Baka Tsuki as well as the autonomous bots under the supervision of MG Simba.


    With the full capacity of science and technology restored, advanced medical treatment came into play as severely injured survivors were sent for full treatment, allowing most of them to recover to full physical health.


    This story is posted elsewhere by the author. Help them out by reading the authentic version.


    This said, most of the survivors¡¯ mental health were the one thing we couldn''t treat easily even with all our equipment, requiring the patients to go for psychotherapy for minor cases to an extensive mind wipe for extremely serious cases.


    For the dead, only memorials could be built in their memory as quoting Moderator Simba in a press conference, "Only the dead will never truly return. That''s why life is precious. YOLO."


    As mentioned before, reconstruction efforts were rapidly completed with the usage of administrative powers that help with a majority of the work. Towards the end, it was decided that the remaining development should be done as normal in order maintain the "natural flow".


    Having returned to our civilian roles half a month earlier, we don on our respective uniforms and mercenary combat outfits once more to attend the official victory ceremony organised by the restored government of M-chan.


    Addressing over millions of citizens, SC Simon made his speech on the grassy plains between the outskirts of the rebuilt city of M-chan and the general direction of Mount YATTA in the back.


    - Leader Simon''s Speech -


    Citizens. Officials. Soldiers.


    All of you gathered here today with one identity. A member of Moon Channel.


    We started out as the Dark Side of Baka Tsuki, with individual goals varying. However, we had one common goal. That was to establish a home for those who loves Baka Tsuki but could not find or make their place there.


    Now, we have succeeded in that goal. However, even as the Dark Side, greater forces of evil and darkness surrounds us and growing from within our community.


    Moon Channel is constantly under great threat. Be it from a hard liner of Baka Tsuki, to a fanatic amongst us.


    Measures have always been taken. Threats put down in silence as regular lives go on from day to day.


    EVEN SO. Our vigilance and efforts can only keep us safe for so long. Villainy is constantly at bay; be it outwardly, or inwardly.


    Five months ago, one such villain stood up.


    We responded with overwhelming power. But it was not enough.


    Through a fiendish bio-weapon, he turned many a good person into one of his underlings. Taking over the mainland, he brought down upon us two whole months of living hell.


    With a far more devious scheme in the works within the shadows, he threatened to change M-chan forever, destroying the home we worked so hard to build and preserve.


    His actions did not go undeterred, as surviving forces of citizens and soldiers formed a resistance, fighting back against the Cat Tyrant as we know him.


    The price of blood, sweat, and tears was paid. The sacrifice was not in vain. Bringing in forces from outside, we struck back at the dictator sitting within his monument of terror.


    Despite our victory in the end, too much was already lost. To those who died, their surviving companions mourn. To those who live, they will move on with this painful memory.


    If there is a silver lining within the clouds, it would be that with our losses, we gained new bonds. Be it in aid of another, or appreciating that we survived to see another day.


    Before I end my speech, I want to emphasize that in Moon Channel, anything is possible. We will never let one man dominate over the rest, like how we will never deny one of their opinion.


    With this message, I conclude the opening of M-Chan Wartime Recognition Ceremony. Thank you.


    - End of Leader Simon''s Speech -


    Followed by a three hour long ceremony of awarding medals to significant persons who contributed greatly in the two months long war, the event ended with reception for attendees.


    Meeting up with a few familiar faces, I took the opportunity to catch up and find out what they were planning for the future. Leaving by myself later in the late afternoon, I return home to write this log.


    Ending this part of the log, the third and final part will consist of key persons and their current lives.


    True Eros for all, MRC Lurker

 Chapter 26: Post-war Ramblings, Part 2

    Historical archive of Post M-chan war log 3 (Final):


    With the aid of Putra''s many videos and the consolidation of memory logs, I am now able to piece together the following list along with latest information regarding various key persons.


    [Ranked File Report: 1337 -begin-]


    The following list is in no particular order, and was written as accurately as possible with the assistance of observer and voyeur, Putra.


    Simon Walter; Supreme Commander, Leader of Moon Channel


    In a formal inquiry a month earlier, Simon is said to have been training up in an underground gym during his two months disappearance. When questioned about not returning sooner to help, he states that it was in the interest of M-chan that he returned in top form.


    Investigations were subsequently stopped short as the remaining council at that time determined the presence of Simon alone completely outweighing any possible act against M-Chan.


