《Where's My Unique Skill?! [Discontinued]》 [1] Wheres My Unique Skill?!?! The rain poured down heavily, giant grey clouds above crying out their tears upon the world below. The sun was completely blocked out, leaving the world below dim and dark. Inside a certain house, a boy sat still, staring at the screen. A soft darkness surrounded him, his hands furiously pressing onto the keyboard. His face was burning red, both in shame and anger. His fingers twitched uncontrollably as he read the computer screen in disbelief. [YOU LOSE] ¡°W-What the f*ck¡­? That worthless prick abandoned the f*cking team!¡± He shouted in anger and slammed his keyboard, the table wobbled from the sudden force. The computer screen flickered, the only light in the room flickering in and out. The closed curtains behind him did not allow any sunlight to enter, if there were any sunlight left out there. All around his blue swivel chair, piles after piles of trash could be seen lying around. Several empty bags of chips, several tens empty cups of noodles, several kilograms worth of soda cans, and a large box of candy, ripped open vigorously by his bare hands. Not that he noticed any of that. He sighed to himself. The image of that one player on his team burned in his mind, still vividly remembering when he just decided to help the other team. The other team! Like, what the hell dude?! He sighed once more as he heard some angry voices coming from the floor under him. Cold sweat emerged on his back as he could just sense and feel what was happening down there. The poor table was probably getting smashed again. ¡°Hah¡­¡± Just trying to picture his drunk mother slamming his door open and shouting at him was giving him a headache. Always, she would always come into his room, in the middle of a match, and mess everything up, no exceptions. And his father was never there to stop her. He sighed softly and returned his focus back onto his computer screen, the screen now displaying his game scores. The player ¡®ProDavin888¡¯, the fabled legend of this modern FPS, had lost, because of a traitor. ¡°F*ck this sh*t.¡± His anger nearly breaking free, he brought his hand over to the mouse and closed the game. He let out a sigh of relief as he stared at the empty desktop screen he had. The world doesn¡¯t seem to be on his side today. [19:56] Looking at the time, several hours had already passed since he first sat down, not actually knowing when he first sat down in the first place. But he needed to stop now, or his rage would boil over and the world would turn to ash. Leaving the game now left a bad aftertaste, but it was for the good of the universe. ¡°I wonder if the server¡¯s doing alright¡­¡± He stretched his arms and went back to the computer screen, pasting his face up close against the dim blue screen. His anger went down drastically when he saw his online trading server, doing better than it had ever done! The trades were booming! ¡°Heh¡­Guess luck¡¯s on my side, finally.¡± Cursing lightly at the traitor in his mind, he kicked back against his chair and relaxed, enjoying as the money in his account constantly rose from the increasing amount of trades. He relaxed his eyes and slowly brought them down. His vision was cut as he fell asleep, still rocking back on his swivel chair. Ah¡­Finally a good time- *Brak!!* *Ting, tang!* *Puchi!* Yeah, like that¡¯ll happen in this house. ¡°Oh, what the hell.¡± Opening his eyes back up, he brought his chair close to the computer screen. Honestly, he didn¡¯t have anything to do, nor did he feel like doing anything right now, and trying to sleep in this environment was near impossible. That was, until he spotted a slight anomaly in his server page. ¡°What the f*ck? Ads?¡± He swore to the depths of the earth that he had never let any ads on this damn server. Being a frequent user of the internet, he always found ads annoying and disturbing, hence why he didn¡¯t allow them to use his site as an advertisement. But what the hell is this thing doing here?! Bringing his mouse over to the ad, he hovered it over the small red cross and tapped. But, the ad didn¡¯t disappear. He clicked his tongue and tapped again, but to no avail. The ad remained unresponsive. Damn it! Go away! And after several hundred furious clicks, the ad finally disappeared! Peace! But, the peace did not last for long, as his screen suddenly flickered multiple times, before shutting off completely. ¡°What the f*ck?¡± Did his beast of a computer just die because of an ad?! What the hell?! He didn¡¯t buy this expensive thing for nothing! He slowly brought his hand over to the power button, and pressed it. But what came back, was not his usual desktop screen, but instead, simple blue desktop, and a simple popup in the middle. [Are you unsatisfied with this world? Y/N?] ¡°Huh? What the¡­?¡± He tried turning his PC off, but the button didn¡¯t respond. The clean blue screen kept on shining, illuminating the dark room he was sitting in. The sounds of his angered mother seemed to have died down, but it was unnaturally silent, too silent. He tried to close the message, but it simply reappeared. [Are you unsatisfied with this world? Y/N?] ¡°The hell?¡± The message kept on appearing, even after he closed the damn thing 10 times. The message would just pop up again, eagerly waiting for him to click for an answer. This could be a virus, but what kind of virus looked like this? Was this like one of those things that would bring people into a new world, sucking them into a screen and stuff? Was this what that was? ¡­Because if it is, he¡¯s instantly boarding that train. ¡°Heh, why not.¡± To try and play along, he moved his cursor over to the ¡®Yes¡¯ answer, and clicked. The message finally disappeared, but not for long, as another question appeared.This story originates from a different website. Ensure the author gets the support they deserve by reading it there. [Do you wish for more from this world? Y/N?] ¡°Yeah, this is totally one of those things, isn¡¯t it?¡± Being the stuck-up he is, he had enough time to do anything he wanted. Play games, watch videos, read erotic novels, and watch some nice anime. This scene definitely mirrored that of an anime he watched back a couple years ago, about a guy being brought to another world and being tasked with saving the world. Oh how he wished to be that man¡­Anyways, ¡®Yes¡¯ please! [Are you ready to sacrifice everything for your goals? Y/N?] ¡°Yes¡­Continue already.¡± [Do you have any regrets? Y/N?] ¡°Yeah, I definitely regret how f*cking slow this quiz is¡­¡± [What world do you wish to inhabit?] ¡°Ho? This is new.¡± Unlike the 4 previous questions, this question was not a yes or no. Instead, right below the question, was a small text box, probably there for him to fill in his answers. Now, there was a large array of different worlds he would like to live in. Scifi, Fantasy, Medieval, the list goes on and on. But one that stood out the most to him, was obviously Fantasy. I mean, who wouldn¡¯t want to feel how it would be to wield magic and shoot fireballs out of thin air? That would be every gamer¡¯s and otaku¡¯s dream! So, he wrote down the word ¡®Fantasy¡¯ and clicked continue. [Are you ready to leave? Y/N?] ¡°Being polite? Or is it just giving me time to say goodbye to my family or some sh*t?¡± Either ways, it was annoying. It isn¡¯t like anyone would miss him or mourn for his death anyways, so what¡¯s the point? The one person who actually cared for him was no more. Twitching in anticipation, he brought the cursor over to the ¡®Yes¡¯ option, and clicked. The screen flashed and- The world went dark. ¡­¡­¡­¡­¡­¡­¡­¡­¡­¡­¡­¡­¡­¡­¡­¡­¡­.. ¡°Ugh¡­What the hell¡­Agh¡­¡± Rubbing his head, he looked up to see the sun, covered by a giant canopy of leaves¡­Wait, what? The sun? And¡­Leaves? Is this¡­the outside? Never in his life would he dare to step out of his home, which meant that¡­ ¡°N-No way¡­I-It actually worked?! H-Hahaha! I-It worked!¡± He shot up and raised his hands in the air. He wobbled slightly from an odd change of gravity, but nevertheless, it worked! T-This is another world! And a fantasy world nonetheless! This was just like the anime! *Gasp* Wait, does that mean that there are skills too?! Alright, let¡¯s do this! ¡°Open status!¡± ¡°¡­¡­¡± Silence, absolute silence. He shouted the command, but nothing came up! Putting aside his odd voice, which was slightly higher pitched than normal, there was no status screen on display! ¡°Uh¡­Status screen, activate!¡± ¡°¡­¡­¡± ¡°Uh¡­Uh¡­Character sheet!¡± Still, absolute silence. Nothing came out as he kept on shouting these cringe worthy lines. Cold sweat began to form on his back. ¡°Uh¡­Uh¡­Open Sheet¡­N-No¡­wait¡­uh¡­Skill screen¡­no? n-not that too?!¡± ¡°Skill Status! Uh, uh¡­Press [F]? N-No? Umm¡­Umm¡­Inventory?!¡± He began to feel desperate. He had shouted many different cringe filled lines, but no status screen or whatever popped up! T-This can¡¯t be, right?! He couldn¡¯t have been scammed, right?! ¡°The Status! Stats! Link Start!! Where is it?!¡± ¡°D-Damn it! Just give me my status, damn it!!!!!¡± *Vrring* ¡°O-Oh¡­t-there it is.¡± Name: Diana Race: Human Age: 17 Class: Peasant Lv: 0/5 | Exp: 0/25 HP: 10/10 MP: 10/10 SP: 10/10 [Strength]: 2 [Tenacity]: 1 [Agility]: 2 [Intelligence]: 2 [Dexterity]: 3 [Mentality]: 3 [Endurance]: 2 [Wisdom]: 2 [Longevity]: 2 [Skill Points]: 0 {Skills}: - {Magic}: - {Titles}: - ¡°W-Wait a sec¡­W-What is this¡­? Where¡¯s my unique skill? O-Or my magic?!¡± His eyes shot open as he read his shameful excuse for stats. No matter how humble you may seem, or how encouraging you are, there¡¯s no denying it, his stats are absolute sh*t. And to add to the insult, his class even denoted him as a peasant, a Peasant! And why is his name Diana?! He abruptly closed his status screen and looked down, his eyes cast in darkness upon his absolutely terrible stats. But then, something else caught his attentions, something on his chest. ¡°W-Wait a minute¡­E-Eep! W-Why is my voice so high?!¡± Closing his mouth, he stopped to consider the voice that just came out from his lips. That high pitched voice, soft and cute, could only belong to the opposite sex. But he¡¯s a guy¡­right? ¡°A-Ah!¡± He slowly brought his hands down to his chest, and touched the two mounds on his chest. A soft moan escaped his lips as his hands touched upon his new assets. His eyes looking down in fear, he continued downwards, towards his nether regions. And there, he felt nothing. ¡°I-I-It¡¯s g-gone¡­?¡± With tears building in his eyes, he, or more appropriately now, she, dropped onto her knees and shivered. Foreign sensations coursed through her system as his loose white T-shirt rubbed against her adequately sized chest. Her silky smooth skin glimmered under the occasional sunlight, her long black hair waved slowly. ¡°Haha¡­haha¡­haha¡­I-It can¡¯t be¡­I-I can¡¯t be¡­ahaha¡­¡± And¡­she¡¯s gone and lost it. First day in a fantasy world, and she¡¯s lost it. Diana, or Davin back in his previous world, had gone and lost it. ¡®ProDavin888¡¯, the myth, the legend, had lost it everyone. A round of applause please. *Boink!* ¡°U-Uaa¡­?¡± Looking up with teary eyes, she stared at the green blob standing before her. The slimy substance bobbed up and down, looking at her with its invisible eyes. Even if he was a she now, there was no doubt about it, the monster before her, was the legendary slime! Instantly, his gamer instincts took over. His arm moved and picked up and nearby stick, and pointed the blunt edge at the slimy abomination. This was his first task, time to get 3 slime balls for the tutorial! ¡­¡­¡­¡­ 5 minutes later, Diana laid on the ground, face first. Her loose white T-shirt and her short pants were slimed all over. Her slim legs were completely covered in the green goo, same goes for her arm. The stick she once held was broken in half. Silently, she cried out as she felt the feeling of defeat, from a slime! And n-not only that, some of her precious HP and SP, wasted! This wasn¡¯t like that anime. It wasn¡¯t like it at all! Where¡¯s his awesome magic skills?! Or his swordsmanship?! Where¡¯s his fabled sword?! His companions?! His cute pet wolf?! Dogmeat?! Where are all of you?! And so, with those self-depreciating thoughts, she continued to cried herself to sleep. [The title [Slime girl] has been acquired. 1 Skill Point gained] -Several hours later- Slowly, she turned onto her back and stared up onto the canopy of leaves. The green living paper absorbed the sunlight and lived on, further living on. Even the trees were doing better than she is! How far down is she?! And you know what¡¯s worst? He even got a title from that slime! Name: Diana Race: Human Age: 17 Class: Peasant Lv: 0/5 | Exp: 0/25 HP: 8/10 MP: 10/10 SP: 9/10 [Strength]: 2 [Tenacity]: 1 [Agility]: 2 [Intelligence]: 2 [Dexterity]: 3 [Mentality]: 3 [Endurance]: 2 [Wisdom]: 2 [Longevity]: 2 [Skill Points]: 1 {Skills}: - {Magic}: - {Titles}: [Slime girl] [Slime girl] You have shown no resistance towards the green blob that is the slime Slimes are naturally friendlier to you Look at it! Just, look at it! Showed. No. Resistance. To. The. Slimes! What is she, some girl from an erotic manga?! Wait no, that¡¯s different. Doesn¡¯t matter! She still failed, to, kill, a, slime! And so, there she laid, crying tears of shame as she read the description for such a title. She couldn¡¯t believe it! Not one bit! And then, her nightmares returned to haunt her once more! *Boink!* ¡°O-Oh god no¡­¡± There, standing before her, was a small green blob of goo, roughly the size of a basketball. Its slimy surface touched against the dirt, causing a soft *Boink* to escape into the air. Her legs shook in terror as she eyed the nightmare before her. Slowly, she began crawling away, but the slime followed immediately, jumping onto her face. ¡°N-NooOO-¡° *Bak!* And squarely, the slime landed on her face, sliming her cheeks all over. The slime slowly slid off, and landed on her lap, looking up towards her with a set of invisible googly eyes. Her body shivered under its constant gaze. ¡°W-W-What d-do you w-want¡­?¡± ¡°¡­?¡± *Boink! Boink! Boink!* ¡°O-Oh god¡­N-No please¡­Not more¡­¡± As if she wasn¡¯t suffering enough mental damage, even more slimes began to appear! First, a group of 10, and then another, and another, until there were more slimes around her than she could even count with her pitiful math skills! What is this?! A nightmare of slimes?! ¡°n-n-no¡­p-please¡­¡± The surrounding slimes inched closer, touching against her body as they attempted to get closer. Slowly, as foreign sensations overtook her, a string of messages entered her mind. [Slime A pledged you as its queen. Accept?] [Slime B pledged you as its queen. Accept?] [Slime C pledged you as its queen. Accept?] [Slime D pledged you as its queen. Accept?] [Slime E pledged you as its queen. Accept?] [Slime F pledged you as its queen. Accept?] [Slime G pledged you as its queen. Accept?] [Slime H pledged you as its queen. Accept?] [Slime I pledged you as its queen. Accept?] [Slime J pledged you as its queen. Accept?] [Slime K pledged you as its queen. Accept?] ¡°Y-Yes!! P-Please stop it!!¡± [You have been crowned as the Slime Queen. Title [Slime Girl] has evolved to [Slime Queen]. [Slime Valley] has been acquired. 1 Skill Point gained] [2] Well, New Skills, but Her Stats Are Still Sh*t Slimy, everywhere, was slimy! What is this place?! Why was she even here?! She¡¯s supposed to be a fabled hero! A person tasked to save the world! Not some maiden in distress stuck inside a cave of slimes! And that makes sense, since she¡¯s a girl now! ¡°Uuu¡­¡± Name: Diana Race: Human Age: 17 Class: Peasant Lv: 0/5 | Exp: 0/25 HP: 7/10 MP: 10/10 SP: 9/10 [Strength]: 2 [Tenacity]: 1 [Agility]: 2 [Intelligence]: 2 [Dexterity]: 3 [Mentality]: 3 [Endurance]: 2 [Wisdom]: 2 [Longevity]: 2 [Skill Points]: 2 {Skills}: [Slime Valley: Lv 1/10] {Magic}: - {Titles}: [Slime Queen] And to make it worse, all the titles and skills she had were all related to her being passive to slimes! To slimes! The first enemy of most fantasy RPGs! And she¡¯s gone and lost to them. Amazing. Just amazing. Much wow. ¡°Uuuuu¡­.¡± She continued to cry, hugging her knees close to try and drown her sadness. Now she regretted leaving behind her previous world! If she knew this was what she would be getting into, she would¡¯ve never left in the first place! Agh! This is the worst! [Slime Queen] A title granted to those who have been crowned as the leaders of the slimes. Slimes are naturally friendly to you. Gives access to [Slime Valley]. Any [Slime] related skills gain a slight experience boost. [Slime Valley] Lv 1/10 ¡°Harness your inner slime girl and go *Kupyu~!*¡± Allows you to shift into a slime girl. Consumes 20 MP and SP every minute. Taking any physical damage will lower your current MP by 20%. Slime form negates all physical damage, but you take 300% more magical damage. ¡°Hic¡­Hic¡­¡± But, at least there was a plus¡­right? Who am I kidding, this was the worst! She¡¯s been surrounded by so many slimes, that she gained the ability to turn into a slime girl!? What does that even mean?! *Kupyu~!*, my ass! *Pring* *Boink, boink* ¡°Uuu¡­hic¡­?¡± Slowly raising her head, she viewed at the nightmare standing across her. An extremely dangerous weapon floated within its gooey body, floating and moving around the slimy body it had. Dropping the knife out from itself, it jumped once and left her alone. She stared at the knife for a moment, before she looked back down and continued to cry her tears out. Even her weapons were being given, by slimes! ¡°Uuuu¡­¡± ¡­¡­¡­ After choking her tears out for about an hour or so, she finally stood up and picked up the knife that one slime had left for her. The silver edge it had was still refined, gleaming despite the dim lighting within this small cave opening. She slowly pressed her feminine fingers upon its clean blade. Gripping the knife tightly, she turned towards the cave walls, and swung! ¡°AAA!! F*ck this sh*t!!! Why did I even end up here! I¡¯m a girl! A GIRL!! Why did I decide to leave my home?! My stupid ass brain decided to do this stupid sh*t?! AGH!!!¡± And so, she continued to slash the cave wall, expressing her inner thoughts towards the world. Sparks of metal flew off as the silver edge struck against the rocky walls. The silver edge clipped bit by bit. ¡°Stupid virus thingy!!! Why did you have f*cking to appear?! I was having a normal day, until you had to go and mess it up!!! AAHH!! Why, why, why?! Why?! WHY?! Aaaagghh!!!¡± And so, she continued to slice and strike the rocky walls, leaving behind more cuts as her slender hands swung the silver knife in a fury. Tears of regret streamed down her eyes, specks of metal flying off as she swung. Until finally, the faithful swing came, and broke the silver blade off its hilt. The silver blade danced in the air, and landed behind her, the sound of chattering metal echoed against the cave walls. But she felt more at ease, having let out her emotions for once. She didn¡¯t have that much freedom to do that back at home, so this was a nice change. But more than that! The first actually useful skill popped up! [Knife Mastery has been acquired. I Skill Point gained] ¡°Yes¡­hic¡­finally¡­hic.¡± Name: Diana Race: Human Age: 17 Class: Peasant Lv: 0/5 | Exp: 0/25 HP: 7/10 MP: 10/10 SP: 6/10 [Strength]: 2 [Tenacity]: 1 [Agility]: 2 [Intelligence]: 2 [Dexterity]: 3 [Mentality]: 3 [Endurance]: 2 [Wisdom]: 2 [Longevity]: 2 [Skill Points]: 3 {Skills}: [Slime Valley: Lv 1/10], [Knife Mastery Lv 1/10] {Magic}: - {Titles}: [Slime Queen] [Knife Mastery] Lv 1/10 You have gained a novice understanding of the knivesUnauthorized use of content: if you find this story on Amazon, report the violation. +5 to the [Strength] and [Dexterity] when wielding a knife ¡°A-Actually¡­W-What do these stats even do¡­?¡± [Strength] Determines your physical might. [Tenacity] Determines your resistance against physical and magical damage. [Agility] Determines your natural speed. [Intelligence] Determines your magical might. Determines how much MP you have. [Dexterity] Determines your reaction speed and muscle control. Determines your precision and accuracy. [Mentality] Determines how resistant you are to mental or soul attacks. [Endurance] Determines your HP and SP count. Recovery: 2 HP points/Hour, 3 SP points/Hour. [Wisdom] Increases your learning speed. Recovery: 1 MP point/Hour. [Longevity] Determines the length of your life span. [Skill Points] Points that are gained when you gain a new skill/title, or when a skill is maxed out. Can be used to exchange for special skills every class upgrade. Currently: 3 Points At the least, each of these descriptions gave her enough to go on. It was just like what she would expect from a video game. These stats, skills, magic, titles, they were all ripped straight from those JRPG games. A sense of nostalgia filled her as she recalled one she used to play back as a kid. And also- *Boink!* *Pring* A shiver crept up her spine as a familiar noise entered the cave. Slowly, she cocked her head over to her right, staring in despair at the nightmarish green blob before her, presenting her the fruits of its labour. ¡°T-T-Thanks¡­?¡± *Boink!* Hearing her awkward words of gratitude, the slime grew satisfied and left the cave, leaving her, once again, to her own lonesome. Luckily, the slime didn¡¯t jump to her face or something! The slimy feeling they gave sent shivers down her feminine back. But, nevertheless, they did bring her another silver knife to use. Actually, why were these slimes being so kind to her? Did they see her as some queen or something?...Oh god, no. Nonono. That¡¯s just a theory! Not a fact! Haha¡­haha¡­ha¡­ Either ways, there was something she wanted to test out. Remember that [Slime Valley] skill? Yeah, the one with the *Kupyu~!* thing? Yeah, how does that work actually? She genuinely wanted to know, for science. Nothing else. Just, science. ¡°Uh¡­D-Do I just-, W-Woah!¡± Just as she was beginning to question her sanity for trying this out, her body suddenly felt weak. Her skin turned green, as her whole body morphed and changed into that of a slime girl. Her body had become see-through. ¡°K-Kya! D-Don¡¯t fall off!¡± But to her dismay, the clothes she was wearing, which were already loose in the first place, fell through her slimy body and dropped onto the floor, covered in a layer of green goo. She looked down, eyeing her naked form, which- ¡°O-Oh god, s-stop it!¡± She shook her head from these odd thoughts and slapped her cheeks, not realising that the knife was still in her hand. As a result, the knife was sent through her head, and came out from the other side. It danced in the air and dropped onto the cold stone floor. ¡°H-Huh? I-I really d-didn¡¯t take any damage¡­?¡± Oddly, there was no damage, nor was there any feeling of pain. Heck, that didn¡¯t even give her any feelings! That just felt¡­slimy. ¡°A-Ah¡­¡± Not being able to handle the mental stress, she reverted back to her human form, now naked and exposed to the cold air of night. ¡°A-Achoo!¡± Quickly, she picked up her clothes and put them back on. They were slimy, but they¡¯ll do! Anything to stave off the cold! Lying on the floor, she stared at the knife as she slowly fell asleep. ¡­¡­¡­¡­¡­¡­¡­¡­¡­¡­¡­. *Boink, boink!* ¡°uuu¡­?¡± Rubbing her eyes, she slowly got up and yawned. This had been the first time she actually slept somewhere else besides her bed room. The foreign feeling of the cold stone reminded her of just how far she had left her old world. Her eyes grew teary as she recalled the warm feeling of her gaming room. *Boink, boink!* ¡°Ngh¡­?¡± Looking to her side, she spotted a pair of green slimes, each offering her an apple. ¡°T-Thanks¡­¡± She carefully looked at the apples, eyeing them just in case for any poison. In the end, she gave up on herself and ate them, not caring if she would die from this. *Nom, nom, nom* *¡­Gulp* ¡°¡­I¡­I¡¯m alive¡­¡± She looked down at herself, and saw herself, still alive and kicking. She was slightly disappointed in the lack of poison, but her trust for these cute slimes grew a bit¡­Wait, did she just call them cute? ¡°O-Oh god¡­¡± I-Is she growing intimate with these green blobs? Well, they are loyal, they give her food, knives to practice, a nice home, and¡­Nononono¡­W-Why is she starting to think like this?! They are slimes damnit! ¡­And she¡¯s a slime girl. ¡°Uuuu¡­¡± And that burst the bubble, as she finally broke down and cried once more. The slimes looked at each other before slowly heading back out, letting their Queen rest until she¡¯s finally ready to head out. In truth, these slimes were not hostile, not at all, but human travellers, or monsters always preyed on these poor creatures, even though they had no will to hurt them. And the fact that they had no brain, made them incapable of holding a grudge towards them. And that¡¯s the sob story of the slimes. Back at the radio. Diana continued to cry her eyes out, hugging her knees close to give her some slight comfort. The knife from yesterday silently rested beside her, simply waiting for the time she would wield it. And that was how it was supposed to go for another 2 hours, but someone clearly did not enjoy her crying constantly inside this cave of hers. ¡°Gugha¡­¡± ¡°U-Uuu?¡± Raising her head, she saw a small green-skinned child, growling at her by the cave entrance. A sharp silver knife was held in its right hand, gleaming under the rays of the sun. Saliva dripped from its mouth, eagerly waiting for the prey to come out. ¡°G-Goblin¡­?¡± Honestly, after her defeat with the slime back then, her confidence in this ¡®Fantasy Hero¡¯ stuff had dropped drastically. If a simple slime was able to overwhelm her, how about a goblin, or an undead mage, or a dragon? Wouldn¡¯t she just get thrown around like a ragdoll and die in a corner? ¡°Gugha!¡± But the goblin didn¡¯t have any remorse, nor did it care for her sob story. It wanted food, and it wanted it NOW. Knife in hand, it rushed into the cave! ¡°A-Ah!¡± From her lingering gamer instincts, she picked up the knife beside her and jumped aside. The goblin turned and looked at her, its eyes gleaming just like its blade under the sun¡¯s light. A shiver ran down her spine as she too held the knife in her hand. ¡°Gugha!¡± ¡°Take this!¡± They both charged at each other, swinging their knives at full force. The silver edges clashed against each other, the sound echoing through the cave. But, this was not how the exchange will continue! ¡°Gugha!¡± *Pang!* ¡°A-Ah?!¡± Twisting its hold slightly, the goblin ducked and knocked her arm up, leaving her chest wide open to its attacks. Grinning widely, the goblin jumped in for the chance. ¡°N-No¡­!¡± By instinct, her [Slime Valley] activated, and her body turned to slime in an instant. The goblin simply fazed through her intangible body, cloaked in a small coat of green slime. ¡°G-Gugha?¡± ¡°It¡¯s my turn! Take this!¡± Turning around, she held her knife in the air, and brought it down towards the goblin¡¯s head. The knife plunged straight in, a burst of blood came from the head wound she caused. Slowly, the goblin grew limp and fell onto the floor. Staring into empty space, the first battle, technically second, had ended with a victory! [Enemy has been slain. Gained 5 experience] [3] Ha! This is Eas-, Okay, Nevermind!! The first enemy has been killed! Well, ¡®Second¡¯, but, whatever. Her EXP bar went up slightly too! 20 more, and she¡¯s on her way to Level 2! Her gamer heart jumped for joy at the thought of that sweet level up. But enough thinking, let¡¯s head outside! Killing that green goblin from earlier had at least boosted her confidence in herself by an adequate amount. Not enough to make her forget getting surrounded and played around by slimes, but enough to at least let her gaming instincts take over. Outside, the sun was hanging overhead, but the lush green canopy of leaves above her kept the sunlight from reaching the ground below. Thin shadows casted upon the soil, dimming the vision she had. But little did she know, that this would become her salvation! But that¡¯s the future! Let¡¯s take a look at her skills! Name: Diana Race: Human Age: 17 Class: Peasant Lv: 0/5 | Exp: 5/25 HP: 10/10 MP: 6/10 SP: 7/10 [Strength]: 2 [Tenacity]: 1 [Agility]: 2 [Intelligence]: 2 [Dexterity]: 3 [Mentality]: 3 [Endurance]: 2 [Wisdom]: 2 [Longevity]: 2 [Skill Points]: 3 {Skills}: [Slime Valley: Lv 1/10], [Knife Mastery Lv 1/10] {Magic}: - {Titles}: [Slime Queen] Just like expected, her Exp count had went up! Woohoo! First 20%, 80% remaining! Time to finally get this ¡®Peasant¡¯ class out of her sight! And get a cool class, like a knight, or a mage, a priest maybe? How about a ranger? But she¡¯s a slime girl. ¡°It¡¯s dark¡­¡± Tightly holding onto the silver knife in her hand, she slowly made her way through the shadowy forest. She was always on edge, the slightest noise caused her to tense up and look around. The fear of monsters visibly present in her face. Even if she did win that battle against that goblin, that was just her being lucky. That goblin didn¡¯t have any magic to attack her, and her slime form allowed her to negate any and all physical damage. But what if the enemy had magic? Or was sturdy enough to wait until her MP and SP ran out? She didn¡¯t want to imagine it, the thought of her dying in this world. Ah, but she just imagined it¡­ *Trik* ¡°?!¡± She froze and looked around, her eyes vigilantly watching for anything in sight. Sweat formed on her cheeks, her tension reaching its peak. *Trik* Again! This time, it was close enough that she actually knew where it came from. Fearfully, she slowly turned around, and- There was a white bunny, cutely staring up to her with its beady eyes. ¡°So cute!......What the f*ck did I just say?!¡± ¡°Nyu?¡± Diana was lost in her own world, not realising that the bunny was slowly inching closer and closer to her. Letting out a cute giggle, the bunny readied its legs, and leaped straight for her chest! ¡°E-Eh?!¡± By instinct, she activated [Slime Valley], and let the bunny faze through her slimy body, at the cost of losing her MP. Sweat formed on her already glistening body as she prepared her knife. She brought the knife down, but the bunny dodged the strike. ¡°Nyu!¡± ¡°Damnit!¡± Returning to her human form, she stood on guard and watched, the bunny giggling as it circled around her. Little bunny feet marks formed on the dirt as it hopped from one location to another, keeping its velocity at its peak. Until finally, it leaped again! ¡°Die, damnit!¡± Changing to her slime form again, the bunny easily fazed through her slimy body, popping out onto the other side. But that was the last thing it did, as a knife impaled through its white fur. Blood was spilled in the name of survival! [Enemy has been slain. Gained 5 experience] [Congratulations! [Slime Valley] is now Level 2!] ¡°Wow, that was fast.¡± Not that she minded of course. Any and all upgrades she could receive would help her greatly. But this turns her into a slime girl¡­Okay, enough of that! Being a slime girl helps! Case closed! ¡°Let¡¯s see!¡± A tinge of excitement was mixed in as she brought up her status. Obviously, she was still a NEET at heart, and these game features were everything to her. The one thing he liked the most out of these systems, was watching herself level up! Duh. [Slime Valley] Lv 2/10 ¡°Harness your inner slime girl and go *Kupyu~!*¡± Allows you to shift into a slime girl. Consumes 18 MP and SP every minute. Taking any physical damage will lower your current MP by 20%. Slime form negates all physical damage, but you take 300% more magical damage. Being a slime girl allows you to shift and morph your body to your own will. ¡°Ooh!¡± Look! Looky look! There¡¯s a new line added! Look at that! Oh, the feeling of gaining more power filled her in satisfaction, and ease as she had a higher chance of survival. This IS the real world now, you know. But she couldn¡¯t test it now, since it seems another being heard their bout and decided to join in. ¡°Gugha?¡± To her left, she saw the familiar green skinned child. Its face was wrinkly and its mouth twisted into a disgusting grin. A wooden staff was held in its left arm, seemingly pulsating with a tiny amount of energy.Stolen from its rightful author, this tale is not meant to be on Amazon; report any sightings. A new challenger comes in! Normally, she would try and battle, but this battle was beyond her league! This monster had magic in its fingertips! No way in hell is she battling that now! She would die a thousand times over! ¡°[Schton Bulyet]!¡± The goblin shouted something, and above its wooden staff, formed a small earthen boulder. The ragged and misshaped boulder spun around in the air, waiting for its caster to release it upon its enemy, and release it will! *Bum!* ¡°Gua?!¡± At a speed she had only seen on baseball matches, on TV of course, the earth boulder shot out and hit her back. A soft cry escaped her lips and she toppled over, swearing that she had heard some of her bones crack fall apart. Of course, she was exaggerating. But damn that thing hurt! And she can¡¯t even use her [Slime Valley] for this! Well, you know the best tactic for something like this! ¡°Run away!!!¡± ¡°G-Gugha?!¡± In haste, Diana turned towards the direction of her cave, and ran! Run with her tail in between her ass! Not that she had a tail, but what the hell, let¡¯s go with that! Ruuuunnn!!! ¡°Gugha!!¡± The goblin flew into a rage and ran at her, casting more earth boulders at her. She barely managed to avoid them, the earthen tennis balls flying all around her, hitting and smashing into trees, the ground, the dead body of the bunny. You know, usual nature stuff. But soon enough, the goblin lost track of her in this darkness, and shrugged its shoulder. Trying to chase this prey was getting annoying, so its time to sleep! Was the thought that went through its head as it retreated back to its home in the distance. ¡°Hah¡­hah¡­hah¡­¡± The flee was a success! She was back at her cave, panting heavily as she rested her back against the stone walls. No experience was gained from that battle, but whatever, she lived! That was more important, damnit! She took a quick look at her condition. Name: Diana Race: Human Age: 17 Class: Peasant Lv: 0/5 | Exp: 10/25 HP: 6/10 MP: 6/10 SP: 5/10 [Strength]: 2 [Tenacity]: 1 [Agility]: 2 [Intelligence]: 2 [Dexterity]: 3 [Mentality]: 3 [Endurance]: 2 [Wisdom]: 2 [Longevity]: 2 [Skill Points]: 3 {Skills}: [Slime Valley: Lv 2/10], [Knife Mastery Lv 1/10] {Magic}: - {Titles}: [Slime Queen] And as you can see, she was hit down to 6 HP! 6! That earth tennis ball she got hit by took out 4 HP?! From her 10?! That was almost half! What the hell?! That was supposed to be a low level enemy, right?! ¡°No¡­calm down me¡­¡± Sitting down, she placed down her silver knife and sighed in defeat. Trying to shout to herself about her problems would only make things worse, maybe. She had never actually gone past middle school, so she never really knew. Just to know, she fully descended into darkness at the young age of 12, so¡­yeah. Looking up at the rocky ceiling, she recalled the description she read before she was interrupted by that damn goblin that almost brought her life to the reaper. [Slime Valley] Lv 2/10 ¡°Harness your inner slime girl and go *Kupyu~!*¡± Allows you to shift into a slime girl. Consumes 18 MP and SP every minute. Taking any physical damage will lower your current MP by 20%. Slime form negates all physical damage, but you take 300% more magical damage. Being a slime girl allows you to shift and morph your body to your own will. Besides the decrease in MP and SP usage, there¡¯s a new message added on the bottom. Now, she had the ability to shift and morph her slimy body to her will! Actually, isn¡¯t that a standard of all slimes? Why is that hidden behind the Level 2 mark? Time to test it out! ¡°Yosh!¡± Jumping back up, she activated her [Slime Valley] once more, watching as her clothing fell through her slimy figure. She became slightly shy, but knowing there was no one to watch her, she immediately began her test. She extended her hand, and using a piece of clay as an example, she began to twist her arm in an unnatural direction. She didn¡¯t feel any pain from it, but watching her arm like that made her cringe non-stop, so she returned it back to normal. The next one he wanted to try out was something he had in his mind since he first received this skill. That question was, ¡®Can I detach a bit of my slime?¡¯ It sounded stupid, and absolutely useless, but why not? As if she was ripping off a bit of clay from herself, she slowly tore off a bit of herself, and brought it in front of her. The small slime ball casually floated in front of her eyes, spinning and wobbling slightly as she played around with it like some kind of yoyo. And after a while, her efforts bore fruit! [[Slime Magic] has been acquired. 1 Skill Point gained] ¡°Yes! Finally!¡± In a rush, she quickly stopped her [Slime Valley] and returned to her human form. She had gotten dangerously close to 0 MP and SP, and she didn¡¯t know what would happen then. Would she be stuck as a slime girl? Or would she explode like some food in a microwave? Who knows? But this new [Slime Magic] interested her deeply! [Slime Magic] Lv 1/10 Allows you to create and manipulate slime in expense of MP The nature of the slime you create is neutral ¡°Hmm?¡± Neutral? Does that mean that every different type of magic had their own nature? Well, fire would be, well fire. And water would be, well, water. That should be obvious. But what about gravity? Or paralysis? Or death?! Well, granted they exist. But whatever, that can come later! ¡°Muaa¡­¡± Her SP was extremely low, just one point above the empty 0. Her body felt weak and heavy, and she was struggling to keep her eyes open. Within the comfort of her cave, she slowly fell asleep. ¡­¡­¡­¡­¡­¡­¡­. ¡°Ngh¡­¡± How much time had passed since she last fell asleep? She didn¡¯t know, and she had no way of finding out. But the sun was still out, so she either slept for a short amount of time, or she slept for so long that another day passed by. She guessed it as the latter. She was a heavy sleeper, alright? She¡¯s a NEET at heart, so she had no schedule on these things! But that aside, her condition was back to full! Her SP was no longer just barely above 0! Yay for no dying again! But let¡¯s put that aside for now, she has more important things to try out! Mainly, her [Slime Magic]! She had absolutely no clue on how to do this, or if this skill was even useful or not? But hey, it could be a nice party trick if he needed him. Or it could be that one skill that just becomes super strong with sweat and dedication! Who knows! But, onto the topic! Trying to actually do this magic was much harder than she first expected. Sure, she knew how to morph or shape herself in her slime form, but creating more slime? How does that even work? She tried several different approaches, but all ended with a failure and her smashing her head into the wall because of the mental pain it brought her. Surprisingly, no blood came out, but still! Why is this so hard to learn?! How do those protagonists learn magic so quick?! They just see it, try it a couple times, and bam! The magic is theirs! But what the hell is this?! This is like Dark Souls level hard!! Give her an easy difficulty damnit!! ¡°Hah¡­I¡¯m hungry.¡± Leaning her back against the wall, she sighed and stared at her hands. The feminine fingers she had and that smooth skin only reminded her of how much she had changed from her male counterpart. And she also noticed a slight personality change. Honestly, she was terrified. The thought of fully losing the old her to a new personality shook her heart to the bottom of the earth. She couldn¡¯t even fathom how that would happen, but its already beginning. Calling the slimes cute, calling that bunny cute, her shyness when it came to her own naked body, these feelings were not something she normally had. Back as a boy, she didn¡¯t have any shame about this. Actually, shouldn¡¯t she feel excited about being a girl? Her anime dreams of being gender bended had come true! Yet, these fears overtook her excitement. *Boink, Boink!* But, more on that later. Turning over to the cave entrance, she saw a single lone green slime, bobbing up and down with a red apple floating around inside its body. The slime happily approached her and dropped the apple off. ¡°T-Thank you.¡± The slime bobbed up happily and left the cave, leaving her behind with a red apple in hand. She stared at the apple, unconsciously smiling as she nibbled on the sweet fruit. ¡°Mmm¡­¡± Somehow, even though those slimes had played and assaulted her, she couldn¡¯t feel any hostility from those green blobs. No, it was more like they were incapable of such thoughts. Heck! They might not even realise her feelings when they were sliming her! But either ways, she was thankful. Because of those cuties, she had lived and¡­Oh god, did she just think of them as cute again¡­? ¡°O-Oh god¡­¡± *Nom* But more on that later. This apple tastes great! [4] Revenge, B*tch ¡°M-My¡­head¡­ah¡­¡± Clutching her head, Diana stared at the wall and smashed her head, the stinging headache in her head persistently staying. Damn it, just leave already! Ouch, and that head bang against the wall really hurt¡­ She slightly regretted her choice of immediately trying to use her [Slime Magic] again. As you can see, all it gave her was a huge headache and the feeling of wanting to smash her head to an incoming bullet train. So yeah, that¡¯s a failure. If it wasn¡¯t enforced yesterday, it surely was now! Learning magic was no easy task! Seriously! She envied those anime protagonists that could easily learn magic because they had the ¡®Talent¡¯ or some sh*t like that. Seriously man, what the hell. But enough of that, because something else in the distance had caught her attention. Through the canopy of leaves, she could just barely see a trail of smoke rising into the air. The slight smell of burning amber lingered in the surrounding air. Shouldn¡¯t there be, like, a side-quest menu or something? Come on! There¡¯s the status screen, why not add a quest menu too?! But let¡¯s cast that aside for now. Her mind immediately focused onto the first monster she had killed, the damned goblins. Although they may not look like it, they do have a small ounce of intelligence, which meant that they had societies. And that smoke trail right there? Perfect indication of a small group or a tribe. Obviously, she couldn¡¯t go in all gung-ho and kill all those goblins. She would die before she could even morph. But if the group was small enough, and dumb enough, she might have a chance at slowly killing them one by one, or she hoped at least. Picking up the silver knife, she stood up and walked out of the cave. She softened her steps and made her way through the shadows, making sure that no goblins or cute white bunnies would ambush her¡­ But soon enough, the trees opened up, and there sitting in the centre of the open area, was a small group of 3 goblins. 2 of them were just normal goblins, while the third was a goblin mage, one that she distinctly recognised as the one with that insane stone tennis ball spell. A slight feeling of anger rose as thoughts of taking revenge and slicing off that damn goblin¡¯s head came up. This wasn¡¯t just about her being a NEET anymore, that goblin needed to die, for her pride! Not that she had any intact anyways. But how would she pick out one of them? They didn¡¯t look like they were in any rush, but she couldn¡¯t just slowly solid snake all the way there and not get killed! She wasn¡¯t a highly trained spy made to navigate through a base to stop some giant robot! She¡¯s a NEET damnit! Before, after, and forever! So, she picked out one move that she had always used to accomplish a similar task. Looking around, she noticed several stone pebbles lying around, perfect for her plans! Picking one up in her hands, she carefully aimed, and threw it at the goblin mage¡¯s head. *Tuk* ¡°Gugha?¡± ¡°Gugugha.¡± ¡°Gugha.¡± They had a small conversation in a language more akin to gibberish, before the goblin mage stood up, took up its wooden staff, and made its way to her direction. Following a stance from a spy movie, she hid behind one of the trees and watched the goblin mage, who had just entered the shadows of the leaves. A small grin emerged on her lips as she tailed it closely, her knife gleaming white in the shadows. The goblin mage was the one she feared the most, since her [Slime Valley] would work terribly against its magical capabilities. So if she managed to assassinate this damn goblin mage, her victory was pretty much sealed, maybe. ¡°Gugha?¡± ¡°¡­!¡± Feeling a small shiver up its spine, the goblin turned around and prepared its wooden staff. Ever since it went back into the forest, it had felt several different feelings of being watched. It wasn¡¯t the most skilled in detection magic, but this predator was too damn obvious. Well, that makes sense! She¡¯s not some ninja! Well, depends on which ninjas you¡¯re talking about. If you¡¯re thinking of the one with an orange jumpsuit and a headband, then no. There ain¡¯t no shadow clone jutsus, alright? Actually, there might be¡­ ¡°¡­Guh.¡± Shrugging its shoulders, the goblin mage softened itself and kept walking. She sighed silently and prepared her knife. It was now or never! ¡°Ha!¡± ¡°Gug-¡° *Puchi!* Jumping out from the shadows, Diana dove her knife into the goblin¡¯s throat, injuring it before it could even finish speaking. Blood spilled out of its neck wound as it fell over, its wooden staff rolling softly on the ground. A small *Ding!* entered her ears as a small message appeared. [Enemy has been slain. Gained 10 Experience] [[Assassination has been acquired. 1 Skill Point gained] Well, that should help a bunch! If only she got that skill before that, and she would¡¯ve done it with much more finesse! But the past is the past. She got the skill, she should be grateful! Although, if she had the chance to ask, was she gaining skills to fast? Or is this just easily it was to do it? Seemed a bit too fast for her, but whatever. Now, onto those two goblins! With the aid of [Assassination], she made her way back to the camp site as quietly as she could, hiding behind the cover of a tree just as she spotted the two remaining goblins, standing up with their knives held in hand. Did they somehow know of that goblin¡¯s death? How?! ¡°Gugha!!¡± ¡°Gugha!¡± ¡°Eek?!¡± The goblin¡¯s eyes stared in bloodlust as they charged at her, still hiding behind the tree. Quickly, she ducked and rolled away, dodging the goblin¡¯s incoming attack, that smashed that tree apart?! What the hell, what was that?! That was when she noticed the different with these goblins. On their arms and their chest, what looked to be black lines streaked across their green skin. They were most likely some kind of rune, or a tattoo, which meant that these goblins were different from the ones he had fought back at the cave! Well, whatever, they¡¯re coming!If you encounter this narrative on Amazon, note that it''s taken without the author''s consent. Report it. The goblins charged at her, slashing their knives violently. Being the complete noob she is at actually fighting, she immediately tripped on herself and fell. Her face planted straight onto the grass below. Luckily, she managed to keep her mouth shut, or she might have the chance of becoming a cow. The goblins saw this chance, and brought their knives down! ¡°N-No you don¡¯t!¡± [Slime Valley] activated, and she quickly morphed into her slime girl form. Her clothes fell through her body as she bent her body, her skill to mold herself proved helpful as she easily dodged the incoming attacks. Her slimy body wobbled slight as she morphed herself back and struck! *Puchi!* Her knife stabbed into one of the goblin¡¯s chest. Blood spilled out like an opened bag of candies. The red liquid spread everywhere, but the goblin wasn¡¯t giving up yet! Knife in hand, the goblin slashed its knife sideways. The knife cut through her slime body, but it remained intact as it melded back together. She quickly brought her knife down and ended its painful life. ¡°G-Gugha?!¡± *Puchi!* She sent another strike, this time aimed at the remaining goblin¡¯s neck. It tried to pull her arm off, but ended up squishing it instead, causing the knife to get stuck in its neck wound. The goblin screamed several times, before its voice ran out. It silently toppled over as messages popped up before her. [Enemy has been slain. Gained 10 Experience] [Enemy has been slain. Gained 10 Experience] [Congratulations! Peasant has levelled up to Level 1! Your stats have improved] ¡°F*ck yeah!¡± She raised her arms and shouted out. Her heart spilled with happiness as the fabled level up finally appeared! Its been way too long before her level up! Well, its only been 2 or 3 days, but to her, it felt like an eternity. Let¡¯s take a look at her stats! Name: Diana Race: Human Age: 17 Class: Peasant Lv: 1/5 | Exp: 15/50 HP: 12/12 MP: 6/12 SP: 8/12 [Strength]: 3 [Tenacity]: 2 [Agility]: 3 [Intelligence]: 2 [Dexterity]: 4 [Mentality]: 3 [Endurance]: 3 [Wisdom]: 3 [Longevity]: 2 [Skill Points]: 4 {Skills}: [Slime Valley: Lv 2/10], [Knife Mastery Lv 1/10], [Slime Magic Lv 1/10], [Assassination Lv 1/10] {Magic}: - {Titles}: [Slime Queen] Yes¡­Look at that stat increase man¡­Feels amazing. Sadly, her intelligence didn¡¯t get the same increase as the rest, but that¡¯s fine. Was that an insult, who knows? Clenching her fist, she felt the new strength in her, the one point increase she had seemed to affect her greatly. But let¡¯s take a look on [Assassination] next! [Assassination] Lv 1/10 You are skilled in the art of stealth and silence. You deal 15% more damage if you attack without the enemy¡¯s notice. Your steps are slightly quieter. The skill told her just like she expected from a skill called [Assassination]. I mean, looked at that! Although, it says that she will deal 15% more damage if she attacks ¡®Unnoticed¡¯. Does that also include attacking from behind cover without the enemy knowing where you are? She wanted to know immediately, but with no means to do so, she pushed that further down her bucket list. Sadly, there wasn¡¯t too much loot she could gather from this camp site. Well, these two silver knives could come in handy if hers break, so let¡¯s take those. But the one she was most interested in, was that wooden staff he left back with the goblin mage¡¯s dead corpse. Following the small trail of blood his knife left, she made her way back to the dead corpse, and just like before, the corpse laid dead on the floor, surrounded by a puddle of goblin blood. On that note, was there alchemy in this world? Can she use this stuff for potions or something? Meh. She¡¯ll find out soon. What she wanted though, was right next to the goblin. The wooden staff, somehow not covered in blood. She picked the staff up and inspected it. From its looks, it was literally just a wooden pole, that became bulkier as it went up until the top. It was about¡­uh¡­1 metre? Maybe? Math was never her strong point, despite owning a trading site. But what was most interesting, was the slight tingling feeling she felt in her palm as she held the staff. At first, the feeling was extremely clear, but as she held it longer, the effect seemed to fade away. Obviously, that was magic, but what does that effect mean? Well, whatever. She should head back now, unless she wanted to deal with more monsters out here, especially that white bunny. A slight bubbly feeling arose as she imagined herself patting that white bunny, but she snapped herself out of it just as quick. She turned towards where her cave was, or where she thought it is anyways, and walked. Her soft steps echoed through the shadows, overtaken by the sounds of the rustling leaves. She smiled happily as she stared at the 3 knives and the staff she had. Loot has been acquired! No money or potions, but weapons? Let her in on this loot train! Soon enough, she was back at her humble little cave opening, an opening that didn¡¯t really lead to a cave, but a small dead end. She was slightly disappointed, but knowing that no spiders would crawl on her and inject poison while she¡¯s asleep far outweighed her desire to enter this imaginary dungeon. Hmm¡­Actually, does dungeons exist in this world? She guessed they did, but she could never truly know until she enters one herself. Sighing softly, she walked into her cave and set the loot she gathered on the floor. ¡°Knives¡­and a staff¡­I wonder if that¡¯ll help me with this slime magic¡­¡± Picking the staff back up, she took a look at her MP. 6 should be enough for now, and if she failed to do it now, she could just rest and wait until it fully restores. Not that she knew how long that would take. She was too lazy to count. Just like she did before, she tried focusing her magic, to perhaps, perhaps, create some slime in the air. She wasn¡¯t too hopeful, and she shouldn¡¯t be. She isn¡¯t some magic scholar, so this should be much harder. But to her pleasant surprise, a visible reaction could be seen from her staff as it began to shine dimly. Her eyes widened as she stared at the beautiful glow, losing focus on the magic, causing the staff to stop glowing. ¡°Huh¡­¡± She tried once again, this time swearing to not get distracted. Her mana swirled around as she tried to force it to enter the staff. The staff noticed her will, and glowed, sucking some mana from her. She stared in awe, as above the staff, a small sphere of slime formed, wobbling slightly as she did her best to maintain it in the air. Sadly, she lost focus and it fell down, splashing all over the floor. But her mood was no longer down, she was ecstatic! She had just casted magic! Magic!! Albeit not a powerful or flashy one, but its magic, dude! Just, wow¡­ But the way she casted magic was obviously amped by the help of this staff. She couldn¡¯t control her own mana, but the staff noticed her will and sucked some out, and helped in her desire to form the magic. But what happened if she lost her staff in the middle of a battle? She would be dead meat! As fast as she could, she needed to learn how to manipulate her own mana, and then cast the magic without the aid of a staff. Well, that goes straight to the top of her bucket list! ¡°Uaahh¡­¡± But she should really rest now. Her MP was dropping low, and she was exhausted after her hunt. The feeling of the blood spilling on her hand still visibly stuck in her mind, causing her to shiver slightly. Not from the feeling of blood, but the thought of having her own blood spilled. The concept of death did not stick well with her. And with those thoughts, she silently drifted into her sleep. ¡­¡­¡­¡­¡­¡­¡­.. Slowly, she opened her eyes, her eye lids still feeling heavy. She was fully rested, but she wanted to just lie down and sleep again, knowing that it was impossible to do. She had many plans to accomplish, she can¡¯t stay here forever! First, she needed to train, just enough for her to sustain herself in a battle situation. She needed to learn how to use this [Slime Magic] as an offensive skill. Training her skill with the knife wouldn¡¯t be that bad too. And most of all, she needed to learn how to control her own mana. And she also needed to find how to live on her own without these slimes! *Boink!* ¡°Eek?!¡± By the cave entrance, she saw a lone green slime, bobbing up and down as it let go of the apple it was holding inside it. Slowly, she took the apple and began to nibble on it, not noticing that this slime had refused to leave. *Nom* ¡°Mmm¡­H-Huh? Why aren¡¯t you leaving?¡± *Boink!* The slime bobbed up and down, jumping slightly closer to her. She tried to back away, but the slime followed her, insisting on staying with her. Why? She didn¡¯t know! Why would she know! There¡¯s no slime language, is there?! But a name is in order-, why did she want to name this thing? She just met it! Why is she trying to name it?! Gah!! Her personality is getting messed up!! But no, really, a name is probably needed if it wanted to stay. ¡°Umm¡­¡± But, there¡¯s a problem. She¡¯s bad with names! Even her nickname ¡®ProDavin888¡¯ was given to him from a random name generator he found back on uncle google! There¡¯s no google here! There¡¯s no internet either! How was she going to name this thing?! ¡°Umm¡­Slimey?¡± Was all she could come up with. *Boink!* The slime happily bobbed up and down as her mouth fell open. Not because of the slime being happy, but because of the message that appeared before her. [Slimey volunteered to be your familiar. Y/N?] ¡°Seriously?¡± This slime took her name, and wanted to be her familiar? Seriously? Wasn¡¯t the process of gaining a familiar much harder than this? But before she knew it, her finger moved, and pressed ¡®Yes¡¯. *Boink!* [Slimey has become your familiar] ¡°¡­¡­O¡­kay¡­¡± Slimey bobbed up and down happily, its feelings now shared to her through the familiar bond holding them together. Diana grew surprised for a moment, but later smiled and looked at slimey, who seemed to be staring back. But she was unsure, since it didn¡¯t even have eyes! Well, she has a familiar now, so¡­yay? [5] Goblins!! How rude?! ¡°Ngghh¡­Stay¡­Focused¡­¡± Diana softly grunted as a small slime ball floated above her wooden staff, the small green blob wobbling and jiggling slightly as she did her best to maintain it. But alas, it was not her day, as her control fell out and the slime fell down, splashing all over the stone floor. ¡°Hah¡­Damnit¡­¡± She sighed and threw her staff down. Her mind was ready to just fall apart, so let¡¯s stop now. Slimey tried to encourage her, jumping all around the cave like a proactive cat in the summer day. Seriously, what are you doing? *Boink!* ¡°Thanks¡­¡± But! Despite what it looks like, she did accomplish something! And something big too! Name: Diana Race: Human Age: 17 Class: Peasant Lv: 1/5 | Exp: 15/50 HP: 12/12 MP: 0/12 SP: 0/12 [Strength]: 3 [Tenacity]: 2 [Agility]: 3 [Intelligence]: 2 [Dexterity]: 4 [Mentality]: 3 [Endurance]: 3 [Wisdom]: 3 [Longevity]: 2 [Skill Points]: 4 {Skills}: [Slime Valley: Lv 2/10], [Knife Mastery Lv 1/10], [Slime Magic Lv 2/10], [Assassination Lv 1/10] {Magic}: - {Titles}: [Slime Queen] As you can see, her [Slime Magic] was now Level 2! Hell yeah! So, what does it do?! ¡­Not much really. She did feel a slight increase in control, but other than that, nothing. Disappointing, I know! She also managed to further improve her time limit, but it wasn¡¯t all that impressive. She would still lose control after about 20 or 25 seconds, so it wasn¡¯t that great. Anyways, she was tired! Practicing magic took much more than she originally thought! Before long, she had completely fallen asleep. ¡­¡­¡­¡­¡­¡­¡­¡­. Meanwhile, not far off from where Diana was sleeping, a small tribe could be seen. Simple stone huts were erected from the ground, surrounding the fire that was blazing in the centre. The lack of any windows or doors allowed the cold wind to enter. ¡°Guuu¡­¡± And inside one of the houses, stood a lone goblin, his fists pressed against his stone. The goblin didn¡¯t look all that different from the rest of his kind, but his height was definitely taller, and the black runic lines on his green body seemed much more alive than the rest. His clenched fists trembled in anger as he recalled what the scout had said to him. As of recent, a group of 3 goblins had been going out, scavenging and gathering food for their kind. He and the rest of the tribe were extremely grateful, but were horrified to hear, that just this day, they had been found dead. The two goblin guards laid dead near their camp site, their weapons missing. While the goblin mage was seen not far away, his trusty staff missing. He would¡¯ve assumed this as their mistakes, but after hearing that there were traces of slime near the two guards¡¯ corpses, the goblin was convinced, that the Slime Queen had returned. A deep rooted anger, and fear arose from his heart. He knew quite well about this Slime Queen from the legends his ancestors had left about it, and how their tribe had fought against her for many decades. Alone, they were powerless, but banded together, they summoned the strongest magic they could muster and fired, taking advantage of the slime¡¯s weakness to magic. In a brilliant explosion, the slime queen died. But now she¡¯s back?! With the recent killing, there only remained about 10 or so goblin mages, him included. But will that be enough? From what he heard, there were traces of dried blood around them, which meant that this Slime Queen was able to handle weapons. This pretty much made her into an even bigger threat than she is. The goblin stared at the pendant around his neck for a moment, the one gift he had received from his father before his death. He held the gift and prayed, before his eyes burned bright with anger. He immediately charged out of his home and informed his fellow goblins about this Slime Queen. Little did he know, that Diana was as far as you could picture as a ¡®Queen¡¯. ¡­¡­¡­¡­¡­¡­¡­¡­ The night naturally passed by, and the sun was back shining up high. The golden rays of the sun still failed to go through the dense canopies of leaves below. Thin shadows casted across the ground below the trees. ¡°Mmm¡­¡± Slowly she awoke, rubbing her eyes and yawning. Ah~, the cold morning breeze felt pleasant¡­ *Boink!* ¡°Nn?¡± Right after, her trusted Slimey returned to her with breakfast! As always, the menu was an apple, but it wasn¡¯t like she could really do anything about that, so time to eat! *Nom-* ¡°[Fauir Boll]!¡± But just as she took her first bite, a goblin mage appeared! A staff was held in its hand, channelling its magic as a ball of fire formed above him. Wait, isn¡¯t it getting larger? ¡°Ua?!¡± *Boom!* In a rush, she picked up her knife and jumped back, avoiding the fire ball. A powerful explosion sounded as, eh?! Her staff was burning?! Vengeance shall be acquired!! ¡°Haa!!¡±The narrative has been taken without permission. Report any sightings. Knife in hand, she leaped straight for the goblin mage. This was for her staff!! ¡°Ha!¡± *Pak!* Knocking its staff away, she cancelled its magic and stabbed her knife! Blood poured out, but it was still alive! ¡°Take this!¡± Sadly, she couldn¡¯t make her finisher as brutal as mortal combat, but stabbing her knife into its neck should be enough for a change! *Puchi!* ¡°G-Gu¡­¡± ¡°?!¡± But the goblin wasn¡¯t done yet! Tracing its blood soaked finger across its body, the black runic lines on its chest began to shine an ominous purple. Feeling a shiver up her back, she jumped back and hid within the cave. The runes continued to shine, until- *BOOM!!* ¡°A-A suicide bomber?!¡± An explosion occurred, sending dust and debris all around! Luckily, her cave shielded her from most of the damage, but it seemed like this cave wasn¡¯t going to stand for much longer! She needed to get out of here! Picking up her knives, she jumped out of the cave as the ceiling collapsed behind her. Standing up, she turned around the see her former shelter, decimated into nothing but a pile of rocks. She felt kinda sad now. You know, like when you¡¯re forced to move out from a home you¡¯ve grown to love? Not saying she loved this cave as her home, but it definitely saved her from the many horrors that lurked within the night. She sighed and looked at the mess that rude goblin caused to the surroundings. There didn¡¯t seem to be anything she could salvage, all she could see was a splatter of guts and blood. Hah¡­This is terrible! Her home was destroyed, her staff was burnt away, and she¡¯s left in this forest with no means on how to defend herself! What a great start to her story! Now then, where to head? There was no map here, nor did her status screen display any maps like games did, so she wasn¡¯t left with much to go on. After staring out at the thousands of choices to make, she simply said ¡°F*ck it¡¯ and went left. As she walked through the forest, her mind continually thought over about how she could maybe try and control her own mana. Would be damn helpful if she could cast magic without using any staffs! If she had to pick an idea, it would be to meditate. You know, like sit under a waterfall and let the energy circulate within you, or something? Qi and stuff? But how was she supposed to do that?! But perhaps there was different way, but what is it? But save that for later! Just as the trees diverged, her eyes fell upon the beautiful lake before her. The surface shined under the golden sun. In a slight daze, she brought herself to the edge, and dipped her toes into the water. It wasn¡¯t too hot, nor too cold. It felt¡­perfect. Looking at the water, she stared at her own reflection, the reflection of a cute girl looked back at her, as if to remind her that the girl was indeed her. From the first moment she stepped on this world, she hadn¡¯t gotten a good look at her new self, and from the first look, she could definitely say that she looked quite, cute. Her long black hair went down to her back, glistening under the sunlight. Her body had become significantly slimmer, and much more feminine. Her arms and legs were much smoother, her skin as smooth as silk. Her chest was ¡¯adequately¡¯ sized, though she had no means to measure them! She placed her hand on her cheek, feeling the smooth skin she now had. The touch she felt was definitely new, yet it felt so familiar to her. It was as if she was born in this world, her skin lacking any contaminations from the pollution Earth had. But enough of that, let¡¯s continue training on [Slime Magic]! Wait, she didn¡¯t have the staff, which meant that she couldn¡¯t even cast magic in the first place! Damnit!! ¡°Hah¡­I guess I¡¯ll just try and control my mana¡­¡± ¡­¡­¡­¡­¡­¡­¡­ The result of that, was a complete failure. She had spent a couple hours sitting still, trying to bring out her inner mana and control it, but to no avail. Although, her training was not without any results. Although she did not manage to control her mana, she felt a much stronger grasp of her own mana, now actually able to feel it moving inside her. It felt just like a river, flowing down towards who knows where. The feeling was similar to the one she felt back when she touched the wooden staff, but that one felt much weaker. Now all she had to do, was to find a way to direct, and finally control her own mana to her own will. It would be hard, it would be tough, it would probably take days or even weeks to come, or months even! Sighing to herself, she laid her back down on the dirt and looked up, her eyes staring up towards the blue sky above her. Distant stars blinked despite it being morning, somehow reminding her of just how far she had gotten from her home. She wondered if perhaps the cold embrace of death would bring her back, that all this was just a simulation. Sure seemed like a good reason to drive a silver knife through her skull! But as more time passed in this world, that seemed less likely. The feelings she felt in this world felt real, sometimes too real. *Boink!* ¡°Yes¡­Let me rest¡­¡± Slimey bounced up and down, feeling slightly worried at her silence. She quickly assured it as she pat it softly, the green blob jiggling from her touch. Slimey seemed to feel satisfied and backed away. The time seemed to pass by quickly, as her mind seemed to sit still in a daze, watching as the sun above slowly begun to move along the sky. The giant celestial star moved and shined upon this world, the warmth of the sun reaching down towards her. She relaxed her every existence and slowly fell asleep, not noticing the message that had just popped up. [[Alleviation] has been acquired. 1 Skill Point gained] ¡­¡­¡­¡­¡­¡­¡­ *Boink!* ¡°Ngghh¡­¡± *Boink!* ¡°What¡­is¡­it¡­?¡± Rubbing her eyes, she slowly opened her eyes and looked up, seeing Slimey who was sitting above her. Seeing as its master was awake, Slimey hopped off from her chest. It seemed satisfied as it rolled over the apples it gathered over her sleep. ¡°Thanks.¡± Pulling her toes out of the lake, she picked up one of the apples and ate. As she was eating, she decided to look over her stats, and immediately noticed the new addition to her skill set. [Alleviation] Lv 1/5 Allows you to enter a state of meditation, where exhaustion, pain, and feelings fades away. In this state, you recover slightly faster. She wasn¡¯t sure how she managed to gain this skill, but she didn¡¯t care. This was awesome! She had just thought of how meditation would help, and guess what? She gets a skill that allows her to do just that! Was her luck finally looking up?! Though, she did find it weird that this one only went up to Level 5, not like the rest of the skills she had. Was this considered a high ranking ability, or was it just that easy to master? Oh please let it be the latter! But let¡¯s get on with it! Her heart couldn¡¯t calm down the excitement she got when she imagined just how much much this would help her in trying to control her own mana. Ooh! Would this also give her access to Qi? That would be amazing! She could just imagine herself shooting out beams of energy from her palms. Well, that¡¯s for later. Sitting down with her legs crossed, she closed her eyes and sat still. She didn¡¯t really know where to start, but as more time passed, she found that it became easier and easier to calm herself down, until finally, all her thoughts, feelings, and senses were dulled out, leaving her seemingly floating in an endless void of her own mind. Then, she felt her mana, seemingly moving around her body without much of her control. Slowly, she reached out for her mana, and grasped for it. The feeling of her flowing mana flowed against her will. She felt it like a river, her magic simply riding down the slope that eventually carried it towards its destination. She needed to change that destination, change its course with her will. But even with her increased focus and lack of senses, she still found it difficult to direct and control her mana, but not impossible. She was ready to continue, but Slimey quickly snapped her out of her trance. ¡°Huh? What is it?¡± *Wuushh!* Picking her knife, she jumped aside and avoided the incoming wind barrage. Out from the trees, came a group of 3 goblins, 2 melee fighters and one mage. The perfect combination to take her down! Well, too late to back down now! It seems a battle was bound to happen! [6] Goodbye, Beginner Forest~ Have you ever felt like a one-man army while playing a fantasy RPG? Sure you would, your grossly over-levelled character must be 20 or so levels above your enemies! Of course you would treat them like sand in the middle of the desert! But sometimes that would still be the case even without being over-levelled! Which was probably because of some balancing issues or a glitch in the system. If so, then give her a way to glitch herself out of this situation!! ¡°Stop chasing meeeee!!!!¡± ¡°Gugha!!¡± Diana ran with all her might, not daring to look back towards the chasing enemies. Small barrages of wind were casted from the goblin mage in attempt to defeat her, only to land and crash into a nearby tree bark. But it wouldn¡¯t be like that for so long, as her SP was pretty much dying right now!! ¡°What to do?! What to do?!¡± Her mind rumbled as she did her best to find a way out of this damn situation! The situation was absolutely helpless! Her staff was gone, her knife was pretty much useless, her skills wouldn¡¯t help much, and Slimey couldn¡¯t even catch up to her and stayed back at the lake! What the hell was she supposed to do now?! Her legs continued to sprint across the shadows, avoiding the incoming wind barrages from behind her. She could just barely hear grunts and groans coming from the goblins, complaining about how annoying this Slime Queen was. Diana of course didn¡¯t understand them and only considered them as a chant, making her even more tense than before. But she didn¡¯t have much time left. One more minute of sprinting or so, her SP would be left empty, and she would be completely vulnerable to these goblins. She shivered unknowingly as she imagined their knives or that wind barrage cleaving and cutting into her skin. She didn¡¯t want that. She didn¡¯t want that one bit! But how was she supposed to get out of this?! That was when, in a sudden strike of intelligence, she came up with a plan, a plan which, she admitted, was something she should¡¯ve realised to do. And so, [Slime Valley] activated! ¡°Gugha?!¡± The goblins watched in shock as the girl before them, morphed into that of a slime. Her clothes slid through her body as her slimy body completely formed. Smiling at her chasers, she ran towards her left, the goblins quickly chasing after her. ¡°Gugha!¡± There in front, they could spot a trail of green slime, a perfect trail only left by a slime. Grinning widely, they ran at her, thinking that she had been played. But of course, they were the ones being played, as from a small bush, Diana emerged, her body already morphed back to her human form, bare and naked to the cold air. The plan was simple, run away, throw some of her own slime in a random direction, and hide. The goblins were dumb enough to actually believe her plan, hence why they were called stupid by this world, and her previous world. Picking up her clothes and her knife, she put her clothes back on and walked back towards the lake. She knew she wouldn¡¯t get lost, as her familiar bond with Slimey gave her enough information as to where to head. Not long after her escape, she emerged back before the lake, the clear surface still looking as clear as ever. *Boink!* ¡°Yeah, I did it!¡± She happily bent down and petted Slimey, the little green blob jiggling in happiness upon the return of its master, and its queen. Sighing to herself, she sat down by the lake and opened her status. Name: Diana Race: Human Age: 17 Class: Peasant Lv: 1/5 | Exp: 15/50 HP: 2/12 MP: 1/12 SP: 1/12 [Strength]: 3 [Tenacity]: 2 [Agility]: 3 [Intelligence]: 2 [Dexterity]: 4 [Mentality]: 3 [Endurance]: 3 [Wisdom]: 3 [Longevity]: 2 [Skill Points]: 5 {Skills}: [Slime Valley: Lv 2/10], [Knife Mastery Lv 1/10], [Slime Magic Lv 2/10], [Assassination Lv 1/10], [Alleviation Lv 1/5] {Magic}: - {Titles}: [Slime Queen] As you can see, she did not come out unscathed. Her HP had dropped right under 20%, her MP was down to a drop, and her SP was just barely above the number zero. She was extremely lucky to have monsters dumb enough to accept that small slime drop as an actual trail! But that aside, she needed to sleep! She wasn¡¯t in a state to fight, nor would she really ever be if she would stay with stats as crappy as this! But she convinced herself to keep on fighting, no matter how high the wall seemed to be. But, rest comes first. Resting her back on a nearby tree, she slowly closed her eyes, not before recalling a certain skill that claimed to help her with this. She brought up her status once more and checked the description for her newly acquired skill. [Alleviation] Lv 1/5 Allows you to enter a state of meditation, where exhaustion, pain, and feelings fades away. In this state, you recover slightly faster. Crossing her legs, she closed her eyes and relaxed, letting her exhaustion slowly wash away. Time to heal back! And so, time continued to pass by. ¡­¡­¡­¡­¡­¡­¡­¡­¡­¡­ Several hours had passed, and Diana finally snapped out of her trance. Her eyes shot open and her whole body jerked, causing her to bump her head onto the tree bark she was resting against. She held her head and cried slightly. *Boink?* ¡°I-I¡¯m¡­fine.¡± Wiping away the tears, she smiled and patted her little familiar. She couldn¡¯t just cry from that, she¡¯s a man! Woman! She¡¯s a woman! That aside, her condition seems to have healed back to full. Her SP was roaring to go! Looking up, she noted that the sun was, indeed, still in the sky. Which meant that her [Alleviation] skill really did work! Or she just awoke early. She is quite the heavy sleeper, especially after days of constant grinding in WoW. But then, she realised something. What if those goblins realised they were being played, and returned here? What could she do then? She couldn¡¯t fight back, and she wouldn¡¯t be able to use the same trick twice! She couldn¡¯t remain here for any longer, no matter how much the clear surface of the waters enticed her. Packing up the 3 knives she had, she called Slimey over and walked in a random direction, with the hopes that they wouldn¡¯t encounter anything in this journey. Of course, that was impossible given where she was, but she could hope! As if this world wanted to completely sh*t on her, a group of unbeatable monsters appeared! Magical monsters, a type of monster untouchable by mere brute force. As they say, you fight fire with fire, and that applies as well to the way to defeat them.If you come across this story on Amazon, it''s taken without permission from the author. Report it. One needed magic to defeat these beings, or other supernatural forces this world had to offer. Diana had none of those, so she could only hope to run. And run she did! By the time night had come, Diana was left tired and weak, panting as her SP fell down to zero. Dropping down and resting her back against a nearby tree, she immediately entered her trance and fell asleep. ¡­¡­¡­¡­¡­¡­ Dawn approached, and Diana started the day with a daily dose of running away in absolute fear as she tried to avoid the impending death these magical wraiths. Their dark miasma, while slow, corrupted and killed anything it touched. Trees, plants, a wandering bunny, nothing was safe from these damn things! Luckily, just like their attacks, the wraiths¡¯ main weakness was their snail speed. They didn¡¯t bother to chase after their opponents if they were too fast, and when they reached far enough, the wraith would simply lose interest and return to doing whatever they were doing before this. The problems is, they were everywhere! And with a simple run, she out sped the wraith, letting it return to its own business. She sighed softly and trotted on. But she did not walk for long, as from within the trees¡¯ cover, came a single goblin, a leather backpack worn on its back. ¡°Another one!¡± ¡°G-Gugha!