    He now leads Moon Channel once more as Leader, in figure and in power.


    Simba Davis; Lieutenant General, Administrator of Moon Channel


    As the top man in charge of post war efforts, Simba went from relief to reconstruction of Moon Channel mainland. The latest event which he took the role of overall in charge is the M-Chan Wartime Recognition Ceremony.


    In a meeting with the partly (figuratively) crippled council, his promotion to Lieutenant General was approved in view of his great contributions to the victory against Cat as well as post war efforts.


    Keeping a lower profile at this time, he works with technical staff on security matters with regards to M-chan servers.


    Hitagi Tsundere; Colonel, Seasoned Member of Moon Channel


    Right after the end of search and rescue efforts, an order came down for his arrest and detention in Alliance HQ. Taking into considerations of his war crimes, Colonel Hitagi was set to have his Yaoi Shtick removed and banished as the minimum punishment prior to death.


    With the wartime amnesty act set in motion by MG Simba and almost immediately approved by SC Simon, COL Hitagi''s acts as a CAT Officer were overlooked on the grounds that his Yaoi Shtick is kept in check and on leash for a year.


    He is last known to be appointed Commanding Officer for a new Military Training School for Yaoi, Yuri and Futanari specialists.


    Sumeragi VI Tirtha; Former Tyrant, Seasoned Member of Moon Channel


    After he was sent flying towards the moon, he was never seen again.


    Based on user status reflected in M-chan mainframe, his current status is set as Banned.


    John Goh Lee; Major, Seasoned Member of Moon Channel


    Although he wasn''t detained after the war, he was restricted to the area of M-chan mainland for a month pending investigations for war crimes. Being called up multiple times, he was interrogated time and again for his use of force during battle.


    Investigations were ended when amnesty was granted for several personnel, as it was deemed unreasonable for him to face lesser charges than those who were granted amnesty.


    Considering there might be anger should he receive any reward other than recognition for his contributions, his promotion to Lieutenant Colonel is withheld till further notice.


    In an attempt to keep a low profile, he is given a year long full paid leave. He now works the owner and bartender of a popular 24 hour bar, along with an occasional dubious character looking him up for "business".


    Khairul Shareef; Master Sergeant, Seasoned Member of Moon Channel


    Without any charges against him whatsoever, Khairul went abroad on a departing vessel as reconstruction efforts began to continue his medical studies.


    Briefly returning for the recognition ceremony, he left after spending some time drinking at John Goh Lee''s bar to resume his course.


    Set to complete his studies in the near future, it is said that his promotion to Major on return is a given assuming nothing unexpected happens.


    Kaiki Aquino; Captain, Seasoned Member of Moon Channel


    Disappearing after aiding in an Alliance plan to defeat the Cat Tyrant, CPT Kaiki was last seen by an observer bot, which he attacked to chase away. He was last seen heading in the direction of Mount YATTA.


    Although he should have been stripped of his military rank at the least, the amnesty granted covers him as promised by LTC Aiel, leaving him as MIA.


    Ahyaa Talal; Warrant Officer, Seasoned Member of Moon Channel


    Ignoring his initial desertion, that was regarded as an attempt to seek help from outer regions due to his eventual return to the battle as a pilot, Warrant Officer Ahyaa was promoted from Master Sergeant in recognition of his contributions.


    Under the command of Captain Mao, the two now work to restore the manned air force unit on M-chan mainland. It was also noted that their relation is highly questionable by friends and colleagues.


    Sanjay Parakkel; Colonel, Seasoned Member of Moon Channel


    Last known to have infiltrated Moon Channel main frame hall in order to restore administrative rights to the original persons, he was nowhere to be found when a group of technical staff and soldiers went in to check the equipment.


    Found over various spots of the place were bloodstains and bullet shells, presumably from his fight against the security bots that were destroyed in the area. Taking a sample from a large spot of dried blood, it was confirmed to belong to Captain Sanjay.


    Based on the amount of blood found, it was concluded that he died restoring the rights and had his body ripped into bits. In recognition of his contributions, he is given one rank rise for his act along with two rank rise for death in the course of duty.


    His final rank at the mass military funeral is Colonel.


    Christian Krown; Major, Seasoned Member of Moon Channel


    Said to be on his deathbed when brought to medical attention at Frontline HQ, he is reported to have grabbed the hands of the loli medic attending to him as he promised to recover.