¡± Seeing the knife she just pulled out, the goblin jumped back in fright and waved its arms in the air, most likely as a sign of peace. She stared at the goblin for a while, before sighing and putting the knife back. The goblin sighed in relief and stood tall. It was then she realised, that it was trying to initiate a trade. Finally! The first non-violent NPC she had met! Or so she thought as such. Although, she didn¡¯t know how to communicate with this green-skinned child. Their language sounded like gibberish to her, and she was pretty sure these goblins couldn¡¯t understand English. So, she simply took out one of her knives and pointed at it, before pointing it at the goblin. The goblin flinched as it thought of it as a warning, but seeing the relaxed expression on her face, it immediately realised that she was willing to trade away her silver knife. It smiled and took out a book from its backpack. The book¡¯s cover was worn out, as if it had been kept for quite some time. Its pages looked like they had been spilled on with some coffee, tainting the white with a nice tinge of light brown. Her thoughts immediately turned towards a spell tome. You know, like those skill books that give you new skills that when you read it? Yeah, those things! In a rush of excitement, she quickly traded her knife for the book and turned away, ready to read through the worn out book. *Boink!* ¡°What?¡± But Slimey immediately gave notice, and Diana instantly turned around, only to see the goblin reaching for her with the knife she had just traded. In a state of shock, she morphed into a slime girl, the knife simply cutting through her slimy flesh before it healed back. ¡°You¡­¡± A flame of anger burned in her slimy eyes as she felt the feeling of being betrayed. It perfectly reminded her of that f*cker that betrayed her team in the middle of the battle. Her anger exploded as she took hold of her own knife and stabbed it repeatedly, wounds after wounds opening on the goblin¡¯s chest. With one final strike, the goblin fell down, bleeding, and dead. [Enemy has been slain. Gained 7 Experience] ¡°Hah¡­Hah¡­¡± Changing back to her human form, she gazed at the dead goblin, its face twisted in horror as it realised just how much of a mistake it had made. And it would be its last mistake. She pulled the leather backpack it was carrying away and checked what it had inside. She wasn¡¯t robbing it, okay? To her disappointment, there was nothing of value inside, only a couple pieces of bread and a small copper coin. This was probably the currency in this world! But that was not what she wanted to focus on! Down by her fallen clothes, the worn out book sat silently, calling for her to read it through and through. She happily complied as she slid her clothes back on and picked up the book. With Slimey by her side, she sat down by a tree and opened the book, only to realise one major flaw in her plan. She couldn¡¯t even read this! But! To her delight, there were illustrations! Praise the sun! And just like she had guessed, this was a magic tome! From what the pictures had, this magic would allow her to¡­uh¡­create bubbles? Really? There might be something special about the bubbles, so it might still be special. Strapping the backpack on her, she placed the book inside and stood up. She needed to find a place to stay. And also find some food. Her stomach had been running empty as of late. Picking a random direction, she simply shrugged her shoulders and walked on, not really knowing where this would take her. And of course, she runs into more wraiths! Ahh!! These things are suddenly everywhere! Where did those cute little bunnies go?! She was even beginning to miss the slimes! But not as much, since she did have Slimey by her side! And that was how it went for about 5 days, running away from those damned wraiths and resting when she needed to, killing the incoming goblins that she encountered and stealing their loot off their dead bodies. Usual RPG gameplay. Until finally, the fabled Level up appeared once more! [Congratulations! Peasant has levelled up to Level 2! Your stats have improved] ¡°Finally!!¡± Shouting out to the world about her achievement, she brought up her status and read in excitement. Name: Diana Race: Human Age: 17 Class: Peasant Lv: 2/5 | Exp: 19/75 HP: 12/14 MP: 10/14 SP: 11/14 [Strength]: 4 [Tenacity]: 3 [Agility]: 4 [Intelligence]: 3 [Dexterity]: 5 [Mentality]: 4 [Endurance]: 4 [Wisdom]: 4 [Longevity]: 2 [Skill Points]: 5 {Skills}: [Slime Valley: Lv 2/10], [Knife Mastery Lv 2/10], [Slime Magic Lv 2/10], [Assassination Lv 1/10], [Alleviation Lv 1/5] {Magic}: - {Titles}: [Slime Queen] Look at those sweet increases man! Just look at them! Might not look like much to an ordinary RPG player, but to her, this was like a blessing. Her long trot across the monster filled forest had finally bore fruit again! Oh, how she couldn¡¯t wait to reach Level 5 of this damn peasant class! Besides power levelling herself, she had also spent some time training to try and control her mana once more. Every time she did, she would always feel so close, yet, the burden of reality pushed away those fantasies as she felt her grip slip away. Her progress on the magic tome hadn¡¯t been doing well either, as he realised that he needed to control his own mana first before finally trying to learn this damn spell. But! She did manage to raise [Knife Mastery] to Level 2, so there¡¯s that! As for her progress to find a place to stay, let¡¯s say that it completely failed. She had seen nothing different besides the same view of the trees and the shadows casted by the leaves above her. That was, until the 6th day, when she finally saw something that was different! The trees cleared out before her, revealing the clear grassy plains before her. The plains stretched out farther than her eyes could see. She took a deep long breath, enjoying the feeling of freedom from that dark shadowy forest. Certainly, she was glad to be out of that damn place, but it felt quite bitter too, since he was abandoning the place he pretty much had called home. Shedding a single tear, she turned away from the forest and walked on, her head held high as she stared towards her future, with Slimey walking by her side. What the future had in store, she did not know, but she would find out! Like, right now. *Crackle, crackle* ¡°Huh? That¡¯s¡­¡± Speaking as silently as she could, she watched the walking undead by the other side of the hill she had just climbed. The skeleton was walking under the broad daylight, wearing a dark purple robe. Its skeletal fingers wrapped around the menacing looking staff it had, the purple gem on the tip shined a dangerous purple. Was that thing some kind of ¡®Overlord¡¯? The staff it had looked way too fancy to be that of a normal monster. But! If this was a boss monster, or a mini-boss even, doesn¡¯t that mean that the staff is probably something good too?! Her gamer heart jumped in joy as she could just taste that sweet loot. There was obviously no money drops here, but that doesn¡¯t matter! That staff was going to be hers!¡¯ ¡°Okay¡­¡± Obviously, she would instantly die if she fought it head on, so that was a no. Instead, let¡¯s make use of this [Assassination] skill for once! In that forest, this skill had pretty much taken a back seat, except for that one time with that green insect she found. She silently dropped her leather backpack down and took out her knife. Silently walking down the hill, she crouched and continued following the skeletal mage. It did not seem to have spotted her, yet. Once she gets spotted, she¡¯s going up to the heavens. Oh! Would there be a high school up in limbo? That might be nice! But just as she came close, a terrible shiver crept up her spine. Her whole body shivered as she felt the terrific pressure the skeletal mage was extending. Her legs and arms shook in fear, her mind shouting to her to go back. But her heart pulsed with energy, and slowly, she crept up behind the skeleton, her knife shining with death. The silver edge still keeping its shine. Swallowing her spit, she readied herself, and swung the knife at the skeleton¡¯s neck! *Bak!* The knife stabbed into the skeleton¡¯s neck, and a crack formed as she pulled it out. Eh, w-why is the skeleton still alive¡­? *Creeaakk* ¡°H-Hii!¡± The skeleton¡¯s skull rotated around, and its empty eye sockets glared at her. A vicious purple flame lit in between its empty eyes, staring directly into her soul. The skeleton cracked a deadly smile, and lunged at her! At that moment, Diana knew, she f*cked up. [7] Effects for You, Effects for Me! At that moment, Diana knew, she f*cked up. ¡°H-Hii!!!¡± In fear, she held her knife and jumped back, avoiding the deadly grip of the skeletal mage. A maniacal smile appeared on its skull, a bright purple flame brightly burning within its empty eyes. She now knew, just how bad of an idea this whole damn thing is! She was severely under-levelled! That damn skeleton just survived a knife to its neck, added with the bonus from her [Assassination] skill too! ¡°Kiiikikiki!¡± ¡°W-What t-the hell am I f-fighting!?¡± Sensing the pitiful excuse of a mana pool she had, the skeleton mage dropped its staff onto the ground and clenched its hand. A deadly black miasma appeared from its robe and surrounded its skeletal fist, an aura of death floating around it. The skeleton lunged forwards, and sent a punch. She ducked down from the punch, but another fist from below sent her flying back. She crashed onto the dirt, wincing in pain as she did her best to get up. Wasn¡¯t this guy a mage¡­? Slowly, she managed to stand up, but too she was too slow. Another punch was sent at her gut, a gasp escaped her lips as she was sent flying once more. Her HP took a drastic fall, dropping from her newly increased 14, to a dangerous 5! She didn¡¯t have any potions either! It isn¡¯t like this damn skeleton would wait for her to munch on her food and heal! This is reality! She isn¡¯t some Dragonborn! But then, hope appeared! *Boink!* Behind, where the skeleton¡¯s staff laid, Slimey could be seen, slowly rolling the staff over to her. She quickly understood what its intentions were from the familiar bond, but she would¡¯ve known nonetheless. She didn¡¯t know what staff that was, nor what it would do to her, but it was her best shot at this b*tch! She couldn¡¯t use magic, and her knife skills were useless! That damn staff was her best option! But, even if the skeletal mage hadn¡¯t noticed Slimey, it wasn¡¯t going to wait for her. Cracking a grin, the skeleton slowly walked towards her, its two hands covered in a deadly miasma, entailing absolute death. She couldn¡¯t wait for the staff any longer! She needed it now! And she ain¡¯t no Thor to have that staff fly to her! And so, [Slime Valley] activated! ¡°Kiki?¡± *Wuushh!!* Controlling her own slimy hand, she extended the arm towards the staff, and pulled it towards her. The skeleton didn¡¯t understand, and simply squashed the arm she extended, breaking her connection with her hand, along with a fifth of her mana. But it was enough, as the skeleton was shocked to see its own staff rolling past it. Regenerating her arm back, she took hold of the staff with her other hand and held it towards the skeleton. She severely wanted to stand and stab her staff into the dirt, shouting ¡®You shall not paaasss!!¡¯, but let¡¯s save that for another time. ¡°K-Kiki!!¡± Realising that its staff had been stolen, the miasma around its arm thickened, and shot out towards her. She moved by instincts, closing her eyes and awaiting the incoming death. And she did feel the death. But it never reached. ¡°N-Ngh¡­?¡± Opening her eyes, she was shocked to see that the purple gem on the tip, was taking in all the miasma it shot out. The gem greedily absorbed the miasma, so much so that all the miasma that had been present, had disappeared. Shining brightly in a dazzling purple, the gem glowed and covered the entire area in a purple shine. She shut her eyes out, hoping that this beam of light would do no harm to her, knowing that it was impossible for it to not to. Slowly, she began to feel her energy deplete. Her HP, MP, and SP quickly went down to zero as the gem continued to emit the purple light, the beacon shooting up into the clouds above. And before she knew it, she had fallen unconscious. ¡­¡­¡­¡­¡­¡­¡­. Ooof¡­That hurt. ¡°U-Ugh¡­?¡± The world blurred and twisted, or was it her own vision? She didn¡¯t know, she didn¡¯t really know¡­What happened actually? The scenery around her seems fine, Slimey¡¯s simply enjoying a nap there, and the skies were clear. Where did the skeleton go? But as she stood up, she saw the skeleton, lying on the ground. She tensed up for a moment, but as she saw the empty eye sockets the skeleton had, she now knew, that the life it once had was snuffed out. The purple flame that once burned in its eyes were no more. She sighed for a moment, knowing that she had survived. Not won, survived. How did she know? There weren¡¯t any messages screaming to her about her experience gain, so she couldn¡¯t have beaten it, right? She was about to think about it further, but the cold wind brushing across her naked body was giving her shivers. Picking up the clothes she left behind, she put them back on, realising that they didn¡¯t really help at all. A loose white shirt and some short pants weren¡¯t going to help much, are they? But then, she spotted the cause of all of this, the staff. Walking over to it, she picked it up and inspected it. The staff itself looked indifferent, but the gem that once laid above the staff was no more. Did it break because of this? Probably did. Anyways, she¡¯s tired now¡­That battle hadn¡¯t left her with much to go on. Her condition had healed slightly from the quick rest, but it wasn¡¯t going to do her any good if it stayed like this. So, just like always, it was resting time! Sitting down with her legs crossed, she closed her eyes and relaxed. Sadly, there wasn¡¯t any save options here. Well, there might be churches here, so she could save her progress there but¡­That¡¯s a video game so, no. Without much of an effort, she entered her trance and rested. ¡­¡­¡­¡­¡­¡­ 3 hours flew by instantly, and her condition was back to full! HP restored! Opening her eyes, she was happy to see her HP back to normal, along with her MP and SP. That¡¯s good! Alright, time to move! Standing up, she quickly ran up towards her leather backpack and wore it on her back. Running down the hill, she made her way towards the sleeping Slimey. From her connection, this guy seems to be fine, but that light had sapped it of its energy, so it¡¯s now sleeping.If you stumble upon this tale on Amazon, it''s taken without the author''s consent. Report it. ¡°Thanks.¡± Looking at the green blob, she silently thanked the slime and placed it into her backpack. If it wasn¡¯t for this guy, she would¡¯ve most likely died, and that wouldn¡¯t be pleasant, despite her occasional thoughts to take her own life to maybe return to reality. ¡°Well¡­Where to¡­?¡± But now that that¡¯s done, where to now?! Everywhere she looked, all she could see was the same damn scenery! Who was the creator of this world?! Did they use procedural-generation for this?! At least have some trees or something!! Anyways, with the loss of the gem, the power she felt from it dropped severely, but it still felt powerful to her. Her skin trembled as it felt the power the staff could unleash. Would this staff unlock her true potential?! Was this her fabled legendary weapon?! Maybe¡­But that¡¯s for later. For now, she should try and search for a village. She wouldn¡¯t do so well all alone here, especially now that no trees could act as her cover against the deadly creatures of the night. She shivered as she pictured more of that skeletal mages, surrounding her from every direction. Just one brought that much trouble, then how about 2, or 3, or 5? She would be dead in a matter of nanoseconds! She didn¡¯t even know what a nanosecond even is! And so, with her eyes vigilantly watching her surroundings, she made her way through the silent plains. The grass waved as the cold wind passed by, her long black hair flowing in the wind. Her soft steps echoed through the air. Occasionally, she would climb a small hill, and look out towards the distance, hoping to see a small village, or a road even. Sadly, she couldn¡¯t install any mods to add a map, so she¡¯s pretty much screwed! And before she knew it, night came. Not wanting to deal with more monsters beyond her league, she sat down and meditated once more. Again, she tried to grasp her mana and direct it elsewhere, but her mana refused, simply flowing past her will. Without much success that night, she snapped out of her trance and lied down. Closing her eyes, she rested her head atop the grass, and fell asleep. The next day, she woke up to her grumbling stomach, empty from the necessary nutrients it needed to process. She frowned and tapped her belly, knowing that she wasn¡¯t going to find any food for some time. Wearing her backpack behind her, she picked up her staff and continued walking. Slimey was still asleep, which worried her, but she could still feel its life, even if her worries hadn¡¯t been dispelled in the slightest. Her stomach growled once more. She was beginning to feel dizzy. 5 more minutes went by, and her muscles started growing weak. Her lips and tongue were dry of their needed moisture, and her energy was depleting. 10 minutes, and she finally collapsed, but her consciousness held on. Her will didn¡¯t easily back down, as she continued to crawl along the ground. She tried using the staff as a support stick, but her lack of energy simply caused her to fall down once more. 15 minutes, and still nothing. Most of her energy had been drained, her fingers not able to hold her staff. Abandoning the staff for a moment, she looked up, to see an angel floating above her. She smiled weakly, as she watched the angel flicker in and out. She was beginning to hallucinate. But then, just a meter away from her, she saw it. The one thing, that would grant her salvation from her starving stomach. Something, that could wash all these problems away. Before her, she saw a berry bush! Her mind knew that it was probably a bad idea. She had seen enough movies and video games to say that eating random berries from a random bush would probably kill you! Especially ¡®Unturned¡¯. Seriously, all the berries there are deadly! But her starving mind caused her reason to cloud. With a renewed vigour, she crawled her way towards the berry bush. Every crawl she did left her with less and less energy to work on. But it was enough, as she plucked a single red berry from the bush. She stared at it with wonder, the red skin glowing red from her touch. She smiled weakly and ate the berry, tasting the sweet, sour, yet also bitter taste of the berry. Swallowing the berry, she took another one, and another one, and another one, until finally, no berries were left behind. But that no matter, her hunger¡¯s gone!! ¡°Hahahahahaha!! I¡¯m freeee~!¡± She stood up and laughed. She wobbled unsteadily, but her smiled never faded. Slowly, and unsteadily, she walked back to where her staff was, and dropped her backpack. She squirmed in delight and laid down, her hands tightly holding onto her hips. ¡°Mmm~¡± A wave of feelings coursed within her. She bit her lip and moaned, feeling a sudden spike in pleasure. It seems like the berry was an aphrodisiac¡­ ¡°A-Ah~¡± Her body shivered as more and more sensations overtook her mind. Her hands seemed to move on their own, removing the white shirt she was wearing. Her cheeks turned pink as her instincts took over, her hands playing with her own body. And that was how it went for 5 minutes or so. She squirmed and moaned, her hands aggressively playing with her own body, her body blasted with pleasure. And before she knew it, the effects ran out, and she was left lying atop the grass, panting from the play she had with herself. ¡°Mmm¡­¡± Not bothering to cover her exposed chest, she slowly closed her eyes and enjoyed the feeling of the wind brushing against her naked skin. The aphrodisiac finally washed away, finally allowing her mind to think rationally, somewhat. ¡°Well¡­that was¡­nice.¡± Her face flushed, she stood up and put her shirt back on. On one hand, she couldn¡¯t believe she actually did that to herself. While on the other, she was slightly disappointed at how fast that passed. But let¡¯s continue, okay? Let¡¯s leave that behind for now. With her backpack on her back, and her staff in hand, she walked on, her face still flushed as she recalled just how good that felt. That play had left her wanting more, but those berries she ate seemed quite rare, so that would have to wait for later. That, and she can¡¯t just be enjoying herself in the middle of a battle, okay? ¡°That¡¯s¡­¡± But, for the first time since a while, another monster had shown itself, or what looked to be a monster at least. Several meters away from her, she could see what looked to be a mushroom, walking on two little stubby legs. Its body was mostly white, with the large cap it had being blue in colour. Two tiny little arms extended out from its body. She could guess that this was the thing that would give some type of debuff to her. You know, like those annoying monsters that are just there to weaken you? Yeah, those things! It¡¯s like a Pok¨¦mon specially designed and created to have status attacks! So, she had to be careful. Putting her staff and her backpack down, she pulled out her knife and slowly made her way towards the shroom. Her [Assassination] skill clearly came in handy here, as she easily made her way up to the shroom without any notice. With her knife in the air, she brought the knife down and stabbed it into the shroom¡¯s head! Pulling the knife out, a burst of purple gas exploded out. As quickly as she could, she covered her mouth and jumped away, but she still inhaled some of the purple gas. She safely made it back to her items and watched as a message popped up. [Enemy has been slain. Gained 19 Experience] But she could hardly focus, as she started to giggle. She collapsed onto the dirt and rolled around, giggling and laughing as the gas took effect. Tears escaped her eyes as she tried to stop laughing, only to giggle. This day doesn¡¯t seem to be on her side¡­ And so, after about 10 minutes of laughing and rolling around the ground like a little kid, she finally stood up and sighed. She still giggled occasionally, but the effect was mostly gone, mostly. ¡°D-Damn it¡­pfft¡­s-stop¡­aha¡­pfft¡­¡± Even as she tried to meditate and enter her trance, the ticklish feeling would instantly snap her out of it. Over all, it wasn¡¯t very pleasant, or was pleasant, depending on how you saw it! Another 10 minutes passed, and finally, the effect was gone! My goodness. She had just come out from the aphrodisiac, and now this?! Could she get some time to relax? Please? Anyways, she did just kill a monster, so let¡¯s look at her stats! Name: Diana Race: Human Age: 17 Class: Peasant Lv: 2/5 | Exp: 46/75 HP: 14/14 MP: 13/14 SP: 10/14 [Strength]: 4 [Tenacity]: 3 [Agility]: 4 [Intelligence]: 3 [Dexterity]: 5 [Mentality]: 4 [Endurance]: 4 [Wisdom]: 4 [Longevity]: 2 [Skill Points]: 5 {Skills}: [Slime Valley: Lv 2/10], [Knife Mastery Lv 2/10], [Slime Magic Lv 2/10], [Assassination Lv 1/10], [Alleviation Lv 1/5] {Magic}: - {Titles}: [Slime Queen] As you can see, not much had changed, besides her Exp count that is. Just 29 more points to go, and level 3 baby! Just 2, or 3 monsters left until that sweet level up! ¡°Okay¡­pfft¡­¡± Picking her items back up, she continued her walk, walking past the dead corpse of the mushroom. She questioned if there was anything of value inside, but the rotting smell it had quickly dispelled any questions. Walking and hiking past another small hill, she decided to take a small break and sat down. Leaning her back against her backpack, she closed her eyes and entered her trance. The feelings of the physical world quickly faded away. Once more, she tried to grasp and direct her mana. The flowing river of her magic shook from her will, but still remained stubborn and kept flowing through without her control. She kept herself focused, her mana continuing to reject her will. But alas, her focus slipped and the mana stopped responding. Sighing to herself, she snapped herself out and opened her eyes. Doesn¡¯t seem like she¡¯ll be able to do it for a while. And so, standing up, she picked up her staff and walked on, her eyes still not drained from the energy despite her many failures. This was a normal thing for her, as she was too, was once a noob. She knew how hard it was to get a good grip on a game, and how hard it was to maintain that level of skill. So she knew not to give up, as it wouldn¡¯t be over until you give up. And it shouldn¡¯t be, as she looked on in happiness, as standing up atop a small hill, she saw the first signs of human civilisation! A village! And of course, she was heading there next! What kind of person would miss out a chance like this to heal? Not her! Time to find a church and save her progress! [8] Level Ups Everywhere! Yay~! Some distance away from the village, Diana sat down with her legs crossed, her eyes staring blankly as she contemplated her life choices. A single tear formed in her eyes and streamed down her cheeks, smiling wryly towards the sky. Previously, she decided to head to the village, and she did! But instantly, she noticed the one big flaw in her plan. One very, very, big flaw. She couldn¡¯t understand anyone!! Seriously, what were they speaking about?! German?! Moon runes?! Kappa language?! How the hell was she supposed to understand any of this?! She isn¡¯t some insane hero with an all-language translation skill!! Lucky bastards¡­ The one way left to understand was¡­*Gasp*¡­To Learn. Dun, dun, duuuunnn!!! She had to learn the language. The daunting wall before her made her feel even smaller than she already is. She wasn¡¯t even good in English, how was she supposed to learn another language entirely¡­? But! There might still be someone who could grant her a translation skill¡­right? Right?! Faeries do exist in this world, right?! They should have that sort of skill, right?! Who was she kidding, she¡¯s just a holed up NEET trying to survive in a fantasy land without any special magic skill or stat that would boost her up beyond her peers. She was just some useless girl in the middle of a deadly wasteland! If she was in the Walking Dead, she would be first to die, definitely. *Grruuu* And now she¡¯s hungry again?! Didn¡¯t she just eat those berries a couple hours ago?! How was she going to get any food now?! She didn¡¯t have any money to buy food! Heck, she can¡¯t even speak the damn language! But! But. She still had hope. Hope, for the future! She didn¡¯t like to learn? Fine! Save it for later! She didn¡¯t have any money? Then just make some! She was hungry? Then just go kill something and cook it! The sun was already pretty high up in the sky. If she didn¡¯t act now, she would probably starve and get eaten by a goblin or something! Time to move! Standing up, she picked up her backpack and her knives, and walked past the small village. She wasn¡¯t going to enter any human civilisations any time soon if she couldn¡¯t even speak the damn language! *Grruuu* An hour swiftly passed by, and nothing. No apple trees, no libido increasing berries, nothing. Not even a small insect she had encountered! Nothing she says, nothing! And her stomach was getting hungrier as time passed by, growling louder and louder. Two hours passed since her leaving, and still nothing. No signs of life existed around her, besides the grass she was stepping over. Could she eat the grass perhaps? Would they taste good? No! No, snap out of it! She¡¯s not a cow! Four hours, and something actually happened! She tripped and fell down! That¡¯s it. She later stood up, cried for a bit, shouted out to the world about her misfortune, and continued on. Her hunger growing as she walked on. Six hours, and finally, finally, she actually saw something! A wild boar sleeping under the shade of a tree! Yes! Source of needed calories detected! Time to hunt for fooooddd!!!!! Silently dropping her leather backpack, she took out her trusty silver knife and slowly inched towards the sleeping boar, its loud snores escaped into the air. Her eyes shined red as she eyed her prey, her drool almost escaping from her lips. Licking her lips, she raised the knife, and stabbed it into the boar¡¯s head! *Puchi!* [Enemy has been slain. Gained 13 Experience] ¡°Food~¡± After so long, she finally found some food. Did she know how to cook? No! Why would a NEET like her worry about learning how to cook? But did she care? Nope! She quickly ran back to her backpack and dragged it closer to her killed prey. Resting the backpack against the tree, she began her preparations! Using her knife, she chipped off three pieces of wood. She plucked off the leaves she could reach, and placed all she gathered next to the boar. Placing one of the pieces on the ground, she held another in her hand, placed it above the piece, and spun! Spin it! SPPIIIINN!!! Let it rip!! Using as much power and speed she had ever used in her life, she spun the piece of wood against the other. Her arms were beginning to hurt, but who cares! This was for her food! Keep on spinning!!! And after about 10 minutes of constant Beyblade tier spinnage, a spark lit off, and a small flame rose from the wood!! Finally!! Immediately, she picked up the leaves she gathered and laid it atop the flame, blowing air to keep the flame growing. And so, a flame was lit! Hell Yeeaaaahhh!!! Was this how those cavemen felt when they discovered fire? It felt amazing! But she was hungry, and she couldn¡¯t waste any more time or she would shrivel up from the hunger and die. And she didn¡¯t want that. Using her knife, she sliced off a piece of the boar¡¯s meat and poked the last remaining piece of wood through. With her spare hand, she hanged the meat above the fire, and waited. Wait, what does the meat look fully cooked? She didn¡¯t know when to stop! How much time did she need to do this?! She didn¡¯t want to end up with burnt meat! That would suck! So, she hanged the meat above the fire and slowly spun the meat around, making sure every nook of this damn meat was cooked. It might taste like sh*t, but it¡¯ll do! Her stomach needed something!! After about 10 minutes of constant muscle pain, she brought the meat away from the fire, and took a taste. Just like she guessed, it tasted like sh*t, but still slightly better than sh*t. Hey, she¡¯s a newbie, alright? But to her surprise, a shocking message appeared as she took another bite. [[Cooking] has been acquired. 1 Skill Point gained] The food in her mouth almost fell as she stared at the message, her mouth dangling wide open as she eyed the message in absolute shock. She gained a skill like that, from doing this? Seriously?! Cooking was way harder than that! What kind of cooking tastes like this piece of sh*t?! Why is she even getting angry at this?! She should be happy! Sighing, she ate the last piece of meat on the stick and lied down. Her eyes stared at the night sky above, the two giant moons, one blue and one white, floated up within the far reaches of space, granted if there was even space in this world. The stars sparkled around the light of the twin moons. Smiling softly, she closed her eyes, and fell asleep around the dancing flame. ¡­¡­¡­¡­. Hours passed by, and she awoke to a horrible smell to her right. Rubbing her eyes, she stared at the dead corpse of the boar, now clearly rotten as the blood inside dried. If the meat tasted like sh*t yesterday, the smell today definitely smelled like it.Taken from Royal Road, this narrative should be reported if found on Amazon. Pinching her nose, she picked up her items and walked away, leaving the boar behind to decompose. That was a good loss of food there, but she could just spend several more hours writhing in pain as she tried to find more food so¡­yeah. And so, she walked across the plains, the silence surrounded her. She felt quite lonely actually, even after her many years spent holed up in her garbage bin not really communicating with anyone. But she did have online friends, so that¡¯s cheating. Her mind flew over to her newly gained familiar, Slimey. Over these past days, it hadn¡¯t even woken up for even a second. It was fine, she could tell, but it wouldn¡¯t wake up. A morbid possibility flashed in her mind, but she ignored such thoughts and continued walking. The journey was peaceful, too peaceful in fact. It creeped her out just how silent this whole area was. Shouldn¡¯t there be more monsters waiting around? Where did they all go to? Quickly, she grew bored, and started playing with her staff. She would play against herself to see just how long she could maintain the slime, or how far she could move the slime. While it was just for staving off her growing boredom, she did learn that her maximum radius of control was around 1 metre around her. Of course, she quickly grew bored of that too, and put her staff back into her backpack, the staff clearly too long to fit within. Pulling out her magic tome, she decided to give it another read, to try and perhaps understand what magic this was. Of course, just like everything in this world, it was in another language!! She couldn¡¯t read anything! But there were pictures, and quite detailed ones too, so her complains were quickly dismissed. And that was how it went for several more days, spent reading her tome, practicing her magic, or trying to once more control her mana. Once the sun begins to set, she would quickly run around to search for any food sources. Sometimes she would get lucky, sometimes, not so much. But! Once again! These several days were not spent in mere boredom! Her stats had gone up once again! Take a look! Name: Diana Race: Human Age: 17 Class: Peasant Lv: 3/5 | Exp: 51/100 HP: 16/16 MP: 11/16 SP: 07/16 [Strength]: 5 [Tenacity]: 4 [Agility]: 5 [Intelligence]: 4 [Dexterity]: 6 [Mentality]: 5 [Endurance]: 5 [Wisdom]: 5 [Longevity]: 2 [Skill Points]: 6 {Skills}: [Slime Valley: Lv 2/10], [Knife Mastery Lv 2/10], [Slime Magic Lv 2/10], [Assassination Lv 2/10], [Alleviation Lv 1/5], [Cooking Lv 2/10] {Magic}: - {Titles}: [Slime Queen] As you can very much see, her Level rose again! She¡¯s a level 3 now! Her [Assassination], and her newly acquired [Cooking] skill had risen to level 2 as well! As for [Assassination], her steps seemed to grow even quieter, and her damage increase had risen. For [Cooking], her general skill in cooking and handling the food seemed to have increased. Over all, these days were spent well! And this night, something interesting will finally occur! Something she had been looking up to since the first time she learned magic! Sitting with her legs crossed, she closed her eyes and entered her trance. Just like she always would, she reached out towards her mana and tried to direct it elsewhere. Her mana jolted violently, trying to reject the will of its owner. Tiny spikes of pain shot through her body, but her focus remained unbroken. Until, finally, [[Internal Mana Manipulation] has been acquired. 5 Skill Points gained] ¡°F*ck yeeaahhh!!!¡± She jumped up and shouted happily, only to crash back down. She groaned as she held her aching knee for a moment, before jumping back up and crying out, both in happiness and in pain. Her knee still hurts alright?! Never in her life had she been so happy to see a message pop up. Sure, it might be a skill and she might be a NEET, but she had never reacted this way before¡­Not that she cared!! This is f*cking awesome man! Look at it! After sooo long!! Well, more like a couple weeks or so, but I digress. [Internal Mana Manipulation] Lv 1/10 You are now able to consciously control the flow of your own mana. Well, that description was short, but who cares?! This was what she had been looking forward to for so long! And it¡¯s finally here! Besides the obvious addition of being able to control her own mana, she was now able to clearly feel her own flowing mana. Before this, she had only been able to feel her mana when she was in that trance, so this was great! Ah! But onto the next problem, magic! Would she be able to control and use her magic without the aid of her staff now? Yes, yes actually. And quite easily too. All she did was recall what it felt like when she held the staff, pictured it in her mind, and let her mana do the rest. Obviously, the control and the size of the slime ball she made was reduced, but still reliable nonetheless. And with her staff, it just became even better! Things were looking up! And with a wide smile, she closed her eyes and slept under the blanket of stars. ¡­¡­¡­¡­¡­¡­¡­¡­ The next morning came, and Diana awoke. Rubbing her eyes, she yawned cutely and looked around, the scenery around her staying as peaceful as it had been. The large golden sun above shined upon the beautiful world under. Rising up, she stretched her arms and yawned once more. The day before had left her quite exhausted, especially after all the shouting and crying she did over her newly gained [Internal Mana Manipulation] skill, and she still wanted to brag about it today. Today, she decided to chill for a bit. Over the last week or so, she had been walking, constantly, through this empty grassy plain. The lack of monsters still creeped her, but after a while, she got somewhat used to the silence. Taking out the magic tome she ¡®Traded¡¯ with that goblin merchant, she sat down and opened the book. Now that she had [Internal Mana Manipulation], she could finally try and learn this magic spell! From what he saw from the pictures, the steps seemed to be easy enough. First, concentrate your mana on a single point, then use it to form this bubble thingy, and then maintain it. It was quite similar to her [Slime Magic], but she learned that by ¡®Accident¡¯, so yeah. Following what the pictures illustrated, she directed her mana towards her right index finger. Next, she tried forming it into a bubble¡­And how do you do that exactly?! How does this even work?! How can mana just turn into a bubble?! So, by the end of her training session, she was left with as much knowledge as when she started. It didn¡¯t seem like learning this magic would be an easy task, so let¡¯s leave that for later. Packing the book back into her backpack, she wore the bag on her back and picked her staff up. Facing towards the rising sun, she smiled confidently and walked on. An hour quickly flew by, and Diana was suffering a severe case of utter boredom. It would get seriously dangerous if it wasn¡¯t treated, so her mind flew elsewhere as she took out her staff. Holding the staff in both hands, she activated [Slime Magic] once more, a slime ball, roughly the size of a basketball, formed above the staff. She didn¡¯t know why, but having the skill [Internal Mana manipulation] increased the control and the power she had over her magic. Was it simple because she could willingly insert mana into her staff, or because of something else? Either ways, it was great! And amidst her play, her [Slime Magic] levelled up once again! [Congratulations! [Slime Magic] is now Level 3!] Her control over her slime increased once again, and the size she could create increased as well, but something else took her attention. [Slime Magic] Lv 3/10 Allows you to create and manipulate slime in expense of MP The nature of the slime you create is neutral Allows you to control the density of the created slimes A new line had been added!! Hell yeah! Skills are levelling up left, right, and centre! That aside, this new level up now allowed her to control the density of the slimes¡­eh? What does that mean? What does density have to do with anything? Experimentation time! ¡°Hup.