    Being sent out on priority to a hospital near Alliance HQ, it is said that he "sprung" to life when his group of lolis from his company visited him in his ward as the rest waited their turns outside the hospital.


    For his contributions in wartime and his honour of protecting lolis, he is promoted to the rank of Major and now works as the Deputy Commander at the Military Headquarters of lolis, swearing to one day take up the Commanding Officer appointment.


    DarkCloud Asuno Hatsuko; Mercenary, Member of Moon Channel


    After assisting non-stop with search and rescue effort for the first three days, she disappeared from the eyes of Moon Channel ever since.


    One of Putra''s observer bots chanced upon her as she was getting out of a regeneration chamber located within the Oppai statue. The recording did not last long as she became visibly annoyed, taking a gun from her armor and firing at the bot''s camera eyes.


    Leaving its audio recording ability, she grabs the bot to leave the following voice message.


    "Putra, you better delete this video from the face of the Earth. Also, pass a message to Hitagi for me. Let him know he will be a dead man soon. And don''t worry, his organs will be properly harvested."


    Mark Yanderesuki; Captain, Seasoned Member of Moon Channel


    A week after reconstruction efforts begun, First Lieutenant Mark left for Outer Base YAN-DA-RAE as he begun to lose control over his 5 yanderes, with them nearly killing a group of tsuderes and fighting amongst themselves soon after.


    Hoping to seek assistance from his place of training, he went there as his yanderes were kept under close watch as he undertook advanced training before taking time to return his relations with his yanderes to normal.


    Completing in time to join us in the recognition ceremony, he is awarded his promotion to Captain as he serves as a personal bodyguard to MG Simba.


    It is said by his close friend Captain Jonathan that he is a man playing a love game with death.


    Jonathan Messiah Ercia; Captain, Member of Moon Channel


    Working hand in hand with LTC Aiel throughout the post war months, First Lieutenant Jonathan took the opportunity to have Master Sergeant Tia work under MAJ Yuno in hopes of having her to be better trained as a Yandere.


    If you stumble upon this narrative on Amazon, it''s taken without the author''s consent. Report it.


    Turning out to be a mistake, that he doesn''t dare to openly admit, the two now work closely (to a rumoured intimate term) as dame-ningen and yandere.


    Receiving his promotion to Captain for wartime effort at the ceremony, Master Sergeant Tia also received her promotion to one rank below Jonathan, and is now First Lieutenant Tia.


    Redshirt; Lieutenant Colonel, Member of Moon Channel


    Perishing by the hands, or to be exact claws, of then CPT (CAT) Angel after saving SC Simon, his efforts throughout the days of resistance as well as combat achievements during the final invasion were recognised during the ceremony.


    Due for promotion prior to his death, he is given one rank followed by another one rank for contributions to wartime efforts. Followed by another two ranks from death in the course of duty, his final rank at the mass military funeral is Lieutenant Colonel.


    Rising four ranks before his end of service, he is said by family members to be the highest ranked officer to leave service in the family of Redshirts.


    Lurker; Mercenary, Member of Moon Channel


    Well, yeah. It''s me. After the two weeks of Search and Rescue operations, I was requested by the council to take up the rank of Major to help conduct investigation of war crimes by Alliance and CAT Officers after they completed their investigations on me.


    Considering the advantages at that point, I jumped at the offer and went on to conduct countless investigations, with more than half of it ending with the amnesty granted by MG Simba and approved by SC Simon.


    Ending my task, I rejected their offer to take up full military service at my temporary rank, returning to being a mercenary as before.


    Receiving a medal at the recognition ceremony, I now work as a lore keeper for M-chan history department along with a kuudere I met during Search and Rescue.


    Putra Chin Wira; Captain (Retired), Seasoned Member of Moon Channel


    Through he was detained for suspected war crimes after returning to Frontline HQ with us, his charges were dropped along with the amnesty on the pretext of him providing vital wartime recordings used to convict countless CAT Officers and some Alliance Officers too.


    In view of his contributions, head investigation officer MAJ Lurker took the opportunity to have the council approve the conversion of his given CAT Officer rank brought over, promoting him from Master Sergeant to Captain without an official ceremony.


    Deciding to leave military service, Putra now meets up with MRC Lurker from time to time for compilation of historical records.


    He is also now renowned for directing a box office film, "Rise and Fall of the Cat Tyrant", with screenings at every theater across M-chan mainland.


    Axer Viniance; Master Warrant Officer (Retired), Member of Moon Channel


    With no war crimes and charges found against him, Master Sergeant Viniance assisted with military and civilian efforts during the three month period after the day of victory.


    Swearing to never climb up a boob while scaling the outer wall of any building more than two storeys high again, he applied to leave military service shortly after the recognition ceremony.


    Receiving a double promotion for his efforts and clean records, he retires from service at the rank of Master Warrant Officer.


    Continuing his search for the woman of his dreams, he now owns the largest departmental store in the reconstructed M-chan city.


    Angel Mandal Perez; Captain, Member of Moon Channel


    After being sent back to Frontline HQ, he was given a full set of uniform and went on to assist with Search and Rescue while under supervision. When reconstruction efforts started, he was detained for a week in Alliance HQ but was found to have no war crimes in his records.


    Upon his release, he requested for time off for official training at Mount YATTA. Being granted his request by MG Simba in person, he set off to the mountain where he hasn¡¯t been heard from since.


    It is now rumoured that he is in the middle of improving his skills and body so that he would not fall prey to a bio toxin ever again.


    Nathanael Li; General (Retired), Seasoned Member of Moon Channel


    Reported by an observer bot to be last seen sprinting in the direction of Mount YATTA, the former General Nathanael who was removed from office due to political reasons in a previous war has not been seen ever again.


    With rumours of his continued loyalty to M-chan sovereignty, Leader Simon has permitted his official return as a member and as a General of M-chan Military on the account he has a face to face meeting with Simon himself.


    Aiel Arbalest; Colonel, Seasoned Member of Moon Channel


    Working closely with MG Simba for the three months after the day of victory, Lieutenant Colonel Aiel was given his promotion to Colonel at the recognition ceremony along with an extra letter that was handwritten by LG Simba.


    The contents of the letter is not known to anyone but Aiel himself and his long waiting fiance, Yuno who also received her promotion to Lieutenant Colonel. The wedding date has yet to be set, with rumours of Aiel attempting to delay it for as long as he could.


    Being given a two weeks break for a vacation, the two stayed on M-chan mainland with CPT Jonathan and 1LT Tia during that time before leaving for their outer region base once more.


    Syafri Shii Putih; Second Lieutenant, Seasoned Member of Moon Channel


    Waking up from his deep sleep in the regeneration chamber, he was found by an Alliance search party and brought back to Frontline HQ. Being found to have a clean bill of health, he was recognised by a former CAT soldier as a CAT prison warden.


    Sent back to Alliance HQ and detained, he was soon declared to be free of war crimes and released under the orders of investigation officer MAJ Lurker. Through the same method used for Putra, Syafri has his CAT Officer rank converted to an Alliance Officer rank.


    With the end of major reconstruction efforts, 2LT Syafri is now in the middle of completing Alliance Officer training as the first batch of the newly restored M-chan Military Institute.


    Tony Yon; Staff Sergeant, Seasoned Member of Moon Channel


    Along with LTC Aiel, SSG Tony continued his work as Comms officer for two weeks during relief efforts. Returning to Alliance HQ thereafter, he carried on in his position to work under MG Yuu.


    Though he was offered a promotion to Master Sergeant for the amount of staff and backend operation work he put in, he declined and instead requested for a chance to join the first batch of Alliance cadets on mainland.


    Approved by COL Aiel and supported by the two Generals, SSG Tony is now in the middle of completing Alliance Officer training with 2LT Syafri. Upon completion, he will receive one extra rank in promotion to First Lieutenant.


    Lite Prince; Master Sergeant, Member of Moon Channel


    Upon his return to human form and Frontline HQ, he spent the next three days in shock at his previous actions before he was talked into his senses by MG Simba.


    Taking part in Search and Rescue, he was subsequently detained and sent back to Alliance HQ for investigations. Being found to have extremist loyalty to the leader he serves as his only crime, he was unanimously released to help in searching the ruins of the CAT Church and Oppai Statue.


    With his efforts, the structure of the entire place was soon combed down to last corner for possible threats remaining. Leading the team into M-chan server halls, he also discovered the dried blood in the main frame hall.