¡± This time, she created another slime ball with ¡®extra¡¯ density. Woah, the slime feels¡­heavier? What? And why is it so sticky suddenly? Her slime was more like a jelly, not glue. Whatever the case¡­this was awesome!! She could just picture the new tactics she could pull off in the middle of a battle, screaming the names of her attacks like they would in an anime. Real talk though, why do they need to do that? And so, with a bright smile, she walked on, the skies above painted a clear blue. The fluffy white clouds above floated along. The grass softly danced as the wind passed by, the cold wind brushing against her skin. She slowly closed her eyes and hummed, enjoying the cold breeze that passed her by. Her long black hair flowed slowly in the wind. The soft howls of the wind echoed in her ears. A soft purr escaped her lips as another breeze brushed by. Time slowly passed by, the scenery around her staying ever unchanging. The soft flowing grass under her brushed against her skin as she lied down, the sun above staring back at her. The warmth of the sunlight shone above her. After about 3 hours of constant walking, someone was bound to get tired. So, lying her head atop the grassy bed, she slowly closed her eyes, and fell asleep once more. ¡­¡­¡­¡­¡­ Waking up, she stood up and yawned, stretching her arms into the air. Her loose shirt softly waved in the passing wind. Looking up, she stared at the sun, now beginning to set. The blue sky above slowly changing. Packing her things up, she faced away from the setting sun and walked on, staying on the same path she had walked through the hopefully find something of interest. She wasn¡¯t counting on it though. Have you seen this plain?! But to her pleasant surprise, before her, she could see a large circle of flowers, with a large white flower blooming in the centre. The mix of colours blended together under the setting sun. A soft smell of honey seemed to linger in the air, the sweet taste of the honey luring her to enter the circle, and it seemed to work wonderfully. She stepped into the circle of flowers, casually walking towards the large white flower in the centre. As she walked closer, the pollen in the air seemed to multiply, causing her to sneeze several times. The pollen danced within the air. And then, a figure emerged from within the white flower, her long green hair flowed. Her eyes sparkled, her mind entranced by the beauty that had just emerged. The figure looked at her and smiled, slowly closing in on her, until finally, Their lips met. [9] F*ck Bubbles The dryad¡¯s smile had captured her, as she pulled in for a passionate kiss. Her lips stolen, she merely let go and enjoyed, the soft feeling of her lips touching against hers. Slowly, the separated, a silver bridge hanging between their lips. Diana looked at the woman, her beautiful green hair flowed. Her body naked, bare against the cold breeze of the setting sun. Her warm orange eyes stared back at her. [The title [Friend of The Dryad] has been acquired. 5 Skill Point gained] The screen flashed in her eyes, but she failed to notice it, her eyes still locked in a daze. Her body didn¡¯t move a single inch, as the dryad pulled her in for another kiss. She slowly closed her eyes, her consciousness slowly fading away. ¡­¡­¡­¡­ ¡°Ngh¡­?¡± Rubbing her eyes, Diana slowly opened her eyes, the sky above now dark, the twin moons and the stars shining upon her. The moonlight lit upon this earth below. She groaned softly and got up, not realising that she was completely naked. ¡°Awake now?¡± ¡°Hmm¡­? Yeah.¡± Looking behind her, she saw the dryad looking back. Her skin, slightly green, glowed under the moonlight. She sat by her large white flower, the pollen it¡­Wait a minute, did she just speak English?! ¡°Y-You know English?!¡± ¡°Just noticed?¡± Diana recoiled in shock and fell onto her butt, her mind thrown in complete shock from this sudden revelation. But it lasted for short, as she began to cry, both in happiness and shock. She actually met someone else she could talk to! The dryad didn¡¯t understand why she was crying, but leaned closer and hugged her, pulling her in once more for another kiss. Her eyes shot open from the sudden notion, but she didn¡¯t do anything. She didn¡¯t know Yuri felt this good¡­ ¡°All better?¡± ¡°Y-Yeah¡­¡± She wiped away the rest of her tears and smiled, somehow knowing that she didn¡¯t mean any harm to her. Not all NPC¡¯s were evil alright? The dryad soon explained that the title she recently gained allowed them to understand each other, putting aside the language barrier they had between each other. Diana asked if she could do this to anyone, and she simply answered with a quick ¡®Nope¡¯. Oh, and in the middle of their conversation, she also realised that she was standing naked. Blushing, she quickly asked for her clothes and put them back on. Being naked all the time wasn¡¯t her forte, despite the fact that being a slime girl made her naked, but I digress once more! Actually, let¡¯s check her status for a moment. Name: Diana Race: Human Age: 17 Class: Peasant Lv: 3/5 | Exp: 51/100 HP: 16/16 MP: 16/16 SP: 16/16 [Strength]: 5 [Tenacity]: 4 [Agility]: 5 [Intelligence]: 4 [Dexterity]: 6 [Mentality]: 5 [Endurance]: 5 [Wisdom]: 6 [Longevity]: 3 [Skill Points]: 16 {Skills}: [Slime Valley: Lv 2/10], [Knife Mastery Lv 2/10], [Slime Magic Lv 2/10], [Assassination Lv 2/10], [Alleviation Lv 1/5], [Cooking Lv 2/10], [Internal Mana Manipulation Lv 1/10] {Magic}: - {Titles}: [Slime Queen], [Friend of The Dryad] [Friend of The Dryad] A title granted to those whom the dryad trusts. +1 attributes to [Wisdom] and [Longevity] That¡¯s interesting¡­Her [Longevity] went up! From what the description says, [Longevity] is pretty much her life span. The more [Longevity] she had, the longer she would live, maybe? She didn¡¯t know, but an increase was nice nonetheless. In simple terms, another title, more bonuses! Yay~! More power to grant her more time to try and live in this damn world crawling with slimes and mushrooms! Why does this remind him of Dragon Quest? But¡­she¡¯s still very sleepy. Her eye lids still felt very heavy, and despite her full SP, her energy wasn¡¯t doing too well either. ¡°Do you want to sleep?¡± She found herself nodding. The dryad simply smiled and pulled her closer, laying her head above her lap. She smiled in a daze before falling asleep once more. ¡­¡­¡­¡­¡­ Morning came, and Diana had already gotten up. Sitting down on the flowers, Diana held out the tome she ¡®Traded¡¯ with that goblin towards the dryad. The dryad read the book for a moment, before she smiled awkwardly and gave it back. ¡°Do you want to learn this?¡± ¡°Un.¡± The dryad smiled wryly at her answer. She didn¡¯t really want to teach this, nor did she understand why she would want to learn it in the first place, but the serious expression she had, which did not suit her in the slightest, would make her feel quite bad to decline. ¡°Well¡­What part do you not understand?¡± ¡°This part. How do you even make the bubble?¡± The dryad explained that she needed to first focus her mana into one point in her body, which she did already knew. After that, when she expelled out some of her mana, quickly mould the mana into the bubble. The concept was similar to her [Slime Magic], if not the same, but she explained that she needed to keep the walls thin, or the bubble would fail. And so, began her training! She could easily focus her mana into one point, that being her right index finger, but the moulding part was where she got stuck. Every time, she would create a wall too thick, or a wall too thin. Finding the balance between them was hard as f*ck!Unauthorized duplication: this tale has been taken without consent. Report sightings. 2 hours passed, and she had some progress on it, but she still failed to truly accomplish what she came for. She was able to form what looked like a bubble, but it would pop as soon as it started to float. Diana was annoyed, but stayed undeterred! The dryad on the other hand, was amazed at just how dedicated she was trying to learn this interesting magic. 4 hours, and finally! She succeeded! [[Bubble Magic] has been acquired. 1 Skill Point gained] She would¡¯ve been super happy at this, if not for the description. [Bubble Magic] Lv 1/10 Allows you to form bubbles. ¡­¡­That¡¯s it. That¡¯s all it had to day. Seriously?! Just bubbles?! She spent many days hyping this thing up, and this is the result?! This is just like No Man¡¯s Sky all over again!! But, let¡¯s not get angry just yet. There might be something hidden in this magic! You know, like when a description doesn¡¯t fully tell you about the skill and stuff? ¡­¡­Nope. That¡¯s it. She could form a bubble, change the shape a bit, and then move it around. No attack power, no defensive capabilities, no magic specialties, nothing. Just, bubbles. Would be great for a party, but not for battle. ¡°Diana?¡± No! There might still be something hidden in the later levels! Yeah! That must be it! That can¡¯t be the only thing it could do! There must be something else to this skill! ¡°Umm¡­Diana?¡± The dryad¡¯s calls came unheard as Diana¡¯s energy returned once more. Her spirit danced as her heart lit a passionate flame. There was nothing useless in this world! Even the crappiest characters in the video game still had a use! Picking up her staff, she began to train her [Bubble Magic] to the fullest. She created multiple bubbles, moved them around in unison, or separately, and changed their shapes mid-flight. She even created a useless wall of bubbles and slammed it against the flowers, popping all at once they met with the petals. [Congratulations! [Bubble Magic] is now Level 2] Not enough! This wasn¡¯t enough! Her control has increased, but nothing major has changed! She must continue traaaaiinniiiinggg!!!!!!!! ¡­Or not. ¡°Hah¡­hah¡­¡± Her MP was completely exhausted. Not even a single drop was left behind as they all ascended into the air. The dryad looked at her in utter disbelief, no believing that she actually spent her MP to do something as stupidly insane as that. But Diana was not done! Sitting down with her legs crossed, she entered her trance and rested. Hours flew by, and Diana was back up, her MP back to full. Picking up her staff, she created her bubbles once more and began training once again. The dryad yawned as she fell asleep in her white flower. Diana seemed to be stuck in her own world, so she didn¡¯t really have anything to do, so why not sleep? With that thought, she climbed onto her white flower and slept. Hours after hours flew by as Diana continued to meditate and train, the scenery around her covered in a uselessly terrific amount of bubbles. The sun slowly set into the horizon, as the twin moons rose up, but she didn¡¯t even take a moment to notice. The moon set, and the sun rose once more. Snapping out from her trance, she ignored the new day, and her growling stomach, and continued training. Her skill kept rising, her power over the magic rising ever more as she fought against her weakening body. By the end of the fifth day, Diana was left completely exhausted, both physically and mentally. She collapsed onto the flowers, her face planted into the ground. Her staff laid beside her, seemingly also tired from the constant use. But it was well worth! Just look at this! [Congratulations! [Bubble Magic] is now Level 4] Level 4 man! Just look at that! That¡¯s amazing! Caesar would be so proud right now. Now, the moment of truth! [Bubble Magic] Lv 4/10 Allows you to form bubbles. You can control various aspects; Size, speed, and shape. ¡°¡­¡­¡­¡­¡± ¡­¡­You know what? She¡¯s done for now. She. Is. Just. Going. To. Sleep. Now. For some reason her life seems to feel worthless now. Reading the new ¡®Improved¡¯ description, her heart fell into the ocean, crashed into the wreck of Titanic, got eaten by a fish, said fish got eaten by a shark, and the shark swam away happily, knowing that it had eaten the spirit of a young female NEET. ¡­What kind of metaphor is that?! F*ck this sh*t! She is going to cry herself to sleep now¡­ ¡­¡­¡­¡­¡­ The next morning came by, and the sun was back. The blue sky floated above, a sea of clouds soared within the sky. The winds softly passed by, as Diana slowly awoke from her sleep, her eyes still red from the tears she cried out the day before. She stayed unmoving for a while, before she broke down and cried again, still not over the insane waste of time that damn skill was. Even the clouds felt her sadness, as a light drizzle came down from the clouds. The drizzle soon grew into a rain. The drops of water landed on her cheeks, her eyes weakly looking up towards the cloudy sky above. Not bothering to speak or shout anymore, she simply laid her head back down. Even the dryad didn¡¯t know what to do but feel sad for her! She carried a basket of berries, but she wasn¡¯t sure if she would even accept the food. Que the sad music. *Imagine sad music playing in the background* Alright, sad time is over, as she shot up from the ground and shouted many different curses she had learned from her years of being a holed up NEET towards this damned world. Her anger boiled over, aimed at the world, but mostly at herself for deciding to learn this useless piece of sh*t in the first place! ¡°D-Diana¡­¡± The dryad¡¯s worry was unheard as she continued to shout and curse towards the sky above, some words about her past life mixed in as well just for good measure. The dryad of course did not understand anything she said, nor did she understand the source of her anger, or sadness, or both. After about 15 minutes of constant shouting and straining her vocal chords, she finally sat down and hugged her knees. She didn¡¯t feel like living right now, so she¡¯ll just curl up into a ball for a while and contemplate over her life choices for a moment. Yep, leave her alone please. The rain continued to pour down, the grassy fields and the flowers were drenched in the rain, the world turned dark from the dark clouds above. The wind died down, as the world was left in a standstill. ¡­¡­¡­¡­ Okay, crying is over, and back to training! There needs to be something to distract her from this damn feeling!! Don¡¯t laugh! Don¡¯t joke! Serious time! This is reality, not her garbage dump of a room! She could die anytime here! F*ck the bubbles, she¡¯s going back to her roots! Standing up, she took up her staff. Holding it with both her hands, she took a deep breath, and formed a small slime ball above her staff. The green blob floated and wobbled slightly, the drops of water mixing together with the slime, gaining a bit of extra weight. She didn¡¯t know what she really wanted to do with it though¡­Seriously, what should she do? Just make it fly around her? What would that do? Oh well, why not? Increasing the density of the slime, she focused a bit more mana and moved the slime ball around her, the slime ball almost losing shape from the speed she made it travel. More and more water soaked into the slime, making it heavier and heavier, until finally, she lost control, and the slime ball went flying out into the distance, quickly followed by an explosion of dust. ¡­Huh? Wait a minute¡­That was almost like a Rasengan! But thrown! Isn¡¯t that even better?! Alright, let¡¯s try it again! She repeated the same steps, forming the slime ball, increasing the density, making it fly around her as more and more water soaked in, and bam! The slime shot out towards the ground, an explosion resounding upon impact! [Tier 1 Spell [Slime Cannon] has been acquired. 2 Skill Point gained] Oh. My. God. That¡­That actually counted as a spell? R-Really?! That¡¯s amazing! F*ck that [Bubble Magic] sh*t, this is the jam! Hell to the yeah! Alright, let¡¯s try this again! ¡­Maybe not. Only realising it now, her MP count had dropped to 2, which meant that those two attacks costed her 14 MP, which was 7 MP every [Slime Cannon]. Damn, that¡¯s expensive. Wait, did she just to internal maths?! She wasn¡¯t even that good at math! Anyways, that meant that she only had two shots of this magic, not that she cared all that much. One attack caused that much damage, then how about 2?! The damage dealt would be insane! She would get a flawless bonus! With a renewed smile, she looked up towards the sky, watching as the rain clouds slowly began to depart, the golden rays of the sun shining through towards the world below. [10] Shes A Peasant No More!! ¡°My heeeaaad!!!¡± Diana cried out as she clutched her head in pain, throwing away the small note book in her hand. Her head felt like it would explode right now!! She didn¡¯t even know she could feel this much mental pain from reading a book! ¡°A-Are you okay?¡± The dryad tried asking Diana, but it seems her question was immediately dismissed. Diana groaned softly and punched her head several times, hoping the pain would go away. And of course not, as her HP actually decreased. After the rain finally broke away, Diana asked the dryad to teach her this world¡¯s language. The dryad raised an eyebrow at her, but decided not to question it. Brining out her small notebook, she began teaching the barebones of this world¡¯s language. 2 hours later, this was the result. Diana was left knowing not much more about the language, and a whole lot of pain as her cranium tried to digest the insane knowledge burst it received, much to her dismay. Alright! Enough learning!! Her head couldn¡¯t take anymore!! Give her something to do!! Give her gaming consoles back damnniitttt!!! But alas, that was impossible. The warmth of her gaming room was too far to reach. May it forever rest in peace, knowing that it would probably get bulldozed sooner or later. ¡°Hah¡­hah¡­¡± ¡°D-Diana? Hello?¡± Diana slowly brought her hands away from her head, careful to try and not inflict any more pain into her soft little brain. Setting her hands down on the flowers, she sighed softly and looked up, her eyes burning as bright as the sun. ¡°I¡¯M FIIINNEEE!!!!¡± With a vigorous shout, Diana shot up, her hands raised up as far as she could pull off. The dryad looked at her for a moment, somewhat lost in thought, before giggling softly. Smiling at the re-energized Diana, she stood up and fed her the berry she had been wanting to give her since, well, who knows. ¡°First, eat.¡± She almost moaned as she felt the sweetness melt in her mouth. She instantly recognised these berries as those libido increasing berries, but why wasn¡¯t she going insane yet? Did the dryad tamper with them slightly? Why is she feeling slightly disappointed? ¡°Mm~, Thanks.¡± ¡°No problem.¡± The dryad giggled softly and offered her another one, and she immediately accepted. The same sweet and warm feeling entered her once more. This time, she did moan, but the dryad seemed fine with it. Ooh, she might go insane if she ate another one¡­Let¡¯s rest for now. Puffing out some air, she sighed and sat back down, the pain from trying to learn that language had mostly faded away. She blushed as she looked up to the naked dryad, the effects of the berries somehow making her embarrassed. ¡°D-Do you wear clothes?¡± ¡°Hmm? Do you not like my body?¡± ¡°N-No! I-I enjoy looki-, I mean, don¡¯t you feel cold?¡± The dryad shook her head and smiled, eating one of the berries from the basket she was carrying. The dryad seemed largely unaffected by the berry, her expression staying very much the same. Was she resistant to it by any chance? Was that why she didn¡¯t mind her moaning just then? Wait, does a skill like that even exist? ¡°A-Ahem. Anyways, are there any places with more monsters? ¡°More monsters? There is, but¡­¡± ¡°There is?! Can we go?!¡± She instantly asked as such, her eyes pretty much glowing gold. The dryad looked at her awkwardly, not really sure what to say, but after seeing her puppy eyes, she immediately resigned the battle and decided to lead the way. Diana jumped for joy, landing on the ground clutching her knee when she fell. ¡°Let me get ready for a moment.¡± The dryad said playfully as she turned away from her, who was still holding back her tears as she clutched her painful knee. Chanting several words into the air, several vines rose from the ground and wrapped around her, combining to form a one-piece vine dress over her naked body. A line of white flowers grew around her dress, as a spear of vines formed in her hand. ¡°Shall we leave?¡± She asked, a slight hint of seriousness mixed in together. Diana lost herself for a moment, staring at the beautiful figure before her. Pulling herself together, she picked up her silver knife and her staff. She stood up and nodded, smiling confidently at her companion. ¡°Let¡¯s leave then.¡± Leading the way, the dryad walked on, leaving the flower circle behind. Diana looked back, somewhat sad that she was leaving the flowers behind together with Slimey, but knowing that she would return here once again, she felt slightly at ease. But what if she never returned? What if she never found her way back, or if she died? That thought sent a shiver running down her spine. She would never dare to leave behind that adorable slime!! The walk there was mostly silent, with the wind occasionally chiming in to fill the silence. The grass sang together with the passing wind. The rising sun in the distance rose from the horizon, the sky painted in a mix vibrant colours. The stars blinked at them both. By the time the sky had fully turned blue, the finally reached their destination¡­A single tree. Wait a second, didn¡¯t she visit this place before? You know, where she killed that boar and got the [Cooking] skill? What¡¯s so special about this tree? Standing before the lone tree, the dryad chanted a song in a strange language, the air around them seemingly vibrating from every word she sang out. The leaves of the lone tree lit up a soft purple, as the earth below rumbled. A small arch opened within the bark of the tree, leading into a tunnel that goes deeper into the earth. Diana gulped as she viewed the tunnel. She wasn¡¯t going to regret this, was she¡­? She probably will, knowing her luck. ¡°Diana?¡± The dryad called out from within the tunnel, already entering on her own. Not wanting to be alone, she quickly ran in, the arch behind them closing as she blended into the shadows. ¡°Dark¡­¡± ¡°Wait a minute¡­¡± Chanting some more words, a yellow flower grew on her hair, lighting up the tight tunnel they were in. The tunnel looked¡­normal. It was just like any tunnels she had ever seen, not implying that she actually went through a tunnel. She would never dare to do such a thing!Ensure your favorite authors get the support they deserve. Read this novel on the original website. ¡°Don¡¯t get too far.¡± Following closely behind, Diana slowly made her way through the dark tunnels, the yellow flower on the dryad¡¯s hair serving as the sole light source in this darkened tunnel. The tapping of their feet echoed through the tight halls of stone. Slowly, the tunnel began to head down, deeper into the earth. The slight descent soon turned into a downward slope. They slowed down as they crawled through the tunnels, making sure not to slip or they would pretty much die. Well, that¡¯s questionable for the dryad, but it¡¯s imminent death for Diana. So, yeah, let¡¯s not do that. As they got farther and farther in, the tunnels began to expand, growing bigger as the walls began to move away from them. By the end of the tunnel, the tight corridor was led into a spacious cave. Blue glowing crystals littered the walls, lighting the room in a blue hue. The dryad removed the yellow flower on her hair and prepared herself, her vine spear armed. Diana tensed up, knowing that something was definitely coming. I mean, the dryad¡¯s getting ready, the room looks like a boss room, and they just walked down a sloping tunnel from a tree that just magically opened up. Yep, this is definitely a dungeon, alright. ¡°Here it comes.¡± A burst of magical energy gathered in the centre of the room, shaking the stone around it. The cave walls trembled under the magical might that gathered in the centre. A bead of sweat rolled down her face as she tried to picture what kind of boss she would be faced against. The gathering of magic lasted for about a minute, before an explosion resounded through the room. The stone rumbled as they both readied themselves, the dryad with her spear, and Diana with her staff. A surge of magic rose as a being rose from the stone. The being was¡­A giant slime! *Que Joseph Joestar¡¯s ¡®OH MY GOOOD!!¡¯ scream* ¡°Oh¡­My.¡± The being slowly turned towards them, a wave of mana passed over them. Diana almost screamed as she felt tripped, while the dryad remained focused, her eyes vigilantly locked onto the first boss of the dungeon. Why is it always the slime?! Is her first everything going to be a slime?! The dryad was ready to leap at the slime, but a sudden change in pressure stopped her. The heavy pressure of hostility was no more, as the large slime slowly crawled its way towards them. She no means let her guard down, but the slime no longer showed hostility. Why? She knew why soon enough. ¡°N-No¡­D-Don¡¯t¡­¡± Diana tried crawling away, but the tunnel was an upwards slope. She couldn¡¯t escape. Was she done for? Was this how her life would end? By a slime?! Seriously?! Why isn¡¯t the dryad doing anything?! Please attack iiitt!! And then, the slime stopped right before Diana. She looked up to it, her eyes swimming around as she tried to cast her magic, but her fear stopped her from doing so. The slime slowly bent down, and¡­rubbed against her cheek. ¡°H-Huh¡­?¡± There were no attacks. There was no magic. No hostility loomed in the air. Just¡­playfulness? What?! This IS a boss, isn¡¯t it?! Why isn¡¯t it attacking her at all?! That¡¯s not how this works! Why is she even trying to reason with this?! Okay¡­Calm down. Let¡¯s take a serious look. What titles does she have? [Friend of the Dryad]? No! Not that one! The other one, yeah, [Slime Queen]. What does its description say? [Slime Queen] A title granted to those who have been crowned as the leaders of the slimes. Slimes are naturally friendly to you. Gives access to [Slime Valley]. Any [Slime] related skills gain a slight experience boost. There! What does the second line say? ¡®Slimes are naturally friendly to you¡¯? Hmm¡­I wonder what that means¡­Hhhhhmmmmmm¡­ Okay, it just means that all slimes are friendly NPCs. And then, a string of long message appeared before her eyes. [1st Boss of the Crystal Caves has been cleared! Gained 150 Experience] [No damage bonus! Gained 50 Experience] [The title [Conqueror of Slimes] has been acquired. 5 Skill Points Gained] [Congratulations! Peasant has levelled up to Level 4! Your stats have improved] [Congratulations! Peasant has levelled up to Level 5! Your stats have improved] [Peasant has reached Max Level! 5 Skill Points Gained] [Class Evolution is now available] ¡°Awawawawa¡­What¡¯s all this?!¡± What is all this?! Wait uuuppp!!! The boss is not dead yet!! Why does it say [1st Boss cleared]?! The slime is still alive, rubbing against her cheek like a clingy lover! Someone please explain what is happening!! ¡°Umm¡­Is this okay?¡± The dryad silently asked as she looked at the cornered Diana, her eyes showing pity as she bumped her head against the wall. For some reason a part of her felt cheated for beating the first boss this easily. With the boss cleared, the slime began to fade away, the dungeon simply deeming the battle over. The slime rubbed against her cheek one last time, before it completely disappeared into the air. Trails of magic floated in the air. ¡°Diana? Are¡­Are you okay?¡± ¡°I¡¯m¡­hic¡­I¡¯m fine.¡± Standing up, she wiped away the tears from her eyes and smiled. She didn¡¯t know why she was crying, but she didn¡¯t care too much about it. For now¡­She won!! Haha! Take that dungeon! She beat it without even attacking!! Glitches be abound! Hail exploits!! Let¡¯s take a look at her stats now! Name: Diana Race: Human Age: 17 Class: Peasant Lv: 5/5 | Exp: - HP: 20/20 MP: 14/20 SP: 16/20 [Strength]: 7 [Tenacity]: 6 [Agility]: 7 [Intelligence]: 7 [Dexterity]: 8 [Mentality]: 7 [Endurance]: 7 [Wisdom]: 8 [Longevity]: 3 [Skill Points]: 29 {Skills}: [Slime Valley: Lv 2/10], [Knife Mastery Lv 2/10], [Slime Magic Lv 3/10], [Assassination Lv 2/10], [Alleviation Lv 1/5], [Cooking Lv 2/10], [Internal Mana Manipulation Lv 1/10], [Bubble Magic Lv 4/10] {Magic}: [Slime Magic Set] {Titles}: [Slime Queen], [Friend of The Dryad], [Conqueror of Slimes] [Conqueror of Slimes] A title granted to those who rule over the species of slimes. You deal 10% more damage to slime type enemies. +1 to [Intelligence]. ¡­¡­Wow. Just, wow. W-Was her eyes lying to her? Did she really just jump over two levels?! Holy crap that¡¯s awesome! A new title too?! Was luck showering her in fortune for once?! Did it finally regret letting her get slimed at the first moments of this world?! Whatever the case, hell yeah! This was great! But something else caught her attention in that insane string of messages. Something she had been looking up to since she first opened her status. Something that would finally let her leave behind her class as a ¡®Peasant¡¯. It¡¯s class change time!! [Available Classes] -[Novice Mage]- -[Novice Assassin]- -[Chef]- -[Novice Monk]- -[Slime Maestro]- Yeess¡­Look at that! They all sounded sooo tempting! Except maybe for the [Chef] class. Why was that even there? If she wasn¡¯t reading it carefully, she might¡¯ve instantly chose the [Novice Mage] class, but the class at the bottom interested her the most. [Slime Maestro] A user of [Slime Magic]. They who wield the powers of the slime rise above all. +2 to all attributes. Increases proficiency with [Slime Magic] and [Slime Valley]. Slime based skills or magic gain experience faster ¡°Yep. This one. Click!¡± Without any more waiting, she chose [Slime Maestro] as her class and clicked accept. A *Ding* sounded in her mind as her status took a change, for the better of course! Name: Diana Race: Human Age: 17 Class: Slime Maestro Lv: 1/10 | Exp: 1/50 HP: 40/40 MP: 29/35 SP: 31/35 [Strength]: 9 [Tenacity]: 8 [Agility]: 9 [Intelligence]: 9 [Dexterity]: 10 [Mentality]: 9 [Endurance]: 9 [Wisdom]: 10 [Longevity]: 5 [Skill Points]: 29 {Skills}: [Slime Valley: Lv 2/10], [Knife Mastery Lv 2/10], [Slime Magic Lv 3/10], [Assassination Lv 2/10], [Alleviation Lv 1/5], [Cooking Lv 2/10], [Internal Mana Manipulation Lv 1/10], [Bubble Magic Lv 4/10] {Magic}: [Slime Magic Set] {Titles}: [Slime Queen], [Friend of The Dryad], [Conqueror of Slimes] Holy¡­mother of ducks. Look at her now!! Heck, even her [Longevity] increased by 2 points! Just, amazing dude. Wow. Ooh, what¡¯s this new menu? Click! [Available Class Skills] [Slime Army] Costs 10 Skill Points to unlock Lv 1/10 Allows you to form an army of slimes to fight for your cause. Requires 2 MP for each slime. Any Exp gained by the slimes would be transmitted to you. You can let the slimes roam, or control them willingly. [Energy Burn] Costs 10 Skill Points to unlock Lv 1/10 Allows you to rapidly burn through your SP. In return, your stats are boosted by 25%. Your skills cost less MP to use while this burn is active. [Slime Mend] Costs 10 Skill Points to unlock Lv 1/10 Gives the slime you create healing properties. This skill can be toggled on and off. Creating slime while this skill is active consumes 200% more mana. ¡°Hmm¡­¡± Damnit! If only she had 1 more Point, she could get the 3 of them! How unlucky!! All these skills sounded so good! Now¡­Which one to choose¡­? She decided to take some time to think. Little did she know that some time meant spending a couple hours brooding over which skill to pick. The dryad could only helplessly watch as Diana mumbled and whispered to herself about which skill to pick. Poor dryad. [11] Was She Just THAT Underpowered? ¡°Hhmmmmm¡­¡± ¡°Diana¡­A-Are you done now?¡± Leaning her back against the cave walls, Diana grumbled softly as she read over the three skill descriptions once more. If only she had 1 more point, she could just get all three!! [Available Class Skills] [Slime Army] Costs 10 Skill Points to unlock Lv 1/10 Allows you to form an army of slimes to fight for your cause. Requires 2 MP for each slime. Any Exp gained by the slimes would be transmitted to you. You can let the slimes roam, or control them willingly. [Energy Burn] Costs 10 Skill Points to unlock Lv 1/10 Allows you to rapidly burn through your SP. In return, your stats are boosted by 25%. Your skills cost less MP to use while this burn is active. [Slime Mend] Costs 10 Skill Points to unlock Lv 1/10 Gives the slime you create healing properties. This skill can be toggled on and off. Creating slime while this skill is active consumes 200% more mana. Seriously, which one should she get?! They all sound so good! [Slime Army] pretty much would turn her into a summoner, [Energy Burn] was a nice situational skill to have, and [Slime Mend] could act as a heal. Why was this so hard?! ¡°Diana¡­?¡± No, wait. If she had [Slime Army], she could just send them out later in battle and then use her magic as backup, but! If she gets caught creating the slimes, then she¡¯s dead. [Energy Burn] was insanely situational, and she¡¯ll most likely use it when she really needs to survive. [Slime Mend] would act as a great support skill, but does that also extend to enemies? What if her enemy takes hold of the slime and heals? She¡¯d be helping the other team! Hah¡­She can¡¯t choose now. You know what? Let¡¯s just pick [Slime Mend] for now, that seems to be the most useful one. Yeah, click! [Attain [Slime Mend]? Y/N?] Yes please! [[Slime Mend] has been acquired] Huh. No skill points, eh? Well, I guess it does make sense. It would be kind of cheating if she spends her skill points to get some of them in return. But well, what can she do? ¡°I¡¯m done.¡± ¡°Finally! Let¡¯s go.¡± Picking her spear up, she turned towards the next tunnel, and went in. Diana soon followed behind, the light of the previous cave slowly dimming down. The yellow flower bloomed on her hair once more, lighting the surrounding dark tunnels. Their steps echoed against the cave walls, the dark shadows creeping from below. A small surge of magic rumbled within the stone. A slight vibration could be felt coming from within the earth itself. The dryad easily noticed. Diana? Not so much. They continued through the dark tunnel, the walls around them slowly growing apart as the tunnel grew wider. Small glowing blue crystals grew out from the rocks, a dim blue glow lit within the rocky halls. Ooh! A mushroom! Could she gather that and sell it to a merchant or something?! That would be great! Oh, wait. She didn¡¯t have her backpack with her. Damnit! She didn¡¯t have any inventory slots available! And then, a slight crackle could be heard. ¡°Stop.¡± ¡°Eh?¡± The dryad took out her spear and held it before her, the tip radiating with natural energy. Her eyes narrowed down as she sensed an incoming force. Diana, still confused, simply readied her knife, the silver edge gleaming blue. And then, it came out! ¡°Shhiii!!!¡± ¡°Shiiaaa!!¡± ¡°H-Hii?! Spiders?!¡± Out from the shadows, came a large group of black spiders, their eight red eyes glowing within the dim blue hue. Their poisonous fangs dripped of purple poison, dripping onto the stone grounds. ¡°Be ready.¡± The spiders continued to come. When was this going to stop?! There¡¯s so many of them! What? 50? 100? How many are there?! This is insanity! How were they going to beat this large army of spiders?! She didn¡¯t have any AOE attacks!! ¡°Shhhii!!!¡± The spiders screeched and lunged forward, their fangs open and ready to stab. Their poison ready to kill, that is, until a swing from the right came and knocked the first wave out. Eh?! An explosion sounded from the right, a wave of debris flew out! What the?! She IS a dryad, right?! You know, a spirit and nature and stuff?! What¡¯s with this insane strength!? ¡°W-Woah.¡± She quickly shielded herself from the incoming debris, a trail of dust left behind as the dryad fixed her posture, tapping her spear against the cold stone floor. The spiders stepped back, realising that their prey might not be as easy to kill as they thought. The dryad clapped her hands together and chanted, an aura of natural energy swirling around her. The spiders quickly charged ahead. A perfect chance for an attack! ¡°[Slime Cannon]!!¡± Holding her staff, she formed a slime ball and shot it out. The slime collided with a small group of spiders, sending them back towards the ground. Hah! Clear hit! Wait, they didn¡¯t die?! And more are coming?! ¡°[Overgrowth]!¡± Large roots grew from the ground, and swallowed the incoming spiders, crushing them apart under the intense force. One by one, the spiders died out as-¡­Wait, did she just kill them all in one shot? Seriously? W-Was she just that underpowered? A minute of silence passed by, and no more spiders came crawling out. Any remaining they spotted would either be crushed by the dryad, or get shot down by Diana¡¯s [Slime Cannon]. Since it was her first test run, she wasn¡¯t very proficient at using it. As a result, she needed about 2 shots to finally destroy just one spider. ¡°Hah¡­hah¡­¡± ¡°Are you alright?¡± Diana took a deep breath, and let go. The exhaustion from her loss of MP was not pleasant, in the slightest. Her muscles felt like they were going to fall apart from her bones, and her lungs felt like they were being squeezed for all it was worth. The dryad quickly took out a blue berry, from who knows where, and fed it to her. Diana relaxed as she felt the berry take effect, healing her MP back to at least half of her capacity. Her cheeks loosened as she felt herself slipping away. Ooohh¡­Why was she feeling so sleepy so¡­suddenly¡­? ¡°Are you okay?¡± ¡°Hmm¡­? Un¡­¡± She replied back, still struggling against her drowsiness. Standing back up, she yawned and picked her weapons up. 5 more seconds passed, before she dropped her weapons back down. The dryad quickly caught her before she crashed onto the floor. [Enemy has been slain. 5 Experience gained] [Enemy has been slain. 5 Experience gained] [Enemy has been slain. 5 Experience gained] [Enemy has been slain. 5 Experience gained] She didn¡¯t even have any time to read those messages, as she fell asleep in the dryad¡¯s arms. ¡­¡­¡­¡­¡­ Some time after, she finally opened her eyes. Her hair flowed behind her as she moved across the rocky floor, her arms wrapping around the dryad, carrying her without much of an effort at all. Her soft steps echoed against the walls around them, a soft blue hue lit the darkness.If you encounter this story on Amazon, note that it''s taken without permission from the author. Report it. Turning her eyes to the front, she watched as they moved further into the cave. Oh, there¡¯s a spide-, okay, it¡¯s dead now. Moving on, she kept walking on, passing by the crushed corpse of the dead spider. Oh hey, it¡¯s a black bat! Wonder what it¡¯s special attack is-, okay, a vine snapped at it and killed it in one shot. The bat dropped onto the cold floor, its wings snapped off. Sighing softly, the dryad moved past. Was she just really powerful? Or was Diana just too weak? Probably the latter. Although she was pretty much breathing onto her neck now, the dryad didn¡¯t seem to have noticed her waking yet. Or she has, but decided not to call out to her and let her enjoy the ride on her back. If it was the latter, thanks! Her back feels comfortable to lean against¡­ Hmm? What¡¯s this warmth she¡¯s feeling in her chest? Was she getting sick or something? ¡°Diana?¡± ¡°O-Oh. Did you know?¡± She giggled softly and nodded. Rather reluctantly, she stepped down from her back and took back the weapons she had been carrying for her. Wait, did she fight all those monsters while carrying her AND her weapons? Gee, just how strong is she? Anyways, with Diana back on her feet, the pair continued their journey through the cave. She was still very much tired, and wasting more of her MP would be bad, so she stayed behind and watched as the dryad tore apart another incoming bat. Somehow her spirit seemed to dwindle as she watched a helpless cave rat get squashed under her spear¡­ Time went by, as more and more denizens of the cave fell prey to the force of nature that walks before them. And that expression actually makes sense, because the dryad is a¡­well, a dryad! Just tell me how unfunny I am! Finally, after about 2 hours of watching the enemies get one-sidedly slaughtered by her, she finally arrived at the end of the cave. A large stone door stood before them. Purple runes stretched across the stone surface, pulsating with seemingly infinite magic. Wait, wasn¡¯t this door too big? How were they going to pas-, oh, you just push it¡­What?! The door was about 10 times her height! How did the dryad just push that?! With one hand too?! She isn¡¯t some paladin in disguise, is she? ¡°Come.¡± ¡°Uh, yeah.¡± Walking past the opened doors, they stepped into the room on the other side. Before them, existed a simple room, a single pedestal of stone standing alone in the centre of it all. A circle of runic letters surrounded it, glowing a soft purple shine. The smell of magic leaked into the air, not that she knew what magic smelled like. ¡°What¡¯s that?¡± ¡°That?¡± A surge of magic sparked from the pedestal, flying out into the runic circle around it. The earth began to rumble, as the runes began to rotate around the pedestal. The purple glow brightened, the air vibrating violently. The rocks began to shake, magic swirling within the air. ¡­Was this another boss room? ¡°That¡¯s the next boss.¡± Yup. Got that correct. Well then, wonder what the boss will be this time? A large serpent? A dragon? A large blue minotaur from a certain anime? Oh, maybe not. Out from the glowing circle, rose a large towering figure. His height far surpassed theirs, standing just above 5 metres or so. His large arms twitched as magic moved within. Two demonic horns grew out of his head, his dark brown hair flapping wildly as he fully formed, a large blade formed in his hands, the sword looked oddly similar to a certain hero on his final fantasy. Did you steal that from Cloud, you bastard?! ¡°Diana. Be ready.¡± ¡°H-Huh? Oh, yeah.¡± Taking hold of her staff, she readied herself, her eyes fully locked onto the demon before them. His face remained expressionless as he swung his sword in the air, an air of strength floated within his presence. Umm, wasn¡¯t she super underpowered? How the f*ck was she supposed to beat this?! ¡°[Floral Spear]!¡± Stepping back, she aimed her vine spear, and threw it! The spear cut through the air, and overflowed with natural energy. A surge of green magic exploded from the spear as it made contact. The demon quickly used his large blade to block the attack, but still got pushed back back. His deep purple eyes stared straight into their souls. ¡°Diana! Be careful.¡± ¡°Y-Yes ma¡¯am!¡± Clapping her hands together, the dryad ran straight at the demon. A wave of large roots followed behind her, crawling across the stone floor. Remaining expressionless, he stabbed his sword into the stone, and chanted. The air vibrated violently under his words. The dryad suddenly fell onto her knees, an unseen force weighing on her shoulders. But such thing would not stop her! Chanting once more, the dryad formed a barrier around her, and charged! Spear in hand, she sent several stabs onto the demon, he in return parrying with his large sword. Their blades clashed under the influx of magic. Diana simply watched from behind, her eyes looked dead. Her mind was aimlessly wandering around in limbo, wandering when this battle would end. Obviously, she was a sh*t character, and she was way too weak to join. One swing from his fi-, no, one flick from his finger should be enough to kill her soo¡­nope. Eh? But isn¡¯t the dryad getting beaten? Her layers after layers of barriers were getting torn down! Her face seems to be covered in sweat, and she was starting to slip up her and then. Ah! She even got kicked back! Damnit! There was bound to be something she could do!! Come on, even the crappiest characters have some role in the battle, right?! All she needs to do was to find it!! ¡°[F-Floral Shield]¡± A barrier formed around her downed self, blocking the incoming sword strike. The barrier instantly fell apart, as she charged once more with her spear. Stabbing it into his chest, she stepped back and set the spear off, a burst of magic exploded within his body. ¡°Hah¡­hah¡­¡± But, the demon stepped out from the dust, his body still standing strong as he brandished his large blade. Raising it above his head, he loaded a burst of mana into his arm and- *Splash!* A load of slime landed on his face¡­What could this nonsense be? Wiping the slime off, he looked at Diana, who was pretty much shaking from top to bottom, her mana still present in the air. Her eyes swam around as she noticed his piercing glare. The only thoughts the went through her head were ¡®Sh*t,sh*t ,sh*t,sh*t,sh*t,sh*t,sh*t,sh*t,sh*t¡¯ Yup, that pretty much sums it up. ¡°[Ensnare]!¡± A large root grew from the stone and coiled around his body, pressing against him in an attempt to crush his bones. Sadly, they were simply a nuisance, as he easily tore them and shook them away. ¡°Guha?!¡± A kick was sent to her chest, as she was blown away. An explosion sounded as she landed into the wall next to her, the walls trembling from the force. She almost shrieked as she heard the explosion next to her. Sh*t! He¡¯s walking this way!! Oh! This must be the moment when she powers up! You know? Like when the protagonist gets trapped in a tough situation, plot armour comes in and gives them some new power or something! Come on now! Where¡¯s her unique skill?! ¡°A-Ah¡­¡± Sh*t¡­He¡¯s standing right before her!! His eyes looked down on her, cold and emotionless. She blinked, and she found the large sword right before he neck, gleaming silver in death. She could almost feel the cold scythe of Sir Death wrapping around her!! W-Was she going to die? Like this?! Well, she does get a cool way to die, so if she does get a story, a game, or an anime, there should be enough source material to use! Haha! Trying to think positive thoughts in this situation is making it worse!! *Swing!!* ¡°Kya?!¡± And then he swung!! Luckily, she managed to step back in time, but the staff she was holding took the attack, and got cut in half! Nooo!! Mr. Staff!! Don¡¯t die on her!! ¡°¡­Eh?¡± Umm¡­Why was magic leaking out from the staff? And¡­Why does it look super ominous? It¡¯s like, all black and everything. There wasn¡¯t a demon hiding inside this staff or something crazy¡­right? Uhh¡­Is it sizzling? What was going to- *BBOOOOOOMM!!!!* ¡°Gua?!¡± A large *Boom!* overtook her as she was sent crashing into the wall. The demon too crashed into the opposite wall, his large blade knocked away from his hands. ¡°O-Ouch¡­¡± Holy crap¡­Did she just survive that?! A kick from that demon knocked the dryad unconscious, but that explosion, which did send the demon flying by the way, didn¡¯t kill her yet?! Haha! Thanks, Mr. Staff! Wait, she wasn¡¯t that hurt?! What the?! Didn¡¯t she just crash into the wall and stuff?! Where¡¯s her large bruise?! Or her awesome scar?! She¡¯s completely unharmed! Was the explosion bugged or something? Rising from the rubble, the demon stepped out, his face still emotionless despite what had just happened. Seriously, what is this guy made of? Adamantium? Oh crap, he¡¯s walking towards her again! She didn¡¯t even have her staff anymore! And her silver knife would probably be useless now!! She needed a weapon! ¡°Oh? That¡¯s¡­¡± Oh hey! That¡¯s the demon¡¯s large blade! Can she even pick that up? Her arms weren¡¯t that strong, not that she had strong arms before she turned into a girl. Ah, think later! The demon¡¯s getting closer! Running over to the sword, she wrapped her hands around the large blade¡¯s handle, and liifftt!! Nope, it¡¯s not working. Liiffftt!!! Damnit! She¡¯s too weak! Cursing softly, she formed some slime around the handle, and tried to carry it that way. It did move slightly, but fell down right after. Damnit, even that doesn¡¯t work?! Again she tried, this time cloaking the blade in her slime and then lifting it. And it worked! She was lifting a blade about 2 or 3 times her height! Ah, but her MP was being drained like mad¡­ ¡°Eh? What¡¯s this?¡± Hey, why was the blade shining? Ooh, it¡¯s turned black! Wait, why is it moving downwards? Wait, even her slime is turning black?! What the?! E-Eh?! Her hands are black too?! She tried to let go, but her body wouldn¡¯t move!! The black element continued to creep further up her body, until finally, her whole body was fully cloaked in black. Her pupils shrunk as she lost consciousness. Well, sh*t. ¡­¡­¡­¡­¡­¡­ ¡°Ngh¡­?¡± Opening her eyes, a dark void surrounded her. Everywhere she looked, all that came back was the void. Eh? Where¡¯s the cave? The dryad? The demon? Her silver knife¡¯s gone too! What the?! Is this limbo or something? Did she die? ¡°Huh?¡± Floating away from her, she could see the demon¡¯s sword, floating there, just, smaller. The blade seems to be about her height now, and black runic lines ran across the blade¡¯s surface. An ominous feeling seemed to pulsate from within. Eh? It¡¯s getting closer to her? Oh! Is this the part where she gets corrupted and gets turned evil or something?! That would be awesome! Come on! Come closer and turn her evil! Give her cool powers okay? Eh? What¡¯s this disappointment she could feel from the blade? Eh?! What do you mean you don¡¯t want to corrupt her?! She¡¯s a perfect target! Hey! Why are you floating away?! Look at her damnit!! Oi. It¡¯s getting farther away. Not wanting to lose the chance of becoming an evil overlord, she ran as fast as she could towards the escaping blade, who seems to be utterly terrified of this terrifying individual. Like hell it could corrupt her! She would corrupt it first! ¡°Heeeyy!! Don¡¯t run away!!¡± Nope, not stopping. The blade continued to float away as fast as it could, hoping this insane girl would just stop chasing it already. Alas, her NEET heart couldn¡¯t be stopped, as she continued to chase the blade. An hour, or what felt like an hour, passed by, and the blade was getting tired. This girl was still chasing it! When was she going to stop?! Did she have infinite energy or something?! Stop already! Even the blade was beginning to feel tired as she kept chasing it through the endless void. This girl was insane. Realising that she wasn¡¯t going to be defeated any time soon, the blade stopped running away, and turned to face her. With a bright smile, she ran towards it and held it in her hands. ¡°Come on! Turn me on already~!¡± ¡­That could be taken in another way, but I digress. Not wanting to deal with her anymore, the blade shined a deep purple as the void around them began to crumble away. ¡°H-Hey?! Don¡¯t just leave!¡± Not listening! Escaping her clutches, the blade floated high into the air, and disappeared into the air. The void faded away, and the she was back in the room she had been before this. But she really wanted to be turned evil! What¡¯s the deal with that blade?! Oh well, let¡¯s take a read on these messages first! [2nd Boss of the Crystal Caves has been cleared! Gained 250 Experience] [Unique completion route achieved! Gained 100 Experience] [The title [Soul Conqueror] has been acquired. 15 Skill Points gained] [Congratulations! Slime Maestro has levelled up to Level 2! Your stats have improved] [Congratulations! Slime Maestro has levelled up to Level 3! Your stats have improved] [Congratulations! Slime Maestro has levelled up to Level 4! Your stats have improved] Name: Diana Race: Human Age: 17 Class: Slime Maestro Lv: 4/10 | Exp: 71/200 HP: 47/49 MP: 26/44 SP: 38/44 [Strength]: 13 [Tenacity]: 11 [Agility]: 13 [Intelligence]: 12 [Dexterity]: 13 [Mentality]: 13 [Endurance]: 12 [Wisdom]: 14 [Longevity]: 5 [Skill Points]: 34 {Skills}: [Slime Valley: Lv 2/10], [Knife Mastery Lv 2/10], [Slime Magic Lv 3/10], [Assassination Lv 2/10], [Alleviation Lv 1/5], [Cooking Lv 2/10], [Internal Mana Manipulation Lv 1/10], [Bubble Magic Lv 4/10], [Slime Mend Lv 1/10] {Magic}: [Slime Magic Set] {Titles}: [Slime Queen], [Friend of The Dryad], [Conqueror of Slimes], [Soul Conqueror] [12] F*ckin Mazes [[Energy Burn] has been acquired] [[Slime Army] has been acquired] ¡°Ehehe~, I finally have them all~¡± Oh yeah. Look at that. Two new skills, bam! Thanks to the previous new title she got, her skill points jumped up to 34, which meant that she could pretty much get the other two skills! Haha! This was great! But her destroyed staff wasn¡¯t so great! She teared up a bit as she picked up a piece of its former glory. It wasn¡¯t going to be easy without this big guy¡­Casting and using magic would surely become much harder! Alright, enough brooding and standing around, the dryad needs help! Oh crap, was she even alive?! She quickly ran over to her, and she¡¯s gone¡­Eh? What the? There¡¯s only a hole here! Where did she go?! Peeping her head through, she got a quick look at the other side. A cave, those blue crystals, and more mushrooms. Did the dryad head down this way? Seeing as there was no way to escape this room, that was most likely. So, with that thought, she walked through and stepped onto the other side. Hey, should she take these mushrooms? Were they even useful in any way? Well, a certain ordinary magician should be happy about this! Anyways, the caves seemed to be light enough, so walking through shouldn¡¯t be that much of a problem to her. Holding her silver knife, she sighed and walked on. Being reminded of those nasty spiders from before, she kept her guard up at maximum. She wouldn¡¯t want to get assaulted by spiders, or by bats, or by anything! Step by step, she made her way through the silent caves. The first minute or so passed by rather silently. After that passed, she began to see dead corpses of many different monsters, plastered and scattered all over the ground. A sign of the dryad! But that carnage was accompanied by a huge claw mark across the cave wall. Three huge slashes scarred the wall, not something the dryad could do, probably. She didn¡¯t know her full abilities yet, so she couldn¡¯t be too sure. Passing that, more and more corpses piled up across the stone floor. Blood splattered all over the stone, slashes scarred across the floor. Geez, she really did leave a mess, didn¡¯t she? ¡°Kiki¡­¡± ¡°Sh*t.¡± Well, looks like there was a survivor! A small little cave rat! Its blue fur shivered as it walked out from the cover. Its beady red eyes stared at her, almost begging her to drop everything and pet him, and she almost did, if not for the huge sharp teeth it displayed rather openly. ¡°[Slime Cannon]!¡± Forming a slime ball within her hands, she held it out, and fired! The sphere collided with the rat, sending it flying back, but by no means killed it. From the puddle of blood, it rose out, its blue fir tainted red from blood. ¡°Ki-¡° ¡°[Slime Cannon]!¡± She shot out another sphere, speeding and crashing squarely on the rat¡¯s face. It wobbled, before falling down into the puddle of blood, its red eyes looking on lifelessly. [Enemy has been slain. Gained 7 Experience] You know? She was kinda hoping for her [Slime Cannon] to level up, but it seemed like it wasn¡¯t its time yet. Oh well, she still could wait. Ooh, although, her MP was dropping quite low. Using any magic for now shouldn¡¯t be too great. She did still have her knife, but seeing as all the monsters here were quite agile, physical attacks would be quite hard to pull off without some insane Mission Impossible moves. And she hardly exercised in her past life! So nope! Anyways, when was this trail of corpses and blood going to end? It¡¯s been about 5 minutes or so of her just walking past them, and they it didn¡¯t look like it was ending any time soon. ¡°Spoke too soon.¡± She stopped before another large stone door, the same purple runes stretched across the stone surface. The lines glowed with energy, pulsing with mana. The blue light of the crystals merged with the purple glow. Ah, but she can¡¯t even push the door open. Even with her using her whole body and pushing it, the door wouldn¡¯t budge even an inch. She even tried adding slime onto the door and pushed, but it didn¡¯t matter, and her MP wasn¡¯t looking too good either! So let¡¯s stop that. ¡°Hmm¡­What should I do?¡± Now she really was stuck. Before her was a large door, too big for her to open. Her slim arms carried no power behind them, her MP was running low, and the one person she knew who could open this door was missing. What can she do now? ¡­And then it hit her. ¡°Ah! I¡¯ll just do this!¡± Yeah, this should work! There¡¯s still a small gap in between the doors, so she should be able to pull this off! Alright, clothes, you¡¯re going off! Now naked, she took a deep breath, and activated [Slime Valley]! In her slime form, she easily squeezed through the small gap between, and popped out on the other side! Plan success! Ah, but she¡¯s naked now. It¡¯s cold, and dark. Luckily, she was still able to pull her clothes through the small gap, but her knife was a loss cause. Crap, she¡¯s unarmed now. Her staff¡¯s gone, her knife¡¯s left behind, and her MP had just dropped below 10. She¡¯ll be screwed if she encounters something here! Well, let¡¯s push that aside for now. Looking up, she stared upon the room before her, and soon, she realised that she was pretty much f*cked. ¡°It¡¯s a maze?!¡± It¡¯s a maze!! It¡¯s a f*cking MAZE?! Why?! Why a maze?! She hated mazes! And she didn¡¯t have any weapons to defend herself! How to f*ck was she supposed to pass through this?! And she could hardly see anything! Diana sighed and rubbed her temples. Getting worked up wouldn¡¯t do her any good. She¡¯s stuck here, she should deal with it. Brooding and cursing to herself would not bring her anything, if anything, it would probably attract more monsters, which would f*ck her up even more. Alright, rule number one, always stick to the left! Following the left wall, she began to explore the dark maze. 5 minutes passed, and she hit a dead end. Greeaaatt¡­She¡¯s stuck already. Well, let¡¯s head back¡­Which way is that again?Stolen content warning: this tale belongs on Royal Road. Report any occurrences elsewhere. ¡°Crap, I¡¯m lost.¡± Well, sh*t. She¡¯s lost, within a room with almost no lighting. How was she supposed to head back to the start?! F*cking mazes. Alright, stick to the right wall, maybe we¡¯d get through this hell hole! And¡­Nope. 10 minutes passed, and she found herself planting her face into another dead end. Cursing softly, she rubbed her face and turned back. Sticking to the right wall, she walked through the maze, occasionally face-planting and cursing into the darkness. 1 Hour passed, still no visible progress. Not visible, because she couldn¡¯t even see! Come on, give her a [Night Vision] skill or something already! She desperately needed it! 2 Hours later, and she was starting to get peckish. It had been some time since her last actual meal, and her hunger was beginning to catch up. This wasn¡¯t good, not at all! What do you think would happen if she starved to death, here?! She would probably get eaten by rats or something! 4 Hours, still nothing. She could clearly feel her hunger now. Her stomach was growling here and then, and her world was beginning to twist and turn. Why did she enter this maze again? Her mind was getting blurry. 6 Hours, and she was almost ready to give up on everything. Seriously, she needed to escape or she might develop some mental illness. Ah¡­Going crazy didn¡¯t sound too bad actually. 8 Hours, and she really was beginning to grow crazy in this dark maze. She began to giggle and laugh on random intervals, and random emotions began to surface as she smashed her fist against the stone wall. 10 hours passed, and as she was walking aimlessly, she felt something streaming down the wall. She was confused at first, but after several taste tests, yes, ¡®Taste Tests¡¯, she realised that this was ¡®water¡¯! In a haste, she brought her face close and licked the streaming water, doing her best to ingest as much water as she could. Her throat felt as dry as the desert, and any water she could get was pretty much a blessing! ¡°Mmm~¡± Of course, that wasn¡¯t ¡®Water¡¯. ¡°Abababababababababababababa¡± Collapsing, Diana struggled as she suffered a seizure, shaking uncontrollably across the stone floor. Well, that was what she got for drinking some unknown liquid off a stone wall within a dungeon! 5 minutes of pure seizure attacks, she finally stopped moving, only left with 1 HP! Ha! She was alive!! Oh wait, her MP and SP were on the verge of running out too¡­Damn, what the hell did she just drink?! ¡­¡­¡­¡­ Within the same corridors, a creature lived within. Its large black claws shone within the darkness, gleaming with bloodlust. Two pairs of purple eyes stared out into the shadows. Its figure diluted within the darkened maze. Just like always, it was taking its casual stroll through the corridors, just, enjoying life. Maybe eat some humans that got trapped here, you know, usual stuff. And today, there was a particularly tasty smell. With its mind set, it set out, following the smell to its origins. After some time spent navigating its large body through the maze, it finally found the origin of the smell! Slowly, it leaned closer, and closer¡­ Opening its large mouth, it extended its large tongue out. Slowly, the tongue lowered down, moved a bit, and¡­ Licked the wall. What? You thought it was going to eat the pitiful excuse of a meal under it? No! Why would it? It smelled terrible and it had nearly no mana! Why would eat that when this liquid had so much more mana? Pulling its tongue back in, it turned around and headed back to its home, leaving behind Diana, who was silently crying on the inside. What? You thought she was unconscious? Of course not! The moment that monster came close, her mind went on full alert and alarms of danger blared. ¡°Am I not enough?! Even water was more valuable than me!!¡± Was what she thought as she curled up into a ball and cried. Get away! She didn¡¯t even want to look at herself anymore! [[Danger Perception] has been acquired. 2 Skill Points gained] ¡°S-Shut up! You¡¯re not helping!¡± -Several minutes of contemplating life choices later- ¡°Hic¡­hic¡­I w-wanna die¡­¡± -Several more minutes of hitting her head against the wall later- ¡°M-My head¡­Ah¡­¡± -And several more minutes of cursing and shouting later- She was finally ready to depart once more! Her condition wasn¡¯t the best, not by a long shot, but hey! She needed to move damnit! She couldn¡¯t stay here crying and contemplating her life, no matter how much she wanted to curl into a ball and die that moment. Standing up, she wiped away her tears and sighed. Following her usual tactic, she stuck onto the right side of the wall and walked on, simply letting her feet take her. Moments later, she bumped into a dead end and turned around. A minute after that, she slipped and fell flat on her face. Some time after that, she spotted a small mushroom amidst the darkness. Its cap glowed a soft yellow hue. Using her many years of experience, there was no doubt that this was poisonous! So what did she do? Pluck it out and use it as a light source! Using her newly acquired light source, she made her way through the maze, and ended up at the entrance. Eh? What the? How did she end up here?! Well, let¡¯s continue walking then! ¡­Oi. What¡¯s this? Why was the exit door right next to the entrance?! It didn¡¯t even take her a minute to make it all the way!! Did she spend all that time there just to see this?! Was the dungeon trying to troll her?! If it was, then good job! You succeeded, you bastard. Walking up to the door, she nearly cried as she rubbed her face against the stone surface, savouring the feeling. She¡¯s been stuck in this maze for almost half a day, okay? Ah, but she can¡¯t open the door. F*ck. Well, guess [Slime Valley] was coming up next! Taking her clothes off, she shifted into her slime form and squeezed through the small gap in between. Pulling her clothes through, she took a deep breath, and shouted! ¡°I¡¯M OOUUUTT!!!!! F*CK YEAAAHH!!!¡± She almost cried as she rubbed her cheeks against the cave wall. Never in her life had she been so happy to see a cave! It almost felt like reuniting with a lost lover! Oh, how she missed this feeling! [The 3rd trial of the Crystal Caves has been cleared! 300 Experience Gained] [Congratulations! Slime Maestro has levelled up to Level 5! Your stats have improved] Name: Diana Race: Human Age: 17 Class: Slime Maestro Lv: 5/10 | Exp: 178/250 HP: 13/52 MP: 11/47 SP: 19/46 [Strength]: 14 [Tenacity]: 12 [Agility]: 14 [Intelligence]: 13 [Dexterity]: 14 [Mentality]: 14 [Endurance]: 13 [Wisdom]: 15 [Longevity]: 5 [Skill Points]: 16 {Skills}: [Slime Valley: Lv 2/10], [Knife Mastery Lv 2/10], [Slime Magic Lv 3/10], [Assassination Lv 2/10], [Alleviation Lv 1/5], [Cooking Lv 2/10], [Internal Mana Manipulation Lv 1/10], [Bubble Magic Lv 4/10], [Slime Mend Lv 1/10], [Slime Army Lv 1/10], [Energy Burn Lv 1/10], [Danger Perception Lv 1/10] {Magic}: [Slime Magic Set] {Titles}: [Slime Queen], [Friend of The Dryad], [Conqueror of Slimes], [Soul Conqueror] Level up!! She only levelled up once, but she didn¡¯t care! She got out alive, and she was happy! No special bonuses, who cares?! 300 Experience was already a whole lot! That aside, she really was racking up the skills, wasn¡¯t she? She should really start levelling her own skills up before she gained new ones. Levelling [Internal Mana Manipulation] wouldn¡¯t be that bad of an idea too! Alright, enough of that, let¡¯s continue! The soft blue glow surrounded her as she walked through the silent cave, her steps echoing through the empty halls. Small trails of magic floated within the air. Soon enough, she reached the next room. Thankfully, there weren¡¯t any doors blocking her, so she didn¡¯t need to transform! Heck yeah! Her MP was quite low, and she didn¡¯t feel like wasting them any time soon. Instead, the door was missing, leaving the next room visible to see. Walking through, she stepped into the next room, breathing in the warm air. Now, what was her next trial? It wasn¡¯t a maze is it? Yes, and no. It wasn¡¯t maze, but it was a puzzle instead. *Yaaaaay* Well, at least this one was slightly better than a dark maze with almost no light in it! She¡¯s played many puzzle games before, she should be able to do this! Little did she know that she would be spending the rest of the day crying out in frustration. -Meanwhile, back at the dryad¡¯s flower garden- *Boink?* Jumping out of Diana¡¯s leather backpack, Slimey appeared, finally awake from its slumber! Looking around, it was shocked to see its master nowhere in sight. Only a batch of flowers surrounded it! *Boink!* Found her! She was in a dungeon! Using the familiar connection she established with it, Slimey hopped across the empty plains towards the entrance of the dungeon. There, it stopped before a lone tree. Ah, but how was it supposed to go in? The arch that the dryad opened had closed up! Opening it by force was pretty much impossible for it. But then, it noticed a small gap within the tree, which seemed to lead down into a dark corridor. *Boink, Boink!* Hopping in delight, it squeezed through the small gap, and popped out on the other side. With its mind set on its master, Slimey began its journey to return to its master! Sadly, Slimey¡¯s journey through the corridor wasn¡¯t that interesting, so let¡¯s jump back to Diana! Unless you want to read about a slime rolling through a dark corridor thinking about random things that is! -Back at Diana- ¡°F*cking stupid lever! Just open the f*cking vault already!!!¡± *Click!* ¡°No!! Not that one! The other f*cking one!! AGH!!¡± *Click, clack!* ¡°Just open-, hah¡­Just end me¡­¡± Yeah, let¡¯s save that for the next chapter¡­ [13] F*ck Puzzles too! ¡°End me already¡­hic¡­¡± And so, we return to see Diana, who was currently curling up into a ball and bawling her eyes out as she smashed her head against the wall. She was good at puzzles, she said? F*ck no! She sucked ass! So, after about 4 hours of constant frustration and head pain, she finally broke. There was no way in hell she was going to complete this damn puzzle!! The 4th trial of the Crystal Caves is known as the labyrinth of madness, infamous for driving many young adventurers insane. Diana here was a perfect example! 52 different rooms, 13 levers, constant traps and illusions, this trial was the perfect ¡®F*ck You~!¡¯ sign. To make it even worse, if that was even possible, she needed to hit the 13 levers in the correct combination to get the gate at the far north end of the labyrinth to finally open! And the only thing to give her a sign was the *Click* noise she¡¯d get after she flicked the levers! If she got it correct, it would just go *Click*. If not, then two *Click* sounds would come up. She needed to flick the levers 25 times, and the same lever could be pressed three times! THREE TIMES!!! Long story short, this was a trial that truly tested the endurance of those who dared to enter! Sadly, after the 4 hours she had spent shouting and cursing in frustration, she only managed to get 4 of the 25 flicks. Add in the occasional trap and illusion, it was a perfect recipe to drive her insane. But! She would not give up! She had crawled through the first 3 trials, she would not lose now! Rising up, she wiped away her tears and began the process once more. She wouldn¡¯t back down! Not here, not tomorrow, not until she finished thiisss!! *Click, Clack!* ¡°¡­¡­F*ck.¡± And that¡¯s over. The moment she got her 4th lever flicked, the 5th one would always fail!! Agghh!! What did she do wrong to deserve this?! All she wanted to do was try and level up!! Not what this sh*t is! But, just as she was getting ready to smash her head again, she felt something, coming from the previous trials before her. It took her a bit, but she soon realised that her companion had woken up! Slimey¡¯s back in the show! Huh? But Slimey¡¯s not moving? Slimey was still in the first trial, the one with that huge slime. No¡­D-Did Slimey fail and die?! No! Let¡¯s not go there first. From her connection, there didn¡¯t seem to be any distress nor danger coming from Slimey, so he seemed alright. But why was Slimey waiting in the 1st trial? Was it chatting to the giant slime or something? Little did she know, that Slimey really was having a nice pleasant chat with the giant slime. But that aside, she really needed to finish this trial! But how?! She couldn¡¯t just stay here! She would starve! But then, an inspiration came! [Slime Army] Lv 1/10 Allows you to form an army of slimes to fight for your cause. Requires 2 MP for each slime. Any Exp gained by the slimes would be transmitted to you. You can let the slimes roam, or control them willingly. ¡°Yeah! This should do!¡± With her plans set out, she began her mass production of her very own minions. Sadly, they weren¡¯t addicted to bananas, but that¡¯s fine in her book. She clasped her hands together, and slowly, a slime began to emerge from within! Ah! Why don¡¯t we make this a bit fun? Forget the normal boring slime blobs, let¡¯s make them a bit more special! *Flips through her library of game knowledge* ¡°Found it!¡± Her eyes lit in excitement, as the slime in her hand began to morph. Out from its back, a small bushy tail emerged, and a pair of cat ears popped out of its head, not implying that the slime actually had a head, but, moving on~. Also, let¡¯s give this guy a pair of googly eyes too! And¡­Done! Her creation was finished! *Boink!* Her new slime minion looked up to her, its googly eyes staring at her. Being the person she is, she released a cute ¡®Aww~¡¯ and petted the little guy. Its googly eyes showed no change, but the tail behind it swayed happily. Somehow this guy seemed more like a dog¡­Oh! Let¡¯s give it the name Dogoo! Since it¡¯s like a ¡®Dog¡¯, but also ¡®Goo¡¯, ya get what I¡¯m saying? N-No? Okay¡­Although, it had cat ears¡­ Somehow this reminded him of a certain JRPG he used to play¡­Something starring a certain Nep¡­ Anyhow, one guy wasn¡¯t enough! There were 13 levers in this place, so she continued on and created 12 more! Her own slime army was being amassed, and soon, she would take over the world! Mwahaha~! Placing her control on each slime, she tried to move them. ¡®Tried¡¯, since she realised that precisely controlling 13 slimes at the same time was a stupid idea and ended up rolling across the ground while holding her head! So, she controlled the slimes one by one, and led them towards each lever that existed on this damn puzzle labyrinth. Once they got there, she made them jump on the levers, since, slimes didn¡¯t really have any physical prowess. Instead, what she did, was to tilt their bodies in one direction to flick the lever, and it was a grand success! So, with that set up, she continued on with a renewed vigour, pushing on until she finally reached the final lock!! 4 hours later, and she slumped onto the stone floor. For now, she¡¯s done! Controlling 13 slimes one after the other was much more tiring than she thought! By the end of it all, she managed to reach the 12th lock! But in return, her brain felt like it would crack open at any moment! Seriously! Even her 40 hours gaming marathon didn¡¯t leave her this weak! Was this just how the skill is normally, or was it just her being weak? Probably the latter. ¡°Hey!¡±Unauthorized reproduction: this story has been taken without approval. Report sightings. Moving on, it looked like Slimey had finally left the 1st trial, and was now heading for the 2nd one. Honestly, she was terrified. How was that little guy going to survive against that sword wielding demon?! It would get squashed instantly! Ah, but physical attacks don¡¯t deal any damage to slimes. So, Slimey¡¯s invincible then? Wait, no. That demon also had magic, so¡­Crap. On the topic of slimes, her [Slime Army] skill reached Level 2! Hooray for progress! The new level didn¡¯t really increase much, but control over the slimes seemed to be smoother than before. So, now that she had gotten this far, let¡¯s take a break for a moment. Since she was bored, she decided to play with her bubble magic until she fell asleep. [Congratulations! [Bubble Magic] is now Level 5!] ¡°Oh, shut up.¡± -Another 4 hours later- *Click¡­Clack!* ¡°Gah! Damnit!¡± Slamming her fist against the wall, she softly cursed as she heard the second click. Damnit! She had gotten so close! She was now on the 23rd lock! 2 more to go, and she would be out of here! ¡°Alright, one more time!!¡± Once again, she repeated the process, flicking each lever with the help of her Dogoos. Sounds of clicking gears echoed through the rooms. Finally, she reached the 23rd lock, and was now back! Now, 11th lock, 7th, or 9th lock? ¡°Hmmmmm¡­¡± Damnit. She forgot which one she flicked earlier! Did she flick the 11th one before? Or was it the 7th? Muuu¡­Alright, Yolo! 11th lever it is! *¡­¡­* ¡°Come on¡­What¡¯s with this suspense?!¡± *¡­¡­Click!* ¡°YEESS!!!¡± F*ck yes! She did it! 24th lock achieved! Just one more lever left to go! Now¡­9th, or 7th? Why was this so tense?! Umm¡­Ummm¡­Let¡¯s go with seven-, no! 9th! Please don¡¯t let her regret this later!! *¡­¡­¡­¡­¡­¡­¡­¡­¡­* ¡°Come on, come on-¡° *Click!* ¡°Ye-¡° *Clack!* ¡°¡­¡­¡­¡­¡± ¡­¡­Well, guess the 7th lever is the last one, huh. Well, let¡¯s restart this! No need to feel down now! Several more lever flicks later¡­ *¡­¡­Click!* ¡°YEEEESSS!!!!¡± Not bothering to contain herself, she shouted happily as she hopped along, enjoying the fulfilment of finally being one of the few who were able to fully complete this ¡®F*ck you~!¡¯ trial! *Vrrruuuuu* Now that the trial was finished, the door at the far north end of the labyrinth fell open, leading to the last trial, hopefully. Wait, does that mean that a boss battle was coming up soon?! Was she even prepared?! Well, that could wait. After she gathered her Dogoo army, she headed for the door, and just like she expected, the door blocking the path had disappeared! Now, onto the last trail!! Although, where was her experience? She was already heading through this dark tunnel, shouldn¡¯t her trial be finished already? No¡­I-It¡¯s couldn¡¯t be¡­right? This trial was definitely over, right?! ¡°No¡­¡± Straight out of her nightmares, her eyes fell upon the wall before her. A row of 10 buttons stood before her, with a single iron door standing in between them all, blocking the way to the last trail. Taking a deep breath, she stepped forward, and- ¡°ANOTHER ONE?! WHAT THE F*CK?! WHY ISN¡¯T IT OVER YET?!¡± Did this dungeon have a grudge against her or something?! Why was this dungeon being such a b*tch to her?! Sorry for all those cheap wins, okay?! She¡¯s sorry! And so, her frustration continued to build as she tried to complete this new button combination! ¡­¡­¡­¡­¡­ ¡°Hah¡­hah¡­I-I can¡¯t do this¡­¡± She¡¯s done for now. It had been around 3 hours since she first began this trail, and nothing! There wasn¡¯t even a *Click!* sound to indicate her progress! She was starving! Please spare her some food! ¡°Hah¡­¡± Sighing to herself, she leaned against the iron door. At that moment, the door behind her moved, and she fell! ¡°Ouch?!¡± Turning aside, she rubbed her back as she-¡­wait, did the door just open on its own? ¡°¡­¡­¡± ¡­Seriously? The door didn¡¯t need to be opened? It was already opened all along?! Then what was that row of buttons for?! Decoration?! Actually, yeah. Those buttons were actually just decorations. ¡°F*ck this. Come on, Dogoos, let¡¯s go.¡± *Boink!* Not even bothering to care, she stood up and walked into the tunnel, closely followed by her army of slimes. Their figures slowly merged into the darkness. [The 4th trial of the Crystal Caves has been cleared! 500 Experience Gained] [Congratulations! Slime Maestro has levelled up to Level 6! Your stats have improved] [Congratulations! Slime Maestro has levelled up to Level 7! Your stats have improved] Meanwhile, with Slimey! *Boink!* 3rd trial had been completed! Squeezing through the small gap, Slimey popped onto the other side. Well, no time to waste now! Slimey needed to get back to master! And so, hopping across the stone floor, Slimey made its way towards Diana, who had just made it into the last room! ¡°Woah¡­This looks rad.¡± Well, this room looks great! A large cavern, around 4 metres in length and 5 metres wide. Many blue crystals growing off the rocks. Purple runic lines running across the walls, stretching throughout the entire room. Yeah, this sure is the last room alright! And then, with an explosion of magic, a ball of light appeared before her, shining with a beautiful myriad of colours, the light merging together. ¡°Young adventurer, congratulations on-¡° ¡°Holy sh*t! It speaks English!¡± ¡°¡­On reaching the last trial. Now, you must face the greatest trial of all. Prove your worth, and you shall claim the price. Good Luck.¡± With the end of the speech, a surge of magical energy began to gather in the centre of the cavern. Large tremors pulsed through the earth, shaking the world below. Cold sweat formed on her back, as she witnessed the birth of her last trial. This was it! Time for the last boss! *Poof* ¡°¡­¡­Eh?¡± ¡­What the? The magic that was gathering just disappeared suddenly! What the hell happened?! ¡°¡­Forgive us for the difficulties. I shall return shortly.¡± -Within the dark void- ¡°Vade! Why did you refuse to come?!¡± Floating within the dark void, the large sword floated aimlessly. The runes that ran across its blade only glowed dimly, lacking any energy. ¡°Hah¡­Sorry. But I¡¯m not going there.¡± ¡°What do you mean?! That adventurer had come all the way here, and you refuse her enthusiasm?!¡± ¡°You don¡¯t understand! That girl is a monster!¡± ¡°Stop complaining and do your job! Do you think I¡¯ll allow you to do as you please?!¡± ¡°Her powers are monstrous! I felt like my soul was being dragged out from within me!¡± ¡°¡­Dark magic?¡­Interesting.¡± How the hell did it come to that conclusion? That aside, the orb of light returned before her, and explained the ¡®circumstances¡¯. ¡°Forgive us for the delay. This is what you shall battle. Good luck.¡± The orb of light faded away into the air, as a huge amount of pink slime rose from the stone. Merging together, the giant pink slime from the 1st trial appeared once again! But there was no tension in the air. ¡°H-Hey~, that tickles~!¡± ¡°¡­¡­¡± What the hell was it doing?! Why was the slime cuddling against her?! The orb¡¯s soul was thrown into chaos as it watched the scene that played out before it. Did this girl use dark magic on it too? But there was no sign so magic? Was that just how skilled she was? How the hell did it arrive at that conclusion? After Diana separated from the giant slime, she let her own Dogoos have fun with the giant slime, hopping across the ground while playing chase. Obviously, the giant pink slime was losing the chase. ¡°A-Astounding¡­¡± From the void, the orb watched in astonishment as the slimes continued to play, not even minding the fact that this was supposed to be the last damn trial! Why the hell were they playing chase anyways?! The orb played the straight man and sighed into the void, simply accepting the fact that this girl before it was too strong for them to handle. Although her abilities were absolute sh*t, the tenacity she had within her was terrifying, so much so that she withstood all the challenges before her. But, the fact still remained. She needed to have a trial! No way in hell was it going to let her claim victory just by being in this room! Its prided ancestors would stare at it with shame! ¡®But what kind of trail would suit her? Her prowess with dark magic seems to be beyond my control, and her tenacity crushed our traps and mazes with ease¡­If so, what challenge would stand against her?¡¯ Was what the orb had going through its head. A simple battle would not suffice, and a normal challenge would not strike her down. Something else needed to be displayed! Something more¡­unique. After thinking about it, the orb reappeared before her once again. ¡°So, young adventurer, are you ready?¡± ¡°Hell yeah~!¡± ¡°Then-¡° A surge of magical energy began to gather around her, swirling and spinning around her. A rainbow of light shone in all directions! ¡°Good luck.¡± And out of the light, came a grand serving of¡­food. ¡°¡­¡­Eh?¡± Time for the final trial! A trial to¡­eat food. Eh? [14] A Great Buffet! Eh? What was all this?! Why was there a mountain of food around her?! Why was there so much?! She couldn¡¯t even see the end of it all! And why was there a hamburger there?! Wait, this was the final trial! Not a rest area! How was she even going to eat all this?! She¡¯s not some shounen character who had a universe of space within their stomachs! I¡¯m looking at you, Luffy. ¡°Umm¡­So I just¡­eat?¡± Slowly, she picked up a hamburger from within the pile, and bit! *Chomp!* ¡°Mmm¡­Is this beef? This doesn¡¯t taste tha-, Bue?!¡± Before she could even swallow the food, her entire body jerked as a foreign energy entered her. In the shock, she dropped the half eaten hamburger, dropping it coldly onto the stone floor below her. ¡°W-What kind o-of hamburger w-was t-that¡­? T-That was h-horrible¡­a-agh¡­¡± Lying down, she curled up into a ball and held her stomach in pain, softly whimpering as she withheld the pain in her stomach. Whatever had just entered her, it was not kind! Still, what the hell was her objective again?! All she was given was a mountain of food and that was it! At least give her some kind of sign or something! She couldn¡¯t just sit here and chomp through this endless supply of food!! After about 3 minutes of writhing in pain, she stood up and picked out a hotdog. Eh? Did the sausage just glow blue? Were her eyes playing tricks on her? Well, ahn~. *Chomp!* ¡°Guhue?!¡± Once again, another internal attack occurred, causing her to lie down again. Was this how it would go?! Was the orb thingy taking pleasure seeing her get damaged like this?! Was all the food like this?! Give her some answers damnittt!! But she would not back down! Not until the end!! -3 Glowing Hamburgers later- ¡°Uuu¡­M-My stomach¡­A-Ah¡­¡± A-Ah, why was this happening to her? All she wanted was a good fight for the last trial, but this was what she got?! Was this dungeon laughing at her?! Was it trying to tempt her with her hunger?! Her stomach wasn¡¯t even getting filled! Even though she shoved in about a whole day¡¯s worth of hamburgers, her stomach still felt empty!! Where was all the meat going?! But then, out of the shadows of the surrounding food, a hero arises~! *Boink!* ¡°S-Slimey!¡± Yes, Slimey has arrived to save the day! In delight, Slimey hopped up to Diana and jumped onto her head, calmly resting on its master¡¯s head. Ah, its asleep already¡­¡­¡­Might as well join! And so, surrounded by a mountain of food, the two slept peacefully. -3 hours later- ¡°A-Agh¡­¡± Once again, Diana was lying on the ground, clutching her stomach as the oddly hot pizza slice she ate went to work on her stomach. Seriously, just how long would this take?! She was getting nowhere! The situation looked dire, hopeless even! She had a huge pile of food she needed to finish before she starved to death! What¡¯s with the insane failure penalty?! She couldn¡¯t even logout!! Damn you, Kayaba! *Boink!* By her side, Slimey was watching anxiously. It had never seen its master like this, and even if it wanted to help, it couldn¡¯t! No! It needed to help her! Slimey couldn¡¯t let its master do all the hard work! There must be a way! Slimey cautiously approached a cake slice, and ingested it! I say ingested, but all it did was put the cake slice into itself. Wait, slimes don¡¯t even have to eat! Abort plan! But then, something magical happened! *Voom~* A low humming sound began to play from Slimey, as the cake slice floating within it began to glow! What was this incredible concoction?! Was Slimey about to evolve or something?! The light from the cake slowly faded away, and Slimey quickly popped it out. Ah, the cream went everywhere. Hey, maybe this cake slice wouldn¡¯t be that mean to her! Might as well try it! ¡°Ahmp.¡± 5 seconds¡­nothing. 10 seconds¡­nothing? Eh? Where¡¯s the pain? C-Could it be? The cake wasn¡¯t a lie after all?! Amazing! A food that was actually food! What does that even mean?! Who knows! Taking out a cookie she found within the pile, she gave it over to Slimey. Once again, the same occurrence happened, and the magic that was once in the cookie was completely devoured by Slimey! And taking a bite, no pain could be felt! Victory! She had found a way to finish this trial! Hell Yeah! Ah, but she still had the mountain of food to eat through¡­Was she even capable of eating this much? This would probably take her a couple months of eating to finish! And she would become fat! That would suck! A couple minutes later, she ate one more hamburger and sat down. A~, she¡¯s full now~. Eating through all this would take a while¡­ -Several days later- And days seemed to fly by as she went through her days sifting and eating through the pile of food supplies she had at her disposal. Of course, if she stayed dormant and ate all day, she would get fat, no doubt. So, she decided to take a daily jog too! Oh! Would 100 push-ups, 100 sit-ups, 100 squats, and 10 Km jogs grant her superhuman strength?! Would she be able to shout *One Puuaaaanncchhh!!* After all that?! But let¡¯s put that aside for now! Something terrible just happened! [The title [Friend of The Dryad] has been lost. -1 [Wisdom] and [Longevity]]Love what you''re reading? Discover and support the author on the platform they originally published on. This was terrible! Not only did she lose a title, she also lost some stat points! How did this happen?! Did the dryad die or something?! She hadn¡¯t even found the dryad yet! *Boink, boink!* ¡°Huh? What is it?¡± Walking up to Slimey, who was hopping up and down rather excitedly, Diana examined the interesting item Slimey found within the pile of food. Eh? A small green seed? Why was this here? Did that orb get this mixed up? Well, let¡¯s keep it! Shrugging her shoulders, she put the seed into the one pocket she had on her pants. With that done, let¡¯s have lunch! -Several more days later- This was getting annoying. Really, annoying. Seriously! How much food was in this pile?! It¡¯d been about a week, and she couldn¡¯t even see a slight change! How was she going to finish this?! Even Slimey was getting fat from all the magic it was consuming! She couldn¡¯t just force Slimey to do her bidding at all times! Besides that, nothing much had happened really. Her stats hadn¡¯t changed all that much, no new monsters had appeared, and the orb thingy seemed to have gone silent. It was starting to get pretty lonely actually. But Slimey¡¯s here, so no need to fret! By now, it was about noon, and Diana was spending her time sitting still, focusing to her utmost potential as she continued to train her [Internal Mana Manipulation] skill. It¡¯s been a while since she last trained this skill, so why not, right? Still, this was hard~! It had been about 4 days of training, and nothing! Well, she might be a bit impatient, but levelling this skill up was insanely hard! Not having someone to guide her wasn¡¯t helping either!! -2 weeks later- ¡­This was endless. How much longer would this take? Two months? Six? A whole year? Two years? Would she even be able to get out of here? She couldn¡¯t do this for much longer!! She needed a faster way! But how?! She couldn¡¯t just vacuum all the food here into her mouth! She would die! That was when, an amazing idea struck her mind! An idea that the orb would surely not have thought of! Now Slimey, go~! *Boink!* While waiting for Slimey to return with the results, Diana sat down and began to train her [Internal Mana Manipulation] skill once more. Since that ended with a failure, she ended up spending her time playing with her [Bubble Magic] instead. *Boink!* And Slimey had returned! But it wasn¡¯t alone! Behind the green blob, was a giant group of cave rats, bats, and other cave monsters Slimey could find hiding within the cavern walls. Under Diana¡¯s command, Slimey brought them all here. ¡°Chuu?¡± One of the rats stepped up and looked at the huge pile of food, a daunting wall standing before its small self. She took out a chicken wing and gave it to the rat. Timidly, it went up to the chicken wing, sniffed it a bit, and bit. *Nom* ¡°Chuu!¡± With a warm smile, Diana petted the small little rat as it chomped down on the chicken wing. Go little guy! Eat as much as you want! ¡°Come on! You guys too!¡± The other monsters understood her gesture and dived in, greedily biting down the food supply! More and more monsters began to show up, and they too dived in and took some food! Come now~! It¡¯s a banquet! In just a couple hours, the whole entire pile had disappeared! What terrific eating speed! These guys must have been really hungry¡­Well, it was a win for both sides. [[Beast Taming] has been acquired. 5 Skill Points gained] Eh? Her giving food to the poor monsters counted as taming? How? That was just her being kind! And that wasn¡¯t even her own food! But, she wasn¡¯t complaining! A skill or two was always accepted! Unknown to her, the orb was tearing its hair out from the frustration, figuratively of course! The orb had prepared this with an open mind, but this?! Where did those monsters come from anyways?! Wasn¡¯t Crawler taking charge over these guys?! ¡°This girl¡­She¡¯s too strong¡­¡± With that in mind, the orb reappeared before Diana, and spoke. ¡°Congratulations young adventurer. Now, only one last trial lies before-¡° ¡°THERE¡¯S ANOTHER ONE?!¡± ¡°¡­Before you. I wish you luck.¡± Before she could speak any further, darkness descended upon her. The lights from the blue crystals seemed to dim into the shadows. A chilling atmosphere took over the entire cavern, as if a whole bucket of ice cubes had been thrown in for good measure. Oi, this wasn¡¯t funny. What¡¯s with this chilling feeling creeping up her back? This feeling¡­Doesn¡¯t this just scream of her death? Aha~, can¡¯t be¡­right? Surely not, right? Eh? Why were the monsters backing away? E-Even Slimey? The darkness swirling and gathered before her, as a crystal began to form within the shadows. It shined an ominous black light, as if the light from the crystals failed to even reach it. ¡°U-Umm¡­¡± Uwah¡­This is bad¡­This is bad! Whatever that crystal was, it surely wasn¡¯t something good! A low hum began to fill the air, as the crystal continued to grow. Wait, was the crystal going to explode?! Would the wither appear or something?! With the best intentions, she jumped up and ran back towards the tunnel, which was blocked?! Sh*t! Plan abort! But it seems, it was too late. *BOOOOOMM!!!!* ¡°Kya?!¡± A loud explosion resounded behind her, sending her flying back towards the wall! Ouch~, that hurt! Turning around, she looked towards the crystal, and there, she saw¡­A staff. Eh? What? Where¡¯s the boss? Did it glitch out or something? The dark blue staff merely floated, with the black gem resting atop the staff. The whole room froze, as if time itself had frozen over. Slowly, the staff began to float towards her. The air seemed to vibrate as it slowly moved across the air. D-Doesn¡¯t this staff feel more menacing than that demon? She mustered her courage, and fired her [Slime Cannon], but the slime bounced away! A torrent of dark energy gathered within the crystal, violently contained within that tiny little black crystal. Sh*t, this wasn¡¯t looking good! Not at all!! And then, a beam of darkness shot out, precisely aimed, for her skull. ¡°A-Ah¡­¡± Was this the end? Even if she did cast another [Slime Cannon], what would she do then? Wouldn¡¯t she just fail again? Would she wake up in a hospital after this? Or would she ascend towards the skies, forever leaving this world? She didn¡¯t know, she didn¡¯t want to know! She shut her eyes. Time slowed to a crawl, and slowly, she opened her eyes. It was then, she realised, that she really had been saved. *Vuuuuu!* Between her and the beam, a green figure jumped up, and took the full damage! Slimey had come! In a last attempt, it casted aside its fear, and jumped towards the beam, to sacrifice itself for her! Its wish, was fully granted, as Slimey then exploded, tearing apart as the beam fully tore it apart. The green remains of Slimey shot out into the surroundings, splashing loudly against the stone floor. ¡°¡­¡­E, Eh?¡± She could only let out a stupefied voice, as she stared at her surroundings. Her eyes fell upon the remains of her green friend, scattering across the stone floor. Her eyes froze as her mind slowly caught up. It was then, she realised, That her friend, had been blown away. ¡°SLIMEY!!!¡± Her anger fully erupted. Her soul blazed. There was no fear. There was no remorse. Only anger! Slimey had died for her, she couldn¡¯t let its efforts go to waste! Gritting her teeth, she jumped and grabbed onto the staff! If she could guess, that crystal was the main danger! Taking hold of the crystal, she tried to pull it out, but to no avail. The crystal seemed to be completely glued onto the staff! ¡®B*tch! I ain¡¯t letting you take me alive!¡¯ Was what the crystal said as it began its retaliation! A dark miasma began to seep into her fingers, tainting them black. The miasma continued to spread further across her hand, slowly crawling up towards her arm. But what came out, was not a voice of fear. Instead, there was only determination! ¡°Yes! Give me more!!¡± A big ¡°?!¡± appeared above the crystal. After all, what kind of person would be excited to have their body taken over?! Now, it realised why Vade, its colleague was so afraid of her. And frankly, it was too! The darkness creeping through her skin seemed to stop. No, not just stopped, it was slowly disappearing! The crystal broke out in cold sweat as it saw its nullified. Such intense resistance! Diana herself didn¡¯t seem to realise what she was doing, and kept trying to pull the crystal off. No matter how long this would take, she would not complain! Slimey had done all it could, and now it was her turn! To go on a slight tangent, it was quite odd why she felt no sadness from Slimey¡¯s death. Was it because she had [Slime Army], which allowed her to form more slimes. Or was it simply because she assumed there was some magic capable of bringing it back to life? Alright, back at the main channel! Although the dark miasma had stopped advancing, it didn¡¯t mean that the crystal¡¯s assault had ended. In fact, it hadn¡¯t stopped at all! It was then, that it realised. This wasn¡¯t just resistance; its powers were being absorbed! In fear, it tried to break away, but Diana¡¯s grip kept it in place! ¡®This girl sure is being stubborn! Just let me go already!!¡¯ Were the thoughts that went through its mind. A minute of constant struggles passed, and the miasma on her hand had completely disappeared! The crystal was getting incredibly worried. The title [Soul Conqueror] had much more power than it initially thought! Damnit! It needed to run!! *Bakun!* Using the awkward stance she was in, the staff moved and sent an uppercut towards her chin, sending her flying back! *Bak!* Diana flew and crashed down! Using this chance, the staff turned around, and ran! ¡°Oi! Don¡¯t run away!¡± Getting back up, Diana quickly made chase. And so, the staff frantically ran around the cavern, closely followed by an enraged Diana. Why does this remind me of the second trial¡­? [15] 5th Trial Is Finally Complete!! ¡®Grr¡­Get¡­off!!¡¯ As of now, the staff was being pinned down by Diana, whose hand was placed straight onto its crystal, stubbornly trying to pull it out! What was with this girl?! ¡°Damniiittt!!!¡± Turning the staff around, she began pummelling the crystal, hammering it down in hopes of shattering the damn thing. If she couldn¡¯t break the crystal off, then let¡¯s just break it with brute force! Frantically, the staff tried to cast magic, but the constant pummelling from Diana splendidly interrupted the cast! The battle was stuck on a stalemate! ¡®Oi! Admin! Save me already!!!¡¯ The crystal called out into the void, its voice helplessly let out as the ¡®Admin¡¯ watched with dead eyes, not that it had any eyes. The scene of its patrons getting smashed and thrown around by a young girl was definitely not something it had expected to see, ever. ¡®¡­Please hold out.¡¯ ¡®What the hell?! Hey! Stop this girl already! Oi!! Listen to mee!!¡¯ The crystal¡¯s plead went unheard. ¡°HAAA!!!¡± Diana, determined to win this, moved close to the wall and began to smash the crystal onto the wall! If the floor didn¡¯t work, then let¡¯s use the wall instead! Was what she thought as she smashed the crystal into the stone. *Bak!* Oi. Why did the wall just break? This thing ain¡¯t a pickaxe! Ah, but this might lead to somewhere! A secret room perhaps?! With renewed vigour, she began to pave away at the stone wall, using the staff as a pickaxe. If only she had some bombs¡­ The crystal¡¯s cries continued to resound within the void, coming back unheard. The admin wasn¡¯t even surprised anymore. Being surprised at her antics was surprisingly tiring. Vade only watched from behind with a sympathetic look. *Bak!* *Bruk!* Not slowing down, Diana continued her assault at the wall, paving a bigger hole as time went by. Soon, the hole turned into an arch, and then a small tunnel, and so on. 5 minutes of constant physical trauma later, the end of the tunnel broke away, and light came in from the other side. To her surprise, she did find something at the other side! ¡°S-She actually found the unused trial¡­¡± The admin only said so in a low voice and turned away, not wanting to look at her for any longer. Any more, and its sanity might drop from her dark magic! ¡°Woah.¡± Within this new room, she saw a giant blue crystal, floating in the air. Doesn¡¯t this crystal look like a core or something? Oh! Maybe the dungeon core?! Alright, time to break it! ¡°Oi, oi! Don¡¯t put me in there!!¡± Not wanting to lose its life, the crystal voiced its concerns, which took her by surprise. Which, in turn, caused her to lose grip of the staff, causing it to bump against the crystal! And then, magic happened! A surge of magic shot out from the black crystal, and began to disappear into the giant blue crystal! The black crystal was being sucked away! Clapping her hands together, she said her farewells, and walked back into the tunnel. ¡°Oi! Don¡¯t leave me! Please!! I don¡¯t want to die!!¡± Without looking back, she stepped out from the tunnel and back into the cavern. A great sense of satisfaction welled up within her as she heard the voice of the crystal slowly disappear. The pleading voice of it, made her heart flutter a bit. She wasn¡¯t a sadist, okay? *Boink!* ¡°Ah, thanks.¡± Hopping over to her, Slimey dropped the apple it had been holding out, and rolled it towards her. Happily, Diana picked the apple up and took a bite. Ah~, the sweetness of this apple was al- ¡­Eh? ¡°¡­¡­¡­¡­EEEH?! S-S-Slimey?!¡± What the?! Didn¡¯t this little guy die just moments ago?! Did this guy transcend death and return back to her?! *Boink!* ¡°Eh? You didn¡¯t die? Then what happened?¡± *Boink, boink, boink!* ¡°You did get hit, but all the magic you stored until then was instead drained to protect your core. With that, you gathered the scattered slime and, that¡¯s it¡­Eh?! You can store magic?!¡± *Boink!* ¡°You just knew too? As in you just gained a skill? Eh? What¡¯re skills? Uh, I¡¯ll explain later.¡± The conversation just continued on, as if it was the most normal thing in the world. Surely, if someone sane saw this scene, they would flip their sh*t! Well, this is a fantasy world, so anything¡¯s possible. That aside, from what Slimey seemed to express, all the magic she got from the food was used up to save its ¡®Core¡¯ from the magic blast. She wasn¡¯t quite sure what a ¡®Core¡¯ was, but she didn¡¯t question it. Also, Slimey looked smaller than before, so that¡¯s that! ¡°Oi! Bastard! What the hell was that for?!¡±Royal Road is the home of this novel. Visit there to read the original and support the author. ¡°Woah, it¡¯s still alive?¡± To her surprise, the staff was somehow still alive! What a twist! Hmm? The crystal looked a lot smaller than before. Was that because it lost some of its magic? ¡°Oi! Answer me!!¡± ¡°Ah. Sorry, can you repeat that?¡± ¡°Don¡¯t play with me!!¡± Oi. She¡¯s trying to ask a serious question here. She really didn¡¯t hear what it said, and she tried asking that as politely as she could. The staff seemed pissed though¡­ ¡°Do you want to die?! I can still cast magic!¡± Oho~, was the staff trying to threaten her? With all that pleading from earlier, most of the fear factor was mostly gone. Showing the smuggest face she could have, she looked at the staff, and spoke jokingly. ¡°Ah~, do you want to go back to that crystal?¡± Although she said that mostly as a joke, the staff seemed to interpret that seriously, and backed away. The deadly words that spilled from her mouth sent shivers up its none-existent body. ¡°N-N-No ma¡¯am.¡± ¡°Huh~? I didn¡¯t hear you~¡± ¡°N-No ma¡¯am!¡± Aww~, being obedient now, isn¡¯t it? Where did all that ¡®Do you want to die?!¡¯ stuff go? This didn¡¯t even feel like a boss battle anymore! On that note, what did she need to do to finish this trial? Did she need to fully destroy this staff, or was this enough? Hmm, if it was the latter, then the completion message should already be u- [The 5th trial of the Crystal Caves has been cleared! 750 Experience Gained] [Unique completion route achieved! 250 Experience gained] [The Crystal Caves has been fully completed! 500 Experience gained] [The title [Dungeon Crawler] has been acquired! 10 Skill Points gained] [Congratulations! Slime Maestro has levelled up to Level 8! Your stats have improved] [Congratulations! Slime Maestro has levelled up to Level 9! Your stats have improved] [¡­Please spare her¡­] Now that¡¯s what she wanted! Man, look at all that Exp! That was huge!! She even jumped two levels in a row! Amazing! Ah, but what¡¯s with that last message, hmm~? ¡®Please spare her¡¯ you say? Wonder who that might be referring to~? Why does the thought of torturing this little thing bring her so much pleasure? ¡­She¡¯s really not a sadist, okay? Well then, status, open! Name: Diana Race: Human Age: 17 Class: Slime Maestro Lv: 9/10 | Exp: -/- HP: 60/66 MP: 53/60 SP: 41/60 [Strength]: 19 [Tenacity]: 16 [Agility]: 19 [Intelligence]: 18 [Dexterity]: 19 [Mentality]: 19 [Endurance]: 18 [Wisdom]: 18 [Longevity]: 4 [Skill Points]: 26 {Skills}: [Slime Valley: Lv 2/10], [Knife Mastery Lv 2/10], [Slime Magic Lv 3/10], [Assassination Lv 2/10], [Alleviation Lv 1/5], [Cooking Lv 2/10], [Internal Mana Manipulation Lv 1/10], [Bubble Magic Lv 5/10], [Slime Mend Lv 1/10], [Slime Army Lv 2/10], [Energy Burn Lv 1/10], [Danger Perception Lv 1/10], [Beast Taming Lv 1/10] {Magic}: [Slime Magic Set] {Titles}: [Slime Queen], [Conqueror of Slimes], [Soul Conqueror], [Dungeon Crawler] Huh? Something¡¯s odd. Why was she stuck at level 9? Her Exp counter seemed to have stopped functioning. Did she encounter a bug in the system? A glitch in the matrix perhaps? Blizzard, you better patch this before the fans get mad! Hmm, maybe there was still some requirements she hadn¡¯t met yet? Could it be that her skills were too low levelled? That wasn¡¯t that far of a stretch. Putting that aside for now, what should she do with this little girl? Ah, she¡¯s calling the staff a girl now, since the admin did say ¡®Please spare her¡¯, implying that the staff was female. Explanations aside, what should her punishment be? Hmm~ ¡°U-Umm¡­¡± ¡°Hmm~?¡± ¡°Eek?!¡± Uwah, she¡¯s totally scared. Did she go too far? ¡°Ufufu~, what should I do with you~?¡± ¡°Hii?!¡± Unknowingly, her own thoughts seemed to have leaked out, causing the staff to retreat further back. She didn¡¯t know what she might do, but whatever it is, she didn¡¯t want to be a part of it! Not at all!! Being honest, Diana really was getting ahead of herself. This was the final boss of this dungeon, so she should¡¯ve had much more caution. But nope! Throw that sh*t out! She¡¯s done it all, time to have fun in the extra stage! Maybe the insanity this dungeon had induced to her had caused a new door to open within her. ¡®Being dominant doesn¡¯t feel all that bad¡­¡¯ Was what she thought as she slowly approached the terrified staff, which had backed itself up against the corner. Sh*t! Oh god, what¡¯s happening to her? From the void, the admin simply watched silently, watching as Diana slowly cornered the staff, whose pleads had come back unanswered. It wanted to help, but¡­ Vade was in a similar position, watching with a sympathetic look towards a comrade in arms. Not implying that these things had eyes, but moving on. ¡°Now, where¡¯s that haughty attitude, huh?¡± ¡°I-I-I¡¯m sorry for earlier!! P-Please forgive meee!!¡± ¡°Ho, really~?¡± ¡°Y-Y-Yes ma¡¯am!¡± ¡°Hmm? Won¡¯t you just stab me in the back later? Can¡¯t I just deal with you now?¡± ¡°I-I won¡¯t! I promise!¡± Ah, why was she getting so happy at doing this? Hearing the terrified shrieks from this staff was making her heart flutter over and over. She hardly even noticed the mischievous smile she had on her own face. ¡°Just a promise isn¡¯t enough, you know~?¡± She made sure to deepen her tone there, just to further emphasize how serious she was. Of course, that was just her getting full of herself, but let¡¯s not pop her bubble just yet. ¡°I-I¡¯ll do anything!!¡± ¡°Hmm? Really? Anything?¡± ¡°Y-Yes!!¡± Okay, now she really was getting ahead of herself. This is the final boss, you know~? ¡°Shut up.¡± ¡°E-Eh?¡± Geez, what¡¯s with her? Sneering into empty space like that? Either ways, why was the staff even being submissive to her?! Diana wasn¡¯t even that strong! ¡°Oi.¡± That aside, this could not go on for any longer! The admin was extremely worried for her, but the incredible presence of Diana kept it at bay. But really though, Diana was just a little p*ssy being conceited. But, the life of its precious friend was about to be taken away, so it needed to help! Casting its fear aside, the admin warped and appeared before her. ¡°P-Please spare her, y-young adventurer¡± ¡°...Huh?¡± ¡®What does it mean ¡®Spare her¡¯? She wasn¡¯t even trying to kill it anymore! And why was it stuttering?¡¯ Was what Diana thought as she heard its voice. She titled her head in confusion, but the admin seemed to take it as a threat. ¡°I-I¡¯ll do anything, but p-please, s-spare her soul¡­¡± Is the admin her dad or something? Because it really does sound like it! Can that staff even have parents? What are these things in the first place? First world questions¡­ Now, what should she ask? Treasure? Nah, that¡¯s lame. A new skill maybe? But can the admin even give her skills? Muu, what should she pick¡­? And then, her mind moved on to the next options, weapons! Obviously, every dungeon needed to have some type of reward at the end, and a weapon wouldn¡¯t be all that bad! Ah, but let¡¯s make this reward a bit ¡®unique¡¯, shall we? ¡°Then¡­Let me take her!¡± ¡°¡­!¡± ¡°A-Admin¡­¡± She made sure to put a pause in between her words, just to further hammer in her desires. And it worked! ¡°¡­¡­I-I see.¡± ¡°O-Oi, y-you can¡¯t possibly¡­¡± ¡°Then¡­at least keep her safe.¡± ¡°Huh? O-Ou.¡± Why did that sound so dramatic? She just wanted to take this staff with her, why did it make it sound like a dramatic scene from a movie? Turning towards the staff, the admin spoke with a gentle voice. ¡°I¡¯ll see you, crystal.¡± ¡°W-Wait a damn second! You¡¯re just going to leave me?!¡± ¡°¡­Forgive me.¡± Oi, oi. Was she doing something bad here? Was she getting herself in trouble here?! ¡°Goodbye, crystal.¡± ¡°Oi! A-Admin!!¡± Slowly, the admin began to fade away, leaving behind a trail of light in its leaving. The staff called out, but it went unheard. Yeah¡­She did something bad, didn¡¯t she? And then, a surreal scene began to unfold before her! A burst of magic exploded out from the staff, enveloping the entire cavern in a purple shine. And as the light faded away, the staff was no longer there. Instead, in the same place, stood a woman. Her height was about 165 cm, which was just slight above hers. Her raven black hair flowed out behind her, reaching down onto her back. Her sharp purple eyes met hers. Ah¡­But she¡¯s naked, leaving her two melons to hang freely. ¡°¡­¡­¡± ¡°Oi, stop staring so much.¡± And that was how their relationship began! From then on, they would surely go through many different adventures, and encounter many different people. But before that, let¡¯s head through the exit first. And before that, let¡¯s get her some clothes. ¡°¡­Can you form clothes?¡± ¡°No. Give me some.¡± ¡­Well then. [16] Shes Been Left 4 Dead! ¡°Ah~, what a beautiful day it is¡­¡± A beautiful day had arrived! The golden sun shone high above, together with the fluffy clouds. A canvas of blue stretched out into the beyond. The soft passage of the wind moved through the morning. Standing there, Diana muttered so, enjoying the warmth she had missed. A blissful smile could be seen on her face, enjoying the wonderful weather. ¡°What the hell are you saying, dumbass?¡± And just besides her, Crystal said so, clearly not enjoying Diana¡¯s attitude. Look around first, damnit! *Crackle, crackle* *Graaaa* Surrounding them, a group of undead zombies and living skeletons stood. Ah, I guess she was Left 4 Dead then! Wait, that game didn¡¯t have skeletons, did it? Going back a bit, after Diana had secured Crystal some casual clothing, they readied themselves and headed for the exit! Ah, but where was the exit? No new tunnels had opened up here, and she didn¡¯t have an escape rope with her¡­ She also considered using Crystal to pave her own way out, but that¡¯ll probably damage her mental health even more. She tried asking Crystal several times, but she only laughed at her confusion. She received a beautiful [Slime Cannon] straight after. Finally, just before her impatience overtook her senses, a magic circle drew itself in the centre of the cavern. Together with Crystal, they stepped onto the magic circle, and disappeared. Moments later, they arrived on the surface. From the happiness, she dropped down onto the purple grass and rolled around, gleefully enjoying the feelings she had missed. ¡°Stop acting like a kid and get up, you sh*t head.¡± Was the response Crystal gave, but it was splendidly igno- ¡­Wait, purple grass? Standing up, she looked down to see that the grass, that thing that she had been stepping on, was purple! Eh?! And there was a thin fog floating above the ground! How did she miss this before?! And more than that, all the trees were dead! The trees had no leaves growing, and the wood had withered away! Didn¡¯t she enter from that huge tree?! C-Could it be?! Did the tree wilt and die?! Did centuries fly by without her noticing it?! Was the world dead and desolate now?! Did she get sucked into Fallout without he knowing?! No! Keep positive! Get positive thoughts! Yeah, this might just be a different place! Maybe the teleportation circle messed up and sent her to a different location! It happens sometimes! But then, out of the shadows, a group of undead appeared! Gross rotting zombies and living skeletons! Yikes! This really was Fallout! And so, that brings us back here, with Diana and Crystal surrounded by a horde of undead monsters. It seems a battle was inevitable! Oh, there¡¯s Slimey here too, but he won¡¯t be fighting anytime soon, so, yeah. ¡°[Slime Cannon]!¡± First attack! A sphere of slime shot out and crashed into one of the skeletons, knocking its skull straight off its flimsy neck. Instant kill! ¡­Or not. Realising that its head had been blown off, the headless skeleton rushed forward and attacked her! Luckily, she managed to slip under the skeleton and survive! Ah, but all the undead are looking at her now. ¡°[Slime Cannon]!¡± Another ball was shot out, colliding with the belly of an unsuspecting zombie. The rotting guy staggered a bit, but came back better than ever. This time, all the zombies roared in unison, and began to chase her! Crap!! ¡°Oi! Help me here!!¡± ¡°Help yourself, b*tch.¡± To her call, Crystal merely replied with a casual tone, not even bothering to look at her. Obviously, she was still displeased for what she did! Recruiting a comrade wasn¡¯t as easy as going to a tavern and throwing out some money, okay?! Without looking back, she ran into the dead woods, closely followed by a horde of living corpses. 20 minutes later, she returned, still being followed by the zombie horde! Just, with less stamina than before! Yay~! What a great start to the day! Oi. Why were the skeletons staying dormant? At least give chase too! Hey! Don¡¯t look at her with pity! She didn¡¯t need any pity from living skeletons! ¡°Grraaaa!!¡± ¡°Hii?!¡± And the noises they make!! Agh, its disgusting! If only they were weak to sunlight!! Damnit! She needed a weapon! If not, she¡¯ll be joining the undead side sooner or later! But in a moments glance, she found her weapon! ¡°[Slime Cannon]!¡± She shot out another sphere, one that smashed through the chest of a skeleton. Parts of its skeletal system flung out into the air, scattering across the purple grass-, eh?! It wasn¡¯t dead yet?! How do you kill these things?! But she had a weapon now! It¡¯s a bone!! Didn¡¯t know which bone this is, and where it came from, but it was blunt, slightly bulky, and the perfect blunt weapon to survive the Dead Rising!If you spot this narrative on Amazon, know that it has been stolen. Report the violation. *Whack!* ¡°¡­Gra?¡± ¡­Oi, did she even do any damage to this thing? She squarely slapped it in the face with her bone, but didn¡¯t it look fine? Oi, oi! Did its eye just glint red?! ¡°GRAAAA!!!¡± ¡®H-Hiii!!!¡± Somehow feeling humility from getting slapped in the face, the zombie roared together with his undead comrades, including his skeleton friends, and charged at her. The zombie horde was moving once more! ¡°H-Hyaaa!!!¡± With as much energy as she could put in, she turned the other way, and ran!! Run as fast as the wind! Run so fast that even Sonic can¡¯t even reach!! RUUUNN- ¡°Ah?¡± Ara, she slipped, and fell, into a ditch. Oi!! Why was there even a ditch here?! How did she even miss this thing?! Damn stupid fog, messing with her sense of vision. ¡°GRAAAA!!¡± *Crackle, crackle!* Sh*t, they even followed her here! Was she going to die here?! In a ditch?! Not even a noble death?! Damnit! She didn¡¯t want to end up like Kazuma and get laughed at! So, with her tail in between her legs, she turned around and ran! Of course, the undead legion quickly gave pursuit and ran, but since it was getting quite tight, the undead assembled themselves and formed into a line. After that, they ran at her! F*ck! They even have intelligence! She was definitely minced meat!! But then, a call came from her close resident green blob, saying something like ¡®Queen! Please use your slime to capture your enemies! With the area you are in, they would all get captured if you fill in the entire area!¡¯ Clearly, Slimey here was the MVP! ¡°Y-Yes!¡± Her MP wasn¡¯t full, but she should have enough to fill in this whole ditch! The end of the ditch was right before her, so it was now or never!! ¡°Uh, uh, [S-Slime Wave]!!¡± *Byuurr!!!* After chanting the name, which she thought up on the spot, a large amount of sticky slime exploded out, filling the ditch with a dense slime! Get suffocated! Wait, they¡¯re already dead, so suffocating wouldn¡¯t work, would it? Either ways, plan success! All the zombies and skeletons were now trapped within her slime ditch! Haha! Take that, you blockheads! Climbing out of the ditch, she turned around and viewed the spectacle she had created. A ditch filled with sticky slimes, annoyed zombies, and plain-faced skeletons. Ah~, what a masterpiece she had created! ¡°Time to end this!¡± Walking up to one of the zombies, she lowered the slime enough for its head to pop up, and began whacking it with her bone. *Bak, bak, bak, bak, bak, bak* The same sound resounded in the dead forest for about 20 minutes, until finally, the zombie died! [Enemy has been slain! ¨C Experience gained] Oi, oi! Not even Exp?! Was this whole ordeal worthless in the grand scheme?! Wait, the zombies might drop carrot and potatoes if she was lucky¡­Oh well, why not? If only she knew, that this would take her about half of the entire day, to finish. ¡­¡­¡­¡­¡­¡­ *Bak¡­bak¡­bak¡­¡­bak¡­bak¡­bak!¡­* [Enemy has been slain! ¨C Experience gained] By the time she was done, the sun had said goodnight and went to sleep, switching its position with the twin moons, now floating high in the sky, accompanied by a sea of twinkling stars. ¡°¡­¡­¡­¡­¡± Her eyes showed no life within. Her expression was blank, as if they were all thrown away. The bone she had been holding was cracked and broken in many places. Surprisingly, her clothes were still pretty clean, but she didn¡¯t care. She¡¯s done now, so please end her already, okay~? Here, she killed about 35 undead monsters, with a weapon that hardly dealt any damage. She wasted about 12 hours doing this, and in return, she got no Exp back. Her dead expression wasn¡¯t too much out of the ordinary, was it? Walking with unsteady steps, she got back to where Slimey was. Crystal had gone to sleep already, resting her back against a wilted tree. Oh, how peaceful she looked. Wonder what her expression would be if she shot a [Slime Cannon] at her now¡­? ¡°Haha¡­ha¡­¡± Ah, she was beginning to lose it. Let¡¯s, just get to sleep already. Anymore, and her mind might just break completely. So let¡¯s sleep, yeah? But of course, that slog wasn¡¯t without its rewards! She did receive a new skill, but her tired mind paid it no mind. [Polearm Mastery] Lv 3/10 You have gained a mastery over polearms. +10 [Strength] and [Agility] while wielding a polearm. Has a slight chance to inflict stun towards the enemy. See? She did that for so long that it even got to level 3. That was even above her [Knife Mastery] skill! ¡°Sle¡­ep¡­¡± ¡­¡­¡­¡­¡­ ¡°Oi. Wake up, dumbass. It¡¯s morning.¡± ¡°Muu¡­?¡± ¡°Wake up, do you want me to hit you?¡± Ah, what dangerous words they were~. Did she want to die or something? Because if she did, she would happily grant it. ¡°S-Sli¡­¡± ¡°Sli? Who¡¯s that? Your imaginary frie-¡° ¡°[Slime Cannon]!¡± ¡°Gofuh?!¡± A [Slime Cannon] perfectly hit her belly, sending her flying up into the air. She gracefully landed several seconds later, her face plunged into the earth. Ah~, what a beautiful start to a new day! ¡°G-Gah¡­¡± Oi, Crystal. Why did that even hurt? That was just a [Slime Cannon] from a fledgling mage who couldn¡¯t even finish the trials on her own, you know? Shouldn¡¯t you be more embarrassed? ¡°Shut up, bastard.¡± ¡°W-Who are you even talking to¡­?¡± Yeah, Diana¡¯s being weird today. Speaking into empty space and all that. Maybe she did break from the previous experience. Hmm~ Ahem, anyways, it was a bright morning once more. The golden sun was back, waving hello at the awake Diana, and she too happily waved back with a bright smile. Crystal only watched with a confused, and slightly scared expression. ¡®Was this girl talking with someone I can¡¯t see?¡¯, ¡®S-She¡¯s completely ruthless¡¯, ¡®Can she speak with nature itself?¡¯, ¡®How did I get myself mixed up with this girl?¡¯, ¡®Doesn¡¯t she hate me? Why isn¡¯t she hitting me?...Eh?¡¯ These thoughts naturally cropped up when she watched the surreal scene. Of course, please do throw that last thought into the trash bin and clear it, it¡¯s not needed here. ¡°Now then, what to do¡­¡± With that undead horde finished, what to do? She¡¯s back on the surface now. Her companion won¡¯t even listen to her. Slimey¡¯s just being Slimey. And the day had already started. What should she do now? Ah. But first, there was something she needed to confirm. ¡°Crystal. Do you want to follow me?¡± ¡°Asking now? Really? Didn¡¯t you-¡° ¡°If you don¡¯t want to, you can go back.¡± W-Woah¡­A-A serious question, coming from Diana¡¯s mouth, a-actually happened?! From the sudden change of tone, Crystal was obviously shocked, and somewhat spooked from it. Who wouldn¡¯t though? ¡°¡­¡­¡± ¡°If you don¡¯t want to, I can just go with Slimey. You still can go back, right?¡± ¡°¡­¡­¡­¡­¡­Hah¡­Fine, where¡¯re we going?¡± For some reason, Diana really wanted to cry at that moment, but she must stay strong! This was the point where her adventure would truly start, she couldn¡¯t break down now! So, taking in her tears, she pointed at the rising sun, and said, ¡°That way.¡± ¡°¡­¡­You want to go to the sun?¡± ¡°No! Of course not! I want to go east!¡± ¡°Ist?¡± ¡°Kuu¡­E-A-S-T.¡± ¡°Ah, East. She had a moment of realisation there! Although, she was quite convinced that she actually wanted to go to the sun. After all, she did point at the sun with the best serious expression she had ever seen. ¡°Come on, let¡¯s go.¡± Well, her mood¡¯s been spoiled now. With Slimey and Crystal by her side, Diana set out for her journey! ¡­¡­ ¡­¡­¡­ ¡­¡­¡­¡­ ¡­¡­¡­¡­¡­ You think its over? Nope! Not yet! ¡°Kyaha?! More zombies?!¡± *Boink, boink!* ¡°Deal with it yourse-, Kya!? D-Don¡¯t cling to my feet!!¡± ¡°G-Get away!!¡± *Boink!* ¡°G-Guu¡­D-Die!!¡± ¡°H-Hey! Where do you think you¡¯re tou~ching?!¡± As you can see, total chaos happened right after. And not even a minute has passed! The undead sure loves them, don¡¯t they? Oi. Why weren¡¯t they attacking Slimey too? At least let him experience the same pain!! In the end, they managed to survive. Crystal was staring with a tired expression, while Diana was still in shock of almost getting herself violated by an undead zombie. With a sigh, they both smiled wryly and continued their journey, where more of the undead were surely waiting for their arrival. They were, Left 4 Dead, after all. [17] Meet Sig, A Sign! ¡°Huh¡­A graveyard¡­¡± About two hours had passed by, and now Diana found herself standing before a lonely graveyard, accompanied by her ¡®trusty¡¯ companions. Just as you would expect, the graveyard, had a lot of graves! ¡°I wonder if there¡¯re any treasures inside¡­¡± ¡°Isn¡¯t that just graverobbing?¡± ¡®Shut up! I can loot stuff from graves too!¡¯ Was what she wanted to say, but after some thought, wasn¡¯t that just immoral? Isn¡¯t it kinda rude to just walk up to someone¡¯s grave and start digging, in hopes that there were treasures inside? Tomb Raiding was illegal, okay? That aside¡­It¡¯s quiet, really quiet. Well, it is a grave, so what do you expect? It¡¯s a place for placing corpses! Would be quite unpleasant to see a lively graveyard¡­ Taking a look around, the graves here¡­seemed to be actual graves, with actual people¡¯s names carved into the stones. She couldn¡¯t read them, of course. There was no Google Translate here, was there? While Diana was taking a silent stroll around the graves, Crystal and Slimey patiently waited outside. There wasn¡¯t really a reason to head in with her, so she shrugged her shoulders and watched from behind. Ah, this was really boring¡­Standing out here without anyone to talk to was really boring. She had to admit, having Diana around was quite a good way to stave off boredom, even if it wasn¡¯t the safest way around. Although¡­ ¡°¡­Where the f*ck is she?¡± Oi, wasn¡¯t she taking too long? It¡¯d been 10 minutes! That was just a graveyard! What was so interesting about a place filled with buried coffins?! ¡­¡­20 minutes. 20 minutes had passed by, and she hadn¡¯t returned yet. Where the hell was she? Actually, hadn¡¯t it been a bit too silent lately? ¡°Oi! Why the f*ck are you taking so long?!¡± ¡­Silence was what she got. Was Diana playing an ignorance game with her? She felt oddly excited-, A-Anyways, she got no reply! Did something bad happen to Diana or something? The thicker fog wasn¡¯t helping either! Well, standing here wouldn¡¯t really prove anything, so let¡¯s just head there already. But, Diana was nowhere in sight?! Where the hell did she go?! Did she exit from the wrong side or something?! Wait a second, there seemed to be something behind one of the graves¡­ ¡­Eh? ¡°¡­Diana?¡± ¡°Zzzz¡­¡± Oi. Did she fall asleep, in a graveyard? Really? Well, she is quite the ¢á, so this didn¡¯t shock her as much, but still! Really?! Was she that tired from walking?! ¡°Hah¡­What the hell¡­¡± ¡­¡­¡­¡­¡­¡­ Uwah¡­Dark, why was this place so dark? Where the hell was this?! Wasn¡¯t she just at the graveyard moments ago?! She¡¯s getting a sense of d¨¦j¨¤ vu for some odd reason¡­ Hmm? Was that a tree right there? It¡¯s huge too?! How tall was that thing?! That aside, was this a dream? That would explain why she was in such an odd place¡­Wait, but didn¡¯t that mean that she fell asleep, in a graveyard? T-That aside, was her real body okay?! She didn¡¯t get buried alive by a skeleton or something, did she?! Uwah~, this was giving her the chills from those Pok¨¦mon creepy pastas she used to read¡­ Muu, just trying to picture her body getting locked up in a coffin was terrifying enough! She needed to get out of here, but how?! This whole place was a void of all colours, with only one gigantic tree standing proudly in the centre!! Hah¡­Getting worked up was no good. Standing here wouldn¡¯t do much good either. Guess that giant tree¡¯s the best option she had now, wasn¡¯t it? Just like she had seen, this tree¡¯s huge! From straight under, she couldn¡¯t even see the tip! Wonder just how tall this tree actually was¡­Anyways, time to investigate! -About 5 minutes, or 10, actually, how much time has passed exactly?- Nothing!! There¡¯s nothing here!! Just an endless void, with one damn huge tree standing in the centre of it all! Oi! Yggdrasil, Saigyou Ayakashi, giant deku tree, answer her already!! Because she got frustrated, she ended up smashing her head against the tough bark several times, but it only ended up giving her a good headache. She also tried pinching herself, but her cheeks became swollen because of it, so let¡¯s stop that, shall we? Agh!! This was annoying!! Why can¡¯t this dream end already!! She might already be dead for all she knows! Wait, if she was dead, then was this limbo? Nonono, let¡¯s not go there yet! Think positive! Hmm¡­Actually, what would happen if she broke this huge tree apart? Would the dream end by then? Or would she violate the Yama and get sent down into the abyss? ¡°If only I-¡° -had an axe, was what she was about to say. But there, within her hands, was exactly the tool she was about to mention, a polished iron axe! How the hell did this thing even get here?! That aside, let¡¯s get on to chopping this damn tree! -30 minutes? An hour? I don¡¯t know man, time flows weirdly here- Kuh, this tree was a tough one! Her polished iron axe hardly did anything! What monstrous defence! She even used another, much sharper steel axe to try and cut it down, but nothing! Here¡¯s a list of the things she had found out: -She was able to ¡®Create¡¯ anything she wanted. Why? She wasn¡¯t too sure. -This tree was damn tough! And that¡¯s about it! It wasn¡¯t much, but being able to ¡®Create¡¯ things out of thin air was quite convenient! It was then, a giant light bulb lit up within her head!This tale has been unlawfully lifted from Royal Road. If you spot it on Amazon, please report it. She could¡¯ve just used a chainsaw this whole time! Forget about those axes, it was time for the main player to step into the ring! ¡°Chainsaw!¡± And just like that, a chainsaw appeared within her hands! Uwah, the sleek metallic body of the iron, the cold sensation of the body, not something she would ever expect to feel in a world filled with magic and slimes¡­ Not complaining though! Let¡¯s get to cutting this tree! *Vrrooomm* Yes! It¡¯s slow, but it¡¯s working!! Cut, my pretty, cuuutt!!! But, as she was slowly cutting through the tough bark, something incredible popped up! It¡¯s a sign! ¡®Hey! Stop cutting that down, you idiot! Do you want to die?!¡¯ Was the text that was written on the small wooden sign. It seemed to be written quite hastily too¡­ ¡°¡­Eh? What the hell?¡± ¡®Don¡¯t ¡®Eh?¡¯ me! Stop cutting already!¡¯ Was the next thing that was written on it-, wait, did the word just change?! How was that even possible?! ¡®How should I know? Magic?¡¯ ¡°Gah?! Y-You can read my mind!!¡± ¡®Well, duh, obviously. I am you after all!¡¯ ¡°¡­Was that a reference to Persona?¡± ¡®What? No! I was being serious!¡¯ ¡­Such was the conversation that seemed to casually play out. An exchange between an idiot and a wooden sign¡­not something I would ever expect to see. Then again, this whole story was stupid in the first place. ¡°So¡­What is this place?¡± ¡®This? To be honest, I don¡¯t really know. I guess you could call it a type of lucid dream? I mean, you can create things from thin air and talk to a sign, so this being a dream wouldn¡¯t be too off.¡¯ ¡°Huh.¡± A lucid dream, huh¡­It wasn¡¯t the most interesting of answers, but that would do. At least that means that she was still alive, right? Or was this all a lie? ¡°Say, how do I leave this place?¡± ¡®Hmm? Leave? I can¡¯t really say how, since, you know, I¡¯m you. But maybe once you wake up?¡¯ ¡°And when will I wake up?¡± ¡®¡­¡­Don¡¯t know.¡¯ ¡°Oi, what¡¯s with that pause?¡± ¡®Remember, I am you, and you are me. Anything you know, I will. But, anything you don¡¯t know, I won¡¯t know either. I¡¯m not some omnipotent encyclopaedia that will explain each and every little function this damned place has, okay?!¡¯ ¡°Okay, okay, calm down~¡± Alright, here¡¯s an updated list of the things she knew! -She was able to ¡®Create¡¯ anything she wanted. -This tree was damn tough! -Cutting that tree down would probably kill her. -This sign was her? Eh? Like, as in her other personality?! Could she perhaps switch personalities and have each personality wield different powers?! ¡®Stop getting ahead of yourself.¡¯ ¡°Geez, you¡¯re ¡®me¡¯ right? At least be more fun!¡± ¡®If I were human, I would probably cringe so much that I would die from intoxication.¡¯ ¡°That¡¯s mean!¡± Somehow I feel like I¡¯m getting forgotten in this¡­ ¡°¡±Shut up¡±¡± U-Uwah¡­ ¡°Actually, do you have a name?¡± ¡®A name, why would I need a name? I mean, I¡¯m a sign damnit!¡¯ ¡°Umu¡­¡­Hmm¡­¡­Ah! How about¡­Wait¡­uhh¡­¡± What are you doing? Just- ¡°Shut up, I¡¯m thinking.¡± U-Uuu¡­D-Diana¡¯s being a meany¡­ ¡°Muuu~¡­¡­Ah! How about Sig?!¡± ¡®Sig? Sig¡­I like it! Sounds pretty nice.¡¯ Wasn¡¯t the name ¡®Sig¡¯ from the word ¡®Sign¡¯? Didn¡¯t you just remove the- ¡°Shut up! This is MY story, so stop speaking already!!¡± F-Fine! I-It¡¯s not like I w-wanted to narrate this story or a-anything! B-Baka! ¡°Ahem, so, is there a way to end this dream?¡± ¡®Hmm¡­I can¡¯t really tell. Sorry.¡¯ ¡°Nah, it¡¯s fine, man¡­But, what should I do in the meantime?¡± ¡®¡­Why not train? Better than doing absolutely nothing, am I right?¡¯ ¡°I guess so!¡± *Gasps* I-I¡¯m finally allowed to talk again! The 4th wall was about to get destroyed!! Ahem, that aside, without any ideas as to wake herself up, it was bound to get boring! Sure, Sig¡¯s here and all, but even talking to this sign for countless hours wouldn¡¯t prove healthy. So, with Sig¡¯s suggestion, it was time to train! ¡­¡­¡­¡­¡­. By the end of it all, she was completely exhausted, both physically and mentally! Since there weren¡¯t any dangers in this void, she decided to use it to train her [Slime Valley] for once. By the time her ¡®MP¡¯ ran out, her [Slime Valley] had reached Level 3! Hell yeah~! Next on the list, was physical training! Running laps around the giant tree, doing random jumps and squats, training with a wooden pole, you know, the usual. Sadly, no boosts to her [Polearm Mastery], but hey, what can she do? And so, that brings us all the way back here, with Diana resting atop the void floor, eyes staring up at the giant tree. Ah, the exhaustion was quickly catching up¡­This was bad¡­What would happen is she fell asleep here¡­? Agh¡­She¡¯s tired¡­Sleep wouldn¡¯t be too bad¡­right¡­? ¡­¡­¡­¡­ ¡°Oi. Awake yet, idiot?¡± ¡°U-Umu¡­?¡± A-Ah? W-What the¡­? She¡¯s¡­back? She could see the bright blue skies above, and she could feel the grass brushing against her! S-She¡¯s back!! ¡°I¡¯M BACK!!!¡± ¡°W-What the?¡± Oi, that shout could¡¯ve attracted some undead monsters to her location. Shouldn¡¯t she be more careful? That aside, she was finally back out!! Although Sig¡¯s company wasn¡¯t all that bad, being trapped in that dream for what felt like an eternity wasn¡¯t how she wanted to spend her life in this fantasy world! Well, at least her time there wasn¡¯t completely useless. ¡°Calm down, dumbass. What if monsters heard that?¡± ¡°Huuh~? Look, I just fell into the void, tried killing myself, talked with a sign, and woke back up here. So shut your mouth, okay~?¡± ¡°Y-Yes ma¡¯am.¡± ¡®What the hell was she saying? The void? D-Did she just have a conversation with the minister?! A-And what was with that threat at the end? Was it getting hot around here or what?¡¯ Was what she thought of when that info dump hit the fan. ¡°¡­Ahem, so, how long has it been?¡± ¡°¡­Eh? Sorry, what did you ask, ma¡¯am?¡± ¡°¡­How long has it been?¡± ¡°O-Oh. I-It¡¯s been about 4 hours, ma¡¯am.¡± 4 hours?! She slept in this place for 4 hours?! Damn, she definitely got lucky that no monsters came! Or did Crystal take care of them all? On that note, what was with her polite speak? It¡¯s slightly disturbing¡­ *Boink!* ¡°Ah, I¡¯ve missed you~!!¡± With a wide smile, she picked Slimey up and hugged him tight. Even if it¡¯s only been 4 hours, having this little guy back to welcome her was always the best way to go! Anyways, that aside, they should probably leave now. Staying near a graveyard for too long wouldn¡¯t prove healthy to the human mind, yes? Heading for the border of this withered forest should prove to be their next objective. ¡°Now then¡­where to go¡­?¡± ¡°Un. Follow me, ma¡¯am.¡± ¡°O-Oh, okay¡­And please drop the polite talk, it¡¯s disturbing.¡± ¡°¡­¡­Eh? I was being polite?¡± Was she a bird brain or what? Hah¡­Anyways, with Crystal leading the way, Diana continued her journey towards the forest¡¯s borders. With Slimey following behind, of course! ¡­¡­¡­¡­ Well, this journey has been quite¡­boring. She hadn¡¯t met up with anything!! No zombies nor skeletons, no cool dungeons or graveyards, nothing!! Where did they all go?! Wait, shouldn¡¯t she be happy about this? They didn¡¯t encounter any troubles, there weren¡¯t any distractions, so all well and good, right? No!! This was a fantasy world!! It should be filled with wonderful things!! Was the spawn rate bugged or something?! Then again, it¡¯s only been 15 minutes, so she was just being impatient, no? ¡°Graaa¡­¡± Actually, scratch that, there¡¯s some zombies right there! They seemed to just be hanging around. [Fight] or [Run]? Hmm¡­ ¡°GRRAAA!!¡± Never mind, the zombies already noticed their presence! Well, want it or not, here they come! *Bak!* A good punch was sent to the zombie¡¯s gut! Hardly any damage was dealt! No matter, just add in an extra [Slime Cannon]! *Bam!* Although it wasn¡¯t dead yet, that one zombie was knocked out of the fight! 3 more zombies left to go! Seeing its brethren shot back, the 3 zombies became angered and rushed at Diana! But the next thing they knew, their legs were trapped within a thick coat of sticky slime! They were stuck! ¡°Uh, Crystal? Can you kill them?¡± ¡°Ha? Why should I do that?¡± ¡°¡­Fine.¡± Since Crystal was still reluctant, let¡¯s finish this on her own! With her slime, she covered the rest of the zombies¡¯ bodies, just to make sure no damage was taken. She didn¡¯t want her punching bag to fight back, did she? ¡°Graa!!!¡± ¡°Ah, forgot about you!¡± There was still one more zombie left! Clutching its stomach, the injured zombie slowly walked up to Diana, but not before a coat of slime landed on its legs, trapping its movements. In a swift motion, Diana ran, and sent a punch straight at its face! *Bak!* Critical hit! The zombie wavered slightly, but was still alive! Well, here¡¯s another punch, and another one, and it don¡¯t coming~! A wave of swift punches landed on the zombie, leaving no moment to counter! *Ora, ora, ora, ora, ora, ora, ora, ora, ora, ora!!!* [Enemy has been slain! ¨C Experience has been gained] ¡°Now then¡­¡± Slowly, she turned towards the three remaining zombies, who were, despite being dead, were sweating under the intense pressure. This girl was insane! ¡°How env-, pitiful. How pitiful.¡± *Boink?* [Enemy has been slain! ¨C Experience has been gained] [Enemy has been slain! ¨C Experience has been gained] [Enemy has been slain! ¨C Experience has been gained] And there you go! 4 zombies were down! Hell yeah! Didn¡¯t this mean that she was getting stronger now?! Haha~! This was great!! ¡°Alright, let¡¯s go!!¡± [18] Almost Out!! Once upon a time, there lived a girl. Young, kind, and generous. Polite, and caring. She loved the people, and everyone loved her back. That young girl lived a happy life. In time, she grew older, wiser, stronger. She grew to better understand this wonderful world she lived in. But, with her wisdom, she came to understand the truth. She came to understand, to peel away the mask that had hidden the truth from her blissful self. She realised, that all those happy faces she saw, all the smiles she received from them, were nothing but masks. Masks, that hid their true self under them. But she stood strong, knowing that not everyone was like this. Always, there would always be someone different¡­right? She was mistaken. Even her parents, the people she had looked up to and loved, were no different. They fought, they stole, they lied, and worst of all, they hid this all from her. Her heart broken, she ran into the forests, where she later disappeared. On that very same day, the entire forest began to wither and wilt. Rumours speak that the cries of the girl could be heard, still echoing through the withered forests. ¡°And¡­that¡¯s all?¡± ¡°Huh? Uh, yes, that¡¯s all.¡± Well then¡­That was quite¡­interesting, to say the least. Because of one girl, this entire forest withered and died, huh? Was the girl that shocked to find that out? That seemed like common sense to her though. What you just heard there was the supposed origin of this withered forest. Honestly, it sounded more like a fairy tale than an actual factual story, but this was a world ruled by magic, so perhaps someone¡¯s emotions could have such an impact! Also¡­Masks¡­Persona, anyone? Ahem, anyways, there wasn¡¯t really any significant reason as to why Crystal decided to suddenly start storytelling. Since the undead here wasn¡¯t very strong, and the border of this forest was still a day away, she decided to do so, so to not get bored. And well, that¡¯s over, and there was still quite a bit of time until they¡¯re there, so what now? And Diana¡¯s getting hungry too¡­And there wasn¡¯t anything to hunt in the first place! Eating rotten flesh wasn¡¯t healthy, alright? ¡°Hah¡­I¡¯m hungry¡­¡± ¡­¡­¡­¡­¡­¡­. Well, it¡¯s night now. They didn¡¯t have any food, so she didn¡¯t really have anything to cook, nor could she find anything edible in the first place. Her stomach was growling here and there, but she¡¯ll stay strong! As of now, the three were sitting around a small fire they managed to light, which was nice. *Boink!* ¡°Hmm?¡± Huh, Slimey seems to be quite excited about something. Well, he is normally excited about everything, so that¡¯s not saying much¡­ *Boink, boink!* ¡°Eh? You want me to teach you about skills now?¡± *Boink!* ¡°Alright then, come here.¡± With a happy feeling, Slimey hopped onto Diana¡¯s lap as she nestled closer to the fire, enjoying the warmth it gave against the cold of the night. Ah~, this was nice. ¡°So, you¡¯ve seen me turn into a slime, haven¡¯t you?¡± *Boink!* ¡°I¡¯m able to do that because of a skill, and it¡¯s called [Slime Valley].¡± *Boink?* ¡°Shouldn¡¯t the Slime Queen be able to do that normally, you say? Well, I¡¯m not too su-, wait, queen?¡± *Boink!* Q-Queen, huh¡­Did she hear that wrong? She may have the title [Slime Queen], but that¡¯s just a metaphor, r-right? She didn¡¯t want to rule over these monstrous creatures!! *Boink?* ¡°A-Ahem. A-Anyways, without my skills, I¡¯m pretty much just a normal human-¡° A human that stays cooped up inside her own house and sticks to her computer like a clingy lover. ¡°¡­Moving on, I grow stronger by gaining and raising my skills!¡± Well, levelling was also a thing, but let¡¯s save that for a rainy day. On that note, I wonder when she¡¯ll be able to get to level 10? She¡¯s been stuck like this for several days now, and it wouldn¡¯t probably change any time soon, would it? Did she do something wrong? Did she manage to somehow glitch the system out? Was such an act even possible? C-Could this be the infamous no Exp glitch?! How unlucky! ¡°Hah¡­Well, it¡¯ll be fine, won¡¯t it, Slimey?......Slimey?¡± Ara, he¡¯s already asleep? Really? Well, she couldn¡¯t blame the little guy, since they did walk for hours on end. Ah, and the fire finally died out too. Well, time to sleep! ¡­¡­¡­¡­¡­¡­. [Enemy has been slain! ¨C Experience has been gained] Another zombie down for the count! Sadly, no battle spoils, but that¡¯s fine. She¡¯s about to leave this forest anyways! As if she would miss these rotting corpses! She would much rather fight those cute bunnies than these bastards! Either ways, it was daytime now, and it was time to get moving once more! With that zombie out and disposed of, their journey towards the exit continues on! Also! They had weapons now! Since they did beat some variants earlier on in the story, they managed to loot some stuff for themselves! Diana got herself a small iron wand, which she mainly uses as a beating stick. It could also be used for magic, but she occasionally forgets about that. Crystal didn¡¯t see any worth in their loot, so she left without gaining anything new.Stolen from its original source, this story is not meant to be on Amazon; report any sightings. They also got themselves some new clothes. By ¡®New¡¯ clothes, I meant a pair of brown jeans for Diana, and a black robe for Crystal to wear. Actually, that¡¯s a lie, isn¡¯t it? Those clothes weren¡¯t ¡®New¡¯ at all! All that aside, their trip was going quite smoothly! The weather was perfect, there weren¡¯t too many monsters around, and the fog wasn¡¯t all that thick today! And after several hours of constant walking, the edge of the withered forest could finally be seen! She could finally see something green in the distance!! ¡°We¡¯re almost there!!¡± ¡°Shut up, idiot. You¡¯ll attract more monsters.¡± This was it! Just a mile or two left, and they¡¯ll finally be out of this withered forest! No more zombies, no skeletons, no more fog, and no more ditches! The end was near!! Yeah, as if that¡¯ll happen that easily, am I right? ¡°Hmm? Who¡¯s that?¡± Hmm? There seemed to be someone standing by the edge of the forest? And, it¡¯s a girl? Judging from the long black hair and soft facial features, it seems to be a she alright. Uwah, but wasn¡¯t she a bit creepy, just, standing there? Well, she wouldn¡¯t find out by standing here, would she? Oddly, even as they closed in, the girl still stayed unmoving. Oi, did she even notice their approach? Yup, she¡¯s creepy alright. ¡°Hey-¡° ¡°[Phantom Blade]¡± In almost an instant, a blade of pure darkness shot out from behind her, cleaving off the girl¡¯s left arm¡­And yet, no blood was spilled. O-Oi, the girl was even smiling¡­? Yep, that confirms it. She ain¡¯t no human, alright. ¡°GYYAAA!!!¡± ¡°Hya?!¡± U-Uwah, yep, that¡¯s definitely not a human alright! Blood red eyes, skin paler than vanilla, and no blood. And I doubt any normal human could even screech like that! Yep, nope. She¡¯s NOT going to fight that, alright?! As if she would survive in a battle against this unholy being! A-And her left arm just regenerated?! Was she a ghoul or something?! Actually, yes. That girl is a ghoul. Sadly, she didn¡¯t come from Tokyo, but I¡¯m getting side-tracked, so moving on~ Wait, what was it trying to do- *Buk!* ¡°Goho?!¡± In an instant, the ghoul closed the distance between them, and kicked her in the gut! She was sent flying back, crashing with quite the explosion of dust. Well, Diana¡¯s out for the count! Two fighters left! Actually, Slimey¡¯s useless, so that¡¯s only one fighter left. ¡°GYYAAAA!!!!¡± ¡°[Shadow Bind]¡± At her command, two shadow snakes appeared from the ground and chased the ghoul, but the ghoul was swift, easily speeding away from the two shadow snakes. With a swift chant, Crystal sent another [Phantom Blade] at the ghoul, this time cutting straight to its bare chest. The ghoul was enraged! That didn¡¯t mean much for an undead, but pain is pain! Dead or Alive, the sensation of pain will never be nice! Unless you¡¯re an M, but that¡¯s a different story entirely. With its chest wound closing up, the ghoul leapt at her, its clawed arms ready to strike! With a pair of [Phantom Blades], Crystal blocked the incoming attack, but an attack from under caught her by surprise, only barely able to dodge with a small scratch on her cheek! ¡®Fast!¡¯ Was the only thought she had as she jumped back and used her [Shadow Bind] to stop its movements. She quickly shot another [Phantom Blade], this time aimed to sever the head from the neck. However, quickly broke free from the bind, causing her [Phantom Blade] to miss and impale its shoulder! ¡°GYYYAAAAAAA!!!!!¡± Well, this gal sure was tough! Although the lesser enemies of this forest were nothing against her, but this ghoul sure was something! Its astounding speed and regenerative capabilities was quite powerful, alright! It was time to get serious! ¡°[Phantom Iron Maiden]¡± Upon her chant, the ghoul found itself trapped within a dome of darkness, with an uncountable amount of [Phantom Blades] pointed at it from all directions. Their dark edges gleamed with magic. ¡°GGYYYAAAA!!!¡± The ghoul did its best, slashing and clawing away at the incoming blades, but more came, and it was soon overwhelmed as countless [Phantom Blades] pierced through its body, cutting through its very skin. The dome collapsed, and an assured victory had been reached! ¡­Or not. ¡°¡­Seriously¡­?¡± Slowly, the body parts began to recollect themselves, and merged together back to its original state. In a matter of seconds, the ghoul had reformed itself. Truly, an undead refusing to stay dead! But oddly, a sense of disappointment could be seen on its face, as if it had hoped for that attack of hers to be enough, perhaps? But whatever its feelings might be, Crystal wasn¡¯t done yet! And it seems like someone else wants to join in! ¡°[Slime Cannon]!¡± From a distance, a speeding ball of dense slime came flying in, crashing head on with the ghoul! It wasn¡¯t powerful, not by any means, but it shocked it enough for it to stagger, which was perfect! ¡°[Slime Wave]!¡± This time, a huge wave of slime came crashing in, trapping the ghoul within! Well, even if the ghoul was stuck in there, she didn¡¯t really win, did she? I mean, ghouls don¡¯t need to breathe, since, you know, they¡¯re dead! So the battle pretty much hit a stalemate! ¡°So! How do we beat it?¡± ¡°How should I know, idiot?¡± ¡°Muu, okay¡­And stop calling me an idiot!¡± Well, what now? I mean, sooner or later, the ghoul¡¯s going to break out of its slimy prison with enough time! They couldn¡¯t just let it do that, could they? But surprisingly, the one to take action, was Slimey! *Boink, boink!* ¡°¡­Eh? You want to try talking to it? Is that even possible?¡± *Boink!* ¡°W-Well, I guess that could possibly work, but¡­Meh, why not?¡± *Boink!* With all that said, Slimey jumped straight into the slime Diana had created, and merged in! It was time to execute the plan! ¡­¡­¡­¡­¡­. Within, the ghoul kept slashing away, trying to break free from the dense slimy prison Diana had caught it in. The slime may be sticky, and movement might be quite hard, but the ghoul kept clawing away! ¡®Hey! Stop that!¡¯ But, to its surprise, the slime started talking to him! Not literally, of course, but the ghoul could hear a voice calling into its mind! ¡®¡­What?¡¯ ¡®Stop it! I won¡¯t let you hurt my Queen!¡¯ ¡®¡­Queen?¡¯ The ghoul was genuinely confused. After all, this person talking to it was clearly some sort of slime, and those people on the outside definitely do not look like slimes, not one bit. And none of them looks like a queen either! ¡®¡­Forced?¡¯ ¡®Huh? No! Of course not! I love my Queen!¡¯ ¡®¡­Lie.¡¯ ¡®Heed my words, I do not lie!¡¯ ¡®¡­Why?¡¯ ¡®Because she is kind! She loves to share, even to other monsters!¡¯ ¡®!...Lies.¡¯ ¡®Look at that lady with the dark hair!¡¯ ¡®¡­Queen?¡¯ ¡°Eh? No! That woman is merely a servant, an enemy my Queen has defeated! But look! She is alive, because my Queen has given her mercy!¡¯ ¡®¡­Slavery?¡¯ ¡®No, of course not! That woman has simply submitted to us!¡¯ ¡®¡­Impossible.¡¯ ¡®Do you not believe me? Then come out, and let me show you!¡¯ ¡­¡­¡­¡­¡­¡­¡­. ¡°Ah! It seems Slimey¡¯s done!¡± ¡°Took him long enough.¡± Hey! The slime¡¯s melting away, leaving Slimey and the ghoul behind in one piece! Slimey seemed unharmed, from the outside anyways. Well, since the ghoul¡¯s not clawing her to death, it worked, I suppose? *Boink!* ¡°Huh? The ghoul wants to talk to me?¡± *Boink!* ¡°W-Well, alright¡­¡± Well, this is unnerving. She was supposed to talk with, her? Was she going to be okay? The ghoul won¡¯t just go and eat her right away, would it? Let¡¯s hope so! ¡°Umm¡­uh, hi?¡± ¡°¡­¡± U-Uwah¡­I-It¡¯s staying silent. D-Did she do something bad to it? Was it mad at her for putting it inside that slime? And the glare it was giving her was not helping either! ¡°Uh¡­I¡¯m, uh, my name¡¯s D-Diana, and, uh, nice to¡­meet, you?¡± ¡°¡­Awkward.¡± ¡°H-Hey!¡± B-Besides that sick burn right there, the ghoul seemed to have softened, a bit. It¡¯s still glaring at her like an eagle searching for breakfast, but this was a start! ¡°Ahem, s-so, w-what do you, uh, want? You know, since you, uh, kinda attacked us, and, stuff.¡± ¡°¡­Worthy.¡± ¡°Huh? Worthy? What¡¯s worthy?¡± ¡°Human¡­worthy¡­killing.¡± ¡°Eh? Uh, what?¡± Now this was just getting confusing! What does it even want? Did it find her worthy and wanted to kill her? Nah, probably not. Diana¡¯s as worthy as an ant in the middle of the pacific ocean! ¡°Hey.¡± If so, did it find Crystal worthy to kill? I mean, that would kinda make sense, but-, agh! She didn¡¯t understand!! Her language was beyond her comprehension!! Could it be talking in code? Or Dothraki even? *Boink, boink!* ¡°O-Ou? I-Is that really true?¡± *Boink!* Now then, according to our lovely translator Slimey, the ghoul judged that we were powerful enough to kill it completely. But, alas, even Crystal¡¯s mighty attacks could not win against the ghoul¡¯s incredible regeneration capabilities¡­Wait, something doesn¡¯t seem right. Why would it want to be killed? Could it be¡­? ¡°B-But why¡­?¡± ¡°¡­Tired.¡± ¡°Huh? T-Tired of w-what?¡± ¡°¡­Living.¡± Yep, called it. By the amazing process of elimination, this ghoul must be immortal! I mean, its super powerful, can regenerate really fast, and wants to be killed! This gal totally immortal! That, or she¡¯s just way too strong and her [Longevity] stat was incredibly high. Still, immortal or not, being alive like that does kinda suck. She¡¯d seen enough movies to know what immortality can do to a person. And the results are never pretty! But what can she do? If Crystal couldn¡¯t hit the nail, then could she? I¡¯d doubt that really. ¡°D-Do you¡­hate living, so much?¡± ¡°¡­Hate.¡± ¡°R-Really¡­?¡± ¡°¡­Hate.¡± Hah, no good, huh? Her hatred for life was serious, alright. It seems, convincing her either wise won¡¯t be easy¡­Damnit, if only her Charisma skill was higher!! Just Skip This, aint Relevant No More! Well, sh*t. Seems like real life has caught up with me now~, can''t write like I used to. The time I have spare is running low, sooo...yeah. It''s time for a break! I''ll be taking a 2 week break, probably, so please do wait. I am still in middle school. Take that how you willIf you find this story on Amazon, be aware that it has been stolen. Please report the infringement. Ah! Also, I''ve wanted to say, but the upload time for this would be lenghtened again. *Yaaay*, so please be patient by the time the 2 week break finally ends. Diana also needs her rest too, since her mental health has been dropping lately, or else she might develop some mental illness or something, idk. Slimey still seems to want to go tho. Well, enough from me, see ya. [19] New Party Member Unlocked! ¡°U-Um, so¡­Do you, uh, like¡­pets¡­?¡± ¡°¡­Slaves?¡± ¡°E-Eh? N-No! Muu, okay, how about¡­uh, exploring¡­?¡± ¡°¡­Boring.¡± ¡°Kuh, okay¡­Movies maybe? Star Wars?¡± ¡°¡­Star, Wars?¡± Ah, right. There¡¯re no movies in this world, are there? Gah, what the hell! What should she say to her?! She plains up hates everything!! Continuing straight on from last chap, Diana was now trying to get on the ghoul¡¯s good side. Problem is, this gal pretty much hates living, and everything really. Hah~, what should she do now¡­? ¡°¡­Why?¡± ¡°Eh? Why? Why what?¡± *Boink!* ¡°O-Oh, why am I trying so hard? Well¡­I mean, there must be something you like¡­I guess?¡± ¡°¡­Pointless.¡± ¡°H-Hey, don¡¯t say that! Everyone has something they like, right? There must be something you like!¡± Why was this human so naggy? Couldn¡¯t she just eat her up now? After all, she was completely exposed, and her friends were all letting their guard down. Wouldn¡¯t all this annoying talk end there if she did that? But, how to say it~? This human was¡­amusing. As an undead ghoul, she had lived to see many decades fly past her eyes. She had seen many kinds of humans. Smart ones, greedy ones, yummy ones, smelly ones, and stupid ones. Diana probably would fit in well with the last one. But they all had something in common. In her presence, they would all piss their pants! And that should be normal! Under the presence of a stronger enemy, the weak shall cower in fear, and the strong shall devour the weak! That¡¯s how this world works! Was this girl just so stupid to the point where she forgot fear or something? The ghoul seriously pondered if that was the case as Diana continued to worriedly nag on her, trying to finally press the Mercy button on the bottom right of the screen! And no! The Act button was not- *Gururururu* ¡°¡­¡­¡­¡­¡± ¡°¡­¡­¡­¡­¡± ¡­¡­Hup, that was stomach. Uwah~, that was embarrassing! She almost forgot that she hadn¡¯t eaten in a while in the midst of this tense persuasion! Ooh, she could already imagine what face Crystal was making right now! She was probably smirking or something! Actually, no. She was just, plain-faced. ¡°¡­Hungry?¡± But! To her surprise, the ghoul was the first to talk! And it was about her hunger! Was that a hint on what she liked to do?! Though, should she answer yes? I mean, she is a ghoul, so she could be eating human flesh for all she knows, and she is NOT going to become a cannibal, nu-uh! *Gurururururu* ¡°¡­¡­¡­Yes.¡± ¡°¡­Follow.¡± And¡­the ghoul just turned around and left. Well, mission accomplished, I guess? The ghoul was offering some food though, and she was hungry, and she might die of starvation soon, and-, ah, whatever! She¡¯ll just see first! ¡°Oi. Seriously? You¡¯re going to follow it?¡± ¡°E-Eh? B-But I¡¯m hungry!¡± ¡°That¡¯s a ghoul, you idiot. You¡¯ll be eating dried human meat for all I care.¡± *Boink, boink!* ¡°Look! Even Slimey agrees!¡± ¡°¡­¡­Gah, fine. If you die from food poisoning, that¡¯s your own fault.¡± ¡­¡­¡­¡­¡­¡­¡­ At the ghoul¡¯s hideout (Which was literally just a cave), ¡°¡­Food?¡± ¡°¡­¡­U-Um¡­What¡­Is, this?¡± Surprisingly, the ghoul wasn¡¯t, eating, human meat? Actually, she didn¡¯t know. It didn¡¯t look like human meat on the surface anyways. But then, what meat, was this? It also smelled pretty good. ¡°Oh. It¡¯s Zombie Jerky.¡± ¡°Z-Zombie jerky?!¡± Thanks for the explanation, Crystal! Although she could¡¯ve gone without it! It might not be human meat per se, but zombies are human corpses, yes? Doesn¡¯t that mean that Zombie Jerky was also Human Jerky, just, previously rotten and harder to eat? That¡¯s the same as cannibalism! ¡°¡­Not, like?¡± ¡°H-Huh?! N-No, no! I t-totally like this stuff! Just, have s-something in my throat! Haha, ha~¡± ¡°¡­?¡± Uwah, and the ghoul was tilting her head at her too! T-This is¡­! Peer pressure! It was something she had never felt in her previous life, free from any social bonds! W-What an intense feeling! To think just a single stare from someone else could exert such a disempowering feeling! ¡­What the hell? ¡°W-Well, I-Itadakimasu¡­¡± *Om~* ¡°It¡¯s good?!¡±Stolen content warning: this content belongs on Royal Road. Report any occurrences. It tastes good?! A-And really good too! To think rotten human flesh hanged up on the wall for several days could taste this extravagant! Although, everyone else was looking at her weird. Was this common knowledge here in this world? Or were they just shocked to see that Diana actually liked it? I¡¯ll leave that up to speculation. ¡°Uwah~, that was nice.¡± ¡°¡­Also, like.¡± ¡°He~? So you like food, huh!¡± ¡°¡­Taste, good.¡± Ho~? Was this ghoul a cook before she became an undead or some-, wait¡­Wait a minute! That¡¯s it! She had just found out what this ghoul liked! ¡°Well, there you go! You like food, don¡¯t you? Then why hole yourself up here in this place?¡± ¡°¡­Where, go?¡± ¡°Where to go? Well, that¡¯s the fun of it!¡± With those words, something seemed to snap together within the ghoul¡¯s mind. She liked food, and there were many kinds of people out there! Why didn¡¯t she think of this sooner?! She could¡¯ve went out to hunt and eat even more people! ¡°N-No, don¡¯t do that please. I beg of you.¡± ¡°¡­Mind, reader?¡± Okay, maybe not just people. There were many kinds of food out there, waiting for someone to discover and eat them! Perfect for an undead gourmet like her! And humans. Many, many tasty humans. ¡°S-So? What do you think? H-How about it?¡± ¡°¡­¡­¡­Okay.¡± And just like that, the persuasion was finally over, and a new party member has been acquired! Heck yeah! Now her group¡¯s a party of 3 people! Well, 4, if you count in Slimey, but he¡¯s a slime. Then again, Crystal¡¯s a spirit weapon, Diana¡¯s a slime girl, and she¡¯s a ghoul. So there wasn¡¯t any humans on the team, was there? Nevertheless, [New Party Member Acquired!]. And now, it was time, to continue the adventure, and proceed on into the next arc of the story! ¡°Alright, let¡¯s-!¡± ¡°¡­Don¡¯t.¡± ¡­Eh? Wasn¡¯t that the exact opposite of what she said earlier? ¡°Ah, she¡¯s probably talking about the death reaper waiting for you.¡± ¡°EH?! Reaper?! What reaper?! Did he come from Overwatch?!¡± ¡°Overwatch? Uh, no? The Death Reaper is a monster that hunts anyone who dares to leave this withered forest.¡± Oi, oi! What the hell¡¯s about that treatment?! She didn¡¯t know anything about that! And how did Crystal know about that? When they were at the edge of the forest, battling against the ghoul, she sure did not see any death god waiting to slice her head off. ¡°A-And where is it¡­right now?¡± ¡°Right now? Well, right here. With us.¡± ¡­She¡¯s¡­joking, wasn¡¯t she? After all, there were no one else besides her, Slimey, Crystal, and the ghoul here, so that¡¯s just a joke¡­right? This reaper dude wasn¡¯t invisible was he? ¡°His mana spreads over the entire forest, so anywhere we are, the reaper would know.¡± ¡°O-Oh, I see¡­¡± Phew, well, at least the reaper wasn¡¯t physically here with them, so that¡¯s okay¡­Wait, no. If the reaper knows where she is wherever she goes, isn¡¯t that even worse? T-That meant, the only thing they could do to leave was¡­ ¡°To fight it, duh.¡± ¡°You heard the narrator?!¡± ¡°Narrator? What narrator?¡± Oh, she didn¡¯t know who I am, that¡¯s good. Anyways~, that¡¯s, bad, wasn¡¯t it? I mean, the guy¡¯s called the ¡®Death Reaper¡¯, so it¡¯s bound to be really really strong. And Diana¡¯s the complete 180 turn of strong. ¡°C¡­Can we, uh, beat it?¡± ¡°For now, probably not. I might be able to hold him off for some time, and you¡¯ll die faster than Sonic¡¯s running speed. I don¡¯t know about her though.¡± ¡°¡­Too, weak.¡± S-Seriously? Even these two, who were leagues after leagues above and beyond her, were still too weak to kill, or at least defeat that guy? But! That only meant one thing! What do you do when you¡¯re not skilled enough to do something? You train! And train, she shall do! Forget about the next arc of travelling through the world, it¡¯s time for a mini arc to occur! The training arc to defeat the Death Reaper boss, and claim road to leave and escape this withered forest! ¡­¡­¡­¡­¡­¡­¡­ Since then, about 6 days had gone by. And in that time¡­nothing much had happened really. All that really happened was just many continuous training sessions, done over and over again, to finally try and break through to level 10. As of now, Crystal was out hunting for some more zombies to dry and turn in jerky, while Diana was taking her time training her [Slime Valley] and [Slime Magic] together with Rei. Oh, and Slimey¡¯s out scouting the area for any interesting locations. Huh? Who¡¯s Rei? Well, since Diana was getting tired of calling her just ¡®Ghoul¡¯, she decided to give her the name Rei, who was the VA for a certain female Zombie from a certain Harem Anime about monster girls. Right now, according to Crystal, there seems to be some restrictions she needed to fulfil before she could level up. What these restrictions were, she did not know, but they were surely related to her [Slime] based skills. Her [Slime Magic] had already reached level 4, but nothing¡¯s changed. That led her to believe that it was her [Slime Valley] that needed levelling instead. And, that kinda made sense. [Slime Valley] was the first [Slime] based skill she got. Right now, her [Slime Valley] was at level 3, but she could feel it! She could feel that level up coming! Like, right now! [Congratulations! [Slime Valley] is now Level 4!] [Congratulations! Slime Maestro has levelled up to Level 10! Your stats have improved] [Slime Maestro has reached Max Level! 15 Skill Points Gained] [Class Evolution is now available] Hell to the yeah, baby! Finally, she¡¯d broken through to Level 10! Ufu~, the feeling of satisfaction welling up in her heart was nice. Made her heart feel all fuzzy. Anyways, satisfaction aside, time to look at her stats! Name: Diana Race: Human Age: 17 Class: Slime Maestro Lv: 10/10 | Exp: -/- HP: 68/68 MP: 19/61 SP: 09/62 [Strength]: 20 [Tenacity]: 17 [Agility]: 20 [Intelligence]: 19 [Dexterity]: 20 [Mentality]: 20 [Endurance]: 19 [Wisdom]: 19 [Longevity]: 4 [Skill Points]: 46 {Skills}: [Slime Valley: Lv 4/10], [Knife Mastery Lv 2/10], [Slime Magic Lv 4/10], [Assassination Lv 2/10], [Alleviation Lv 1/5], [Cooking Lv 2/10], [Internal Mana Manipulation Lv 1/10], [Bubble Magic Lv 6/10], [Slime Mend Lv 1/10], [Slime Army Lv 2/10], [Energy Burn Lv 1/10], [Danger Perception Lv 1/10], [Beast Taming Lv 1/10], [Polearm Mastery Lv 3/10] {Magic}: [Slime Magic Set] {Titles}: [Slime Queen], [Conqueror of Slimes], [Soul Conqueror], [Dungeon Crawler] [Available Classes] -[Slime Virtuoso]- -[Slime Commander]- -[Slime Gladiator]- -[Slime Mage]- ¡°Hmm~¡± Ooh! Look at all this! What a wide selection of class advancements to have! And they were all connected to her slime abilities too! From the get go, [Slime Commander] immediately falls off the list. That class was related to her [Slime Army] skill, which was something she rarely uses. [Slime Gladiator] was nice to boost her physical abilities, but she also heavily relies on her magic, so, nope. Now, it¡¯s down to the last two, [Slime Mage] and [Slime Virtuoso]! Both of these classes look tempting on their own. [Slime Mage] focuses more on her Magic side, while [Slime Virtuoso] is more of a balanced type, nudging both in physical and magical strength, but not to the extent like the other skills. She thought about it hard, so much so that steam would probably rise out from her ears if this was an anime, but after some time, she just finally decided to embrace being the all-rounder type. [Slime Virtuoso] The power of the slime dwells within you. The power of slime encompasses and swells throughout your entire existence! +5 to all attributes. Further increases proficiency with [Slime Magic] and [Slime Valley], and all [Slime] based skills gain experience faster. There is now a high chance for you to gain [Slime] based techniques. [Do you wish to proceed? Yes/No] ¡°Hell yeah!¡± [Class advancement successful] Name: Diana Race: Human Age: 17 Class: Slime Virtuoso Lv 1/25 Exp: 0/750 HP: 68/82 MP: 19/70 SP: 09/72 [Strength]: 25 [Tenacity]: 22 [Agility]: 25 [Intelligence]: 24 [Dexterity]: 25 [Mentality]: 25 [Endurance]: 24 [Wisdom]: 24 [Longevity]: 9 [Skill Points]: 46 {Skills}: [Slime Valley: Lv 4/10], [Knife Mastery Lv 2/10], [Slime Magic Lv 4/10], [Assassination Lv 2/10], [Alleviation Lv 1/5], [Cooking Lv 2/10], [Internal Mana Manipulation Lv 1/10], [Bubble Magic Lv 6/10], [Slime Mend Lv 1/10], [Slime Army Lv 2/10], [Energy Burn Lv 1/10], [Danger Perception Lv 1/10], [Beast Taming Lv 1/10], [Polearm Mastery Lv 3/10] {Magic}: [Slime Magic Set] {Titles}: [Slime Queen], [Conqueror of Slimes], [Soul Conqueror], [Dungeon Crawler] Woohoo~, now that¡¯s one hell of a stat boost! Not bad, not bad! But, damn, 750 Exp ¡®til the next level? How many cute white bunnies would she have to kill for that? She could probably have a banquet of rabbit stew with that alone! Aside from that stat boost she got, she also had some new [Skill Points] exclusives, but she was too tired to look it up. For now, she¡¯d gotten her level up, so some nice beauty sleep would be nice~ Well, good night! [20] The Challenge Catacombs! ¡°Hah¡­hah¡­hah¡­¡± ¡°¡­Diana, weak.¡± ¡°S-Shut up¡­hah¡­hah¡­¡± We interrupt in the midst of a scene, when Diana was taking a quick rest to replenish the energy she used up. There was still some time before Crystal gets home anyways, so she decided to have a spar to spice things up. Diana¡¯s entire body was tattered up, and some bruises could be seen here and there, but nothing too major. Luckily, this story wasn''t Senran Kagura, or else her clothes would have been torn apart by now~ Anyways, as you can clearly, she got her ass handed to her! She couldn¡¯t lift even finger towards her! Rei¡¯s speed at moving and her insane attacks just, pummelled her down into a puddle of slime¡­No, seriously. She used [Slime Valley], and still got her ass handed to her! So, as you can guess, Diana was naked right now, not that it bothered them all that much. And besides- ¡°Hey, I¡¯m back-¡­The hell?¡± ¡°Hah¡­O-Oh¡­Hey¡­there¡­Crystal¡­hah¡­¡± ¡°¡­Battle.¡± Crystal shrugged her shoulders and dropped the two zombie corpses she had been carrying. It was the ¡®Food¡¯ she was sent out to secure. With the ¡®Ingredients¡¯ prepared, Rei stood up and carried them deeper into the cave. I¡¯ll leave what happens inside to you. ¡°Hah¡­Hah¡­Ene¡­hah¡­¡± Ignoring Diana who was spouting nonsense as she took breathing exercises, Crystal sat down and leaned against the cave wall. It slightly reminded her of her old home back at the Crystal Caves, but that¡¯s long past now, thanks to a certain idiot. After a while, Rei finally came back, with slightly bloody hands. It was interesting to see an enemy she had fought life and death against, now acting all friendly with them after just around a week or so. Was it luck? Could it be her ¡®Soul Magic¡¯ at play there? Or, could it be fate?! She didn¡¯t know, but whatever the answer was, it was slightly irritating to have an enemy join cause and fight alongside her. *Boink, boink!* Oh, and Slimey¡¯s back too! ¡°Hey there¡­hah¡­Slimey¡­hah¡­¡± *Boink?* ¡°Yeah¡­I¡¯m¡­fine¡­¡± *Boink, boink! Boink, boink, boink!* ¡°¡­? You¡­found¡­a weird place¡­?¡± Oho~! It seems like Slimey has encountered a new place of interest! If only she had Slimey carry a Sheika Slate before he left, she could¡¯ve placed a landmark on it! Not that she had a Sheika Slate anywhere close by. *Boink, boink!* ¡°Dark¡­gloomy¡­and, zombies¡­? Isn¡¯t¡­that this¡­whole forest?¡± *Boink, boink, boink!* ¡°And¡­There¡¯s also treasure there?!¡± There¡¯s treasure too?! With renewed energy, Diana shot up from the ground and went up to confirm it. And, yep! According to Slimey¡¯s gathered intel, there were some treasures hidden in that place! ¡°¡­Catacomb.¡± ¡°Eh? Is that what it¡¯s called?¡± ¡°¡­Hidden, treasure.¡± ¡°Are they strong?!¡± ¡°¡­Powerful.¡± Ooh~, her leftover gamer instincts are tingling~! Even Rei said that it was powerful! Alright, that settles it. Their next destination, is the catacomb! ¡­Oh, but before that, she should probably put her clothes back on. Wouldn¡¯t want a zombie to assault her when she¡¯s naked and all. ¡­¡­¡­¡­¡­¡­¡­ ¡°Woah, it¡¯s huge!¡± Damn, this place was humongous. Seriously, it was about the same size as an entire football field, and this was just the entrance garden! Let¡¯s just hope that this wasn¡¯t a maze, or she would probably die from cardiac arrest¡­Ah, crap. She probably just jinxed herself. For now, here¡¯s what she knows: First off, with the already obviously large entrance, this place was incredibly big. Like, BIG big. Slimey also went in for a bit, just to confirm that it is indeed very big. And yes, it is very big. Second, this was no dungeon. From what Crystal, a previous denizen of a certain cave dungeon, the magic that surrounded this place wasn¡¯t anything like a dungeon. If any, there seems to be some kind of barrier placed deep inside. And third, there¡¯s a lot of monsters. Alright, enough exposition, time to head in! Following their Slimy tour guide, they made their way into the true catacomb through a hidden staircase that Slimey managed to find by sliming around. The interior was¡­very, disturbing. Hanged up upon the wall like some kind of trophy, were countless skulls and bones! And all of them were distinctly human bones too?! Who the hell made this place?! Well, it is called the catacomb for a reason. At first, it was a simple linear path, as they walked through a wide tunnel surrounded by rows after rows of human bones. Ugh, and the silence around this place just made it-, hey, did Rei just eat something? ¡°¡­Bones, yummy.¡± ¡°¡­¡­¡­¡­Moving on.¡± ¡­Anyways, after that linear tunnel, they were met with their first challenge! It was¡­ ¡°¡­Holy sh*t, it¡¯s another maze.¡± Yep! Just as Diana had said, their first challenge standing in between them and their treasure, was a maze! It was gloomy, lonely, and was decorated with lovely human bones and graffiti made from dried human blood! Perfect holiday destination! Thankfully, there was still some genuine lighting in this place, so they could see, but bright or not, it¡¯s still a f*cking maze. No, you know what? She¡¯s going be smart about this. She¡¯s not going to suffer through that same excruciating pain of making random choices to hopefully find the exit. Nu-uh, this time, she¡¯s going to use her brain! ¡°I choose you, Dogoo!¡± With a twinkle of mana, a trio of dogoos were created on the spot! These three will be their scouts to discover the quickest path to the exit. Ah, but they¡¯ll need codenames, so she won¡¯t get confused. ¡°Hmm¡­Ah! I got it! You¡¯ll be¡­Aika! You¡¯re Ally, and you¡¯re Suu!¡± ***Boink!*** Still, they were still made from the same palate, so she¡¯s bound to still get confused. So, to make it easier, Aika has one flower on her head, Ally has two, and Suu has three! And, bam! Her secret scout agents have been created! ¡°Now, go!¡± ***Boink!*** And with that command, her scout team heads out! Now then, since she still had a lot of free time left, and since she was bound to get bored soon enough, what should she do in the meantime? If only she still had her phone, she would be crushing candies by now. In the end, she just ended up talking to Rei about¡­stuff. It was mostly food, but she seemed to enjoy talking about food, so she didn¡¯t stop her. And it might also help her raise her cooking skill too, so she¡¯s all ears! Crystal looks at them from time to time, but she seems displeased about something. And Slimey¡¯s¡­somewhere. He¡¯s still around this area, just probably roaming around for fun or something. Crystal and Slimey aside, this was¡­interesting. Pizzas and Burgers exist in this fantasy world too? Gee, McDonalds seems to be opening their branches all over the place, aren¡¯t they? Jokes aside, that was, weird. Like, did this world have fast food restaurants? Or was the ¡®Pizza¡¯ and the ¡®Burgers¡¯ Rei mentioned not the same as the one she knew? That might be, who knows? Ah, wait a minute. Didn¡¯t the Crystal Caves last trial give her a bunch of hamburgers to eat? What¡¯s that about? On a side note, all this talk about food and stuff was making her hungry. Wonder if those Zombie Jerkies Rei ¡®prepared¡¯ earlier were done? And also-This tale has been unlawfully lifted from Royal Road. If you spot it on Amazon, please report it. *Boink!* ¡°Oh! You¡¯re back already?¡± Woah, that was fast! In like an hour or so, her three slimy scouts have returned! And it seems the one who found the exit was Suu! Good on her~! Diana softly pats her head as she wags her slimy tail. Well, with the path already found, it¡¯s time to finish this first challenge! That was, surprisingly easy. She¡¯s not complaining though! Anything that was easy, she would take! Still, that was way too quick for a challenge put in a world that had put her through life and death! It¡¯s as if, there was something waiting, and that this was still the warm-up. And, she was right! Right after they passed through the exit, the true first challenge of the catacomb has shown itself! Standing their guard upon sight, their bodies poised skilfully in style, their bones rattling across the stone floor, they were, [The Skeleton Brigade!] ¡®¡­¡­What the hell? They¡¯re all posing like JoJo¡¯s-¡¯ ¡°Oi, dumbass. Get ready, they¡¯re coming.¡± ¡°A-Ah, right!¡± [The Skeleton Brigade!] was a group consisting of five very powerful skeletons, each with their own skills and powers. They were a perfect group composition! A paladin in front, along with a martial artist, an archer, a spellcaster, and a team buffer! They could probably take on a floor boss from Aincrad like that! With their intros out and done, the brigade charges in! The team buffer casts a grand buff on the entire team, granting them a small shield to protect them and a nice boost to their attack and speed! The paladin readies his giant shield and charges in, but was intercepted by a swift attack from Rei, coming from the side! The skeletal paladin was knocked down, but before she could get another hit in, the martial artist jumped and knocked her back, giving the paladin just enough time to get back up and re-join the fight! On the other side, Crystal was battling against the archer and the spellcaster, engaging in a grand battle of magic and wits! Crystal sends a volley of [Phantom Blades], but the spellcaster quickly casts an array of giant fireballs to counter! The archer sneaks a quick arrow through the chaos, but Crystal quickly evaded. As for Diana, since the other four were already pre-occupied, she was left with the buffer. And just like a buffer, it couldn¡¯t do much in terms of offence, which made her slightly depressed. Since it couldn¡¯t attack back, the buffer ended up becoming a test dummy for her attacks. Because of that, the team buffer also became visibly sad. ¡°[Slime Cannon!]¡± With the magical boost from her iron wand, a dense ball of slime was launched at high speeds, and crashed into the skeleton¡¯s ribcage! It, didn¡¯t do much. And skeletons were pretty good at reforming themselves, so this was supposed to be no big deal, but something was different this time around! ¡°Hmm¡­I guess I can¡¯t call that [Slime Cannon] anymore, can I?¡± No, this time, it was no normal [Slime Cannon]! To the skeleton¡¯s surprise, the bones where the slime hit, started to corrode and break down! Albeit, very slowly, but it was breaking down! And that¡¯s bad! The cause, was this! [Slime: Corrosive!] Lv 1/10 A skill that allows the user to change the Slime¡¯s neutral nature to become corrosive. This can be applied to all slime-based skills and magic. Sadly, since the level is still quite low, the corrosion effect isn¡¯t very strong. But I know you can make it better, yeah? That¡¯s right! In her spare time, she had picked out the first [Skill Points] based skill! Although very slow, this allowed her slime to be corrode things it touched, just like what her slime is doing to the skeleton¡¯s ribcage! To put it to gamer speak, it¡¯s like a damage-over-time effect that deals damage, over time! It¡¯s like poison, except it¡¯s not poison, but similar! The skeleton was freaking out! Well, if your ribcage started to decompose before your eyes, I think you would do the same, but that¡¯s a morbid thought so just push that away. It tried to get the slime off, but that only resulted in it getting its skeletal hands coated in the corrosive slime, further corroding its body! Since this was going to take a while, Diana added another [Corrosive Slime Cannon], further coating it with more damaging slime. Although, watching a skeleton roll around in agony as its body slowly withers was bound to get boring. So, she sat down and decided to watch the other more grand and epic battles. ¡­Well, she was about to watch the ¡®Grand¡¯ Battle, but it looks like the battle had already ended! The skeletal paladin and martial artist were on their knees as they failed to keep up with the speeding bullet forever-regenerating incredibly strong ghoul that is Rei. Seriously, does this gal have a weakness?! *Hint* There totally is, because if not, then she would be the most OP character, ever. Meanwhile, the skeletal archer and spellcaster were trapped inside a deep black dome of countless [Phantom Blades], each ready to move and completely obliterate the two skeletons at a moment¡¯s noti-, oh, never mind, the blades just moved and they both died. Well, Rei just needed to grind the skeletons into dust, and she¡¯s pretty much the winner. Crystal had already executed her enemies. And for the skeletal buffer-, ouch. No, like, seriously. Half of it¡¯s f*cking skull is like, gone! Holy sh*t. That¡¯s, one hell of a sight. That was totally not a pun, since skeletons are undead, meaning they didn¡¯t go through heaven and-, ugh, never mind. Well, so¡­[Flawless Victory!], I suppose? She kinda felt sorry for the [Skeleton Brigade!]. They seem like a pretty hard challenge, and if she was alone, this would¡¯ve been a great boss fight. But, nope. She had overpowered team members, and all was well and good. Moving on, since the battle¡¯s over, Diana and co went through the door that just recently opened up, and advanced into the next challenge! This time, it was- ¡°W-Woah?!¡± Before they could even react, the floor below them suddenly glowed purple, and the next thing they knew, they were standing somewhere else, separated from each other! Heck, even Slimey and his fellow slimes were teleported somewhere else! So now, we shall firstly examine out main protagonist, Diana! Now, as she stood alone, this second challenge was solely on her! Without the aid of her friends and companions, she must face the threat standing before her! The beast was gargantuan. Two large horns protruded out from its head. Its body was wrapped around in blue fur, covered in magic. Its two demonic eyes glared a menacing red as it pulsed with mana. Her second challenge was, [The Great Demon Minotaur]! ¡°¡­It kinda looks like that one boss from Aincrad¡­¡± SAO reference aside, this boss wasn¡¯t messing around! The second she entered its vision, the minotaur readied its fists and charged in! But she won¡¯t lose either! She had spent the last week training with Rei, and refining her skills in battle! She wasn¡¯t fully confident in herself, but she would do the best, no matter how f*cking terrifying that thing is! I mean, it¡¯s literally a demon! She swiftly jumped aside to dodge the incoming charge, and quickly took out her wand. Sensing the slight ripple of magic, the minotaur turned around to see¡­bubbles? The minotaur was suddenly surrounded in a prison of bubbles! After questioning its own sanity for a bit, it swung its arms and popped all the bubbles surrounding it. That¡¯s done, but problem is. Where did Diana go? All it could see was her clothing, her small iron wand, and¡­that¡¯s it. The person that had come to challenge it was now, gone. Well, obviously not. It took it a moment to realise, but its legs were covered in a sticky slime! That¡¯s right, Diana morphed herself into a puddle of slime, and crept onto the minotaur¡¯s feet as it was bubbling around! The slime on its feet began to bubble and expand in size, quickly coating its entire body in the slime-, oops, sorry! Corrosive slime was the correct one! *GGGUUUUUOOOOOOOOOOO* A high-pitched scream of agony sounded out as its skin began to boil as the slime did its work! It wasn¡¯t immediate, since her level was still low and there was a coat of mana sprinkled on its blue fur, but it was working! She came up with that sneak-up technique after she considered that her [Assassination] skill gave her extra damage if she attacked the enemy while unnoticed, or while it was shocked! It was a technique she made to fight against Rei, but she was too fast for it to work. Nonetheless, against slower enemies, it worked wonders! But the minotaur wouldn¡¯t stay silent like this! It tried to rip the slime off, but after seeing that it was ineffective, the minotaur used the mana stored in its blue fur, and released it in a resounding mana explosion! ¡°Damn¡­!¡± In the last second, Diana dislodged out from the slime and jumped back, but the grand explosion still dealt some heavy damage to her. The slime covering it were blasted away, but at the cost of losing some of its stored mana! Picking up her iron wand, she gathered all the slime in the room, and mushed it up into one ball of densely packed corrosive slime! ¡°[Slime Cannon]!¡± The [Slime Cannon] shot out at immense speed, far above what it had been before. Still, it wouldn¡¯t do much damage, especially since the minotaur moved aside and dodged it! That [Assassination] damage boost would do nicely here! *GGGUUUUOOOOOOOOOO* The minotaur charged in with its fist loaded with mana, and caused a devastating shockwave on impact! Diana managed to jump aside, but the wind force from the punch sent her flying back into the wall. Luckily, she didn¡¯t go through the wall like the dryad did. Time for her next Spell Card! ¡°[Slimy Distraction]!¡± Once more, Diana collapsed into a puddle of slime. But then, a group of slime Dogoos sprung out from the puddle like some Minecraft monster spawner! The slime puddle disappeared, leaving behind a grand total of 25 Dogoos on the battlefield! *Boink, boink, boink, boink, boink, boink* The Dogoos began hopping around everywhere, jumping away and into the minotaur like some badly scripted game AI. The minotaur lost sight of where Diana had gone again, which meant that [Assassination] was fully active now! *GGUUOOOOO* The Dogoos were going everywhere! Some were just hopping around, some were clinging onto the minotaur like it was their parent, and some were even going into its eyeballs, which hurt, a lot! *GGGUUUUUUUUOOOOOOOOOOOOO* The minotaur¡¯s fur began to flap wildly, before it released a devastating blast of mana, tearing apart the Dogoos that were clinging onto it in one single swoop! Its mana decreased again, but it was a small price to pay to get rid of these annoying bastards! Actually, not yet! The Dogoos that were waiting by the side-lines began to charge in and cling onto the minotaur again! And this time, the Dogoos were corrosive too! The corrosion effect was starting to take place! No, not just the Dogoos, all the slime from before also became corrosive! Including the slime that went inside its body earlier! *GGGUUUUUOOOOOOOOOOO* It cried out in agony as its whole body burned from the inside out! [Congratulations! [Slime: Corrosive!] is now Level 2!] And to make it worse, her [Slime: Corrosive!] just levelled up, further increasing the effectiveness of the corrosion, which meant even more pain to churn the minotaur even further! The agony was unreal! The minotaur fell onto the ground and began rolling around in pain, twisting and turning as its body burned up! And then, the naked Diana stepped onto the minotaur, her lips curved up into a playful smile. *GGGUUOOOO- ¡°Nu~uh, no you don¡¯t!¡± The minotaur was about to open its mouth to do, uh¡­something, but Diana quickly silenced it by feeding it some more of its much wanted corrosive slime! This caused even more pain for the minotaur, yay~! She is not a sadist, I swear And, well, all that was left now was just to wait! Sooner or later, this guy¡¯s entire body will corrode and wither away, slowly and surely, from the inside, and the outside¡­God, that sounds like torture¡­ And scary thing is¡­Diana seems to be enjoying this¡­ She hadn¡¯t actually beaten anything too threatening in a while, and she was getting a bit bored of just smacking zombies and skeletons with her iron wand, so this being her first actual legit win against another monster was very, very satisfying. *G-GUUOO- ¡°Shh~. Here, have some more!¡± And so, the torture continues! The minotaur continues to cry out in pain, its voice sounding weak and coarse now, probably because its vocal chords just got corroded by her awesome slime powers. After some waiting, and after feeding it some more corrosive slime, the minotaur let out its last ditch attempt to kill Diana! By literally turning itself into a giant bomb! ¡°D-Dangerous!¡± The mana induced fur it had was quickly heating up, and all the mana in its body was quickly being compressed! The minotaur¡¯s body began to quickly bloat out of control, filled with the raging mana inside, until finally, the bomb went off! *BBOOOOOOOOOOOOOOMM!!!!!!* ¡°U-Uwah?!¡± The giant explosion sent her flying back, but she was able to somewhat soften the landing using some slime she conjured at the last second. But, still, aah, that hurts~ Oof, her HP was dangerously low from just several hits, but all in all, it was her victory! [Enemy has been slain! 3500 Experience has been gained] [Congratulations! Slime Virtuoso has levelled up to Level 2! Your stats have improved] [Congratulations! Slime Virtuoso has levelled up to Level 3! Your stats have improved] [Congratulations! Slime Virtuoso has levelled up to Level 4! Your stats have improved] [21] Puzzle Quest! Let¡¯s kick this chapter off with Diana¡¯s status, since I didn¡¯t really show the status last time, did I? Well, here you go! Name: Diana Race: Human Age: 17 Class: Slime Virtuoso Lv 4/25 Exp: 50/1150 HP: 19/95 MP: 37/82 SP: 51/84 [Strength]: 34 [Tenacity]: 30 [Agility]: 33 [Intelligence]: 33 [Dexterity]: 34 [Mentality]: 35 [Endurance]: 32 [Wisdom]: 32 [Longevity]: 9 [Skill Points]: 16 {Skills}: [Slime Valley: Lv 4/10], [Knife Mastery Lv 2/10], [Slime Magic Lv 4/10], [Assassination Lv 2/10], [Alleviation Lv 1/5], [Cooking Lv 2/10], [Internal Mana Manipulation Lv 1/10], [Bubble Magic Lv 6/10], [Slime Mend Lv 1/10], [Slime Army Lv 2/10], [Energy Burn Lv 1/10], [Danger Perception Lv 1/10], [Beast Taming Lv 1/10], [Polearm Mastery Lv 3/10], [Slime: Corrosive! Lv 2/10] {Magic}: [Slime Magic Set] {Titles}: [Slime Queen], [Conqueror of Slimes], [Soul Conqueror], [Dungeon Crawler] Ooh yeah~, look at that nice stat boost man! Her stats are above 30¡¯s now! Does that make her strong now?! Sadly, and scarily, yes. The new advancement to [Slime Virtuoso] sure gave her a great boost in both power and skill! It¡¯s kinda scary to witness, really¡­ That aside, her HP was down to 20%, and advancing with that kind of HP is never a good thing, in game, or in real life! She didn¡¯t have any Estus Flasks on her, so that¡¯s a bummer. And there ain¡¯t any bonfires anywhere close either! The only thing close to her was the door leading to the next room, which had a magic circle inscribed on the floor. It was most likely a teleport spell, just like what brought her here in the first place! But! That can wait for later. Right now, she¡¯ll need to heal up first. She wouldn¡¯t want to go into another boss fight with this kind of HP. So, with her [Slime Mend] active, she created some slime and coated it around her body. Oh! Also on the topic of [Slime Mend], despite its name, it isn¡¯t actually a healing spell. It was close, but slight different! Instead, it was a ¡®Regenerative¡¯ spell, which allowed her to regen faster, to put it simply. For battle, this skill was¡­meh, really. But for stationary healing like this, it sure was a great help! And with the added bonus of [Alleviation], her HP regen just skyrockets! Anyways, time to regen some HP! ¡®I wonder how Rei and Crystal are doing¡­¡¯ ¡­¡­¡­¡­¡­¡­¡­¡­¡­ To answer that thought, let¡¯s first begin with what¡¯s happening on Crystal¡¯s side. Just like Diana did, Crystal faced against the second trial, the large blue minotaur. The same one as the one she fed corrosive slime¡­Yeah¡­ Diana beat the trial and was now resting, and just like she did, Crystal too came out victorious. The difference laid in the fact that it was, One, a [Flawless Victory], and Second, it was also, very, very brutal. Alright, here¡¯s the rundown on how it all played out. Just to note, all of this took only 10 seconds. Put that time in mind as you read on! Just like Diana did, Crystal teleported into the room, and instantly met up with the second challenge that is the [The Great Demon Minotaur]. It roared and immediately charged at her with its fists loaded with mana. Then, she sent two [Phantom Blades], to slice off the guy¡¯s two legs, causing him to tumble down and slide across the stone floor. It cried out in agony as it attempted to rise back up and return to the fight. Only to find out, That its surrounding was completely dark. Without even a chant, Crystal casted countless numbers of [Phantom Blades] around the minotaur, so much so that it looked like it was surrounded within a dome of pure darkness. With a snap, all the blades moved and impaled the minotaur at the same instance, causing a split second of pain before the minotaur¡¯s life went flying back to the heavens. Alright, and there you go, battle¡¯s over. [Brutality!] So now, with nothing left to do, Crystal headed for the teleport circle, and vanished. Alright, next up, let¡¯s look at Rei! ¡­¡­¡­¡­¡­¡­¡­¡­¡­ ¡°*Chomp!*¡­Yummy.¡± ¡­¡­¡­A¡­Ahem¡­As of now, Rei was¡­having her ¡®lunch¡¯. I¡­I don¡¯t need to explain what¡¯s going on, do I?...I-I do? Well¡­ J-Just like the others, Rei was separated from the rest and was faced with the same old [Great Demon Minotaur]. Its eyes were glaring red and mana was rippling all across its skin. Ooh~, how scary~ This time, the first one to act was not the minotaur, but Rei, as she leaped from her spot at Mach speed! A single punch was sent to its gut, before it went flying back and crashed into the wall. She closed the distance in an instant, and began clawing at the crying beast, using her small yet sharp claws to slash and tear apart the minotaur. It was crying actual tears of blood, but Rei didn¡¯t care about any of that sh*t and continued to rip the poor guy alive. After about 13 seconds of constant pain and agony, the minotaur finally succumbed to its wound and died. She was 3 seconds behind Crystal, but holy sh*t was that fast! But she didn¡¯t stop there, and¡­started to¡­eat, the minotaur. From head to bottom, she ate¡­the whole thing. She even ate its two large horns which itself could probably withstand getting hit by a modern-day truck. Gah-, that¡¯s a terrifying scene to witness¡­ After her ¡®Meal¡¯, she wiped off the blood on her face with a satisfied smile and walked towards the teleport circle, and teleported away. She would probably fit really well with some of the other ghouls back in Tokyo¡­ ¡­¡­¡­¡­¡­¡­¡­¡­. Alright, the jump cuts are over, time to focus back on the main protagonist! Heh? Where¡¯s Slimey and friends you ask? Well, they¡¯re¡­¡­Eh? That¡¯s right, where are they? They didn¡¯t get teleported to the boss battle, that I know for sure, but they¡¯re not waiting at the third challenge either! Actually, Slimey wasn¡¯t even in the catacombs anymore! Did the teleportation circle take him away so that she couldn¡¯t and have a companion to aid her? The answer? He was brought to a different challenge. I won¡¯t explain more, but just leave it to your imagination! It¡¯s not very important to the main plot. Anyways, it¡¯d been about 3 hours since she beat the minotaur, and she¡¯s now ready to go! After she tore away the slime from her skin, she put her clothes back on, took up her small iron wand, and stepped into the teleport circle! A flash of blinding light enveloped her, and the next thing she knew, she was back in the same room from before! The one with many skulls and bones littered around the walls! Yay~, she definitely did not miss this place! Ooh, Crystal and Rei were already