    With his contribution in the later part in mind and earlier acts deemed as loyalty to his liege, he returns as an Alliance specialist and is promoted from Staff Sergeant to Master Sergeant.


    Yuu; Major General, Administrator of Moon Channel


    Returning to M-chan mainland to take command of Alliance HQ, MG Yuu provided extensive support in the post war effort as the overall in charge for movement of supplies and equipment from the outer regions as well as citizens who returned to M-chan mainland early to search for their loved ones.


    After the Recognition Ceremony, he leaves M-chan mainland to resume command of outer region forces and is set to returned a year later when he is reappointed to a position in mainland, where he will receive his promotion to Lieutenant General.


    [Ranked File Report: 1337 -end-]


    As I finish up the last person current status, I really wonder. What happened to that Cat?


    For Eros! Now and forever! - MRC Lurker

 Chapter 27: Unending Closure

    Somewhere in the void between fantasy and reality:


    "Nygn...Nyaah?"


    "Where am I?" says Sumeragi VI Tirtha as he looks around in confusion.


    "Oh Cat..."


    "What? Who is that?!" asks the kitten in fear.


    "Hey Cat. You like to have your way, don''t you?" says a mysterious voice.


    "Who? Where are you?!" says Cat as it turns around rapidly in panic.


    "Why...we''re behind you."


    Turning around, the Cat looks to see John Goh Lee, Khairul Shareef, DarkCloud Asuno Hatsuko, Hitagi Tsundere and Christian Krown.


    "Nya...Nyah! Don''t scare me like that nyah." says Cat as it lets out a sigh.


    "Scare you? I don''t want to scare you, right Khairul?" says John.


    "That''s right. We are just going to dissect you slowly." adds Khairul.


    "NYAH?!"


    "Me? I''m just going to shove it in you. My Yaoi Shtick that is. Over and over till I cum and cum and cum." says Hitagi.


    "I would go along with what john and Khairul said but that''s too slow. I will have you in all cut up and oozing as I take picture after picture while you bleed to death~" says DarkCloud as she licks her kitchen knife.


    "NYO! NEVER!"


    "You cannot run Cat. There''s nowhere to go." replies all of them in unison.


    "NYO! NYO! NNNYAAAHH!! GET AWAY! AWAY!" screams the cat as they approach slowly but surely.


    "We will keep doing it. Over and over and over and over..." chants all of them over and over and they grab onto Cat Sumeragi.


    "NNNNNNNNYYYYYYYAAAAAAAAAAAAAA!!!!!!!!!!!" yells the Cat for the last time before it''s brutally murdered and raped over and over.


    As time comes to a slow before finally stopping, a twist in the fabric of space-time dimension warps the scene to where Sumeragi is sitting in front of his computer typing a post.


    This narrative has been unlawfully taken from Royal Road. If you see it on Amazon, please report it.


    Pressing Enter, Cat Tirtha puts up the post that started it all in M-chan, starting the entire sequence from the first comment down...


    LET THE WAR FOR M-CHAN BEGIN!


    -----------------------------------------------------------------------------------------------------------------------


    At an abandoned town 8 miles from the city of M-chan:


    "KKAAANNNGH-PPUIII!"


    Spitting on the ground as I walk through the empty town previously ravaged by CATs during a hunt, I approach a rundown concrete building with a solid metal door and windows sealed with planks of wood.


    "Stay out here, you two. And don''t even think of running. You know what happened to the last two."


    "y-yes, master..." mutters the two girls in skimpy latex outfits and an iron shackle with a broken chain around their neck.


    "Huhh..." I say aloud in an annoyed tone.


    "YES, MASTER KAIKI!" cries the two aloud as they got down on their knees.


    "Good. Thought I might have a little refining work to do." as I walk towards the door.


    Kicking the door which swings open after a loud screech, I enter the room with spots of visual static all over the almost empty room. Looking at the figure covered in static lying in the middle of the room, I sneer as I took out a cigarette.


    "What the hell happened to you, huh."


    Reacting to my voice, the figure stands up from the ground as the static flows off its body in a slimy manner. Lighting up my cigarette, I took a puff before dropping the thing along with the whole pack in disgust.


    Looking at the figure again, I opened my mouth to say the word I held back earlier.


    "Sanjay."


    -----------------------------------------------------------------------------------------------------------------------


    The end. Thanks for reading.


    The afterword might be posted at some point, along with additional content leading up to the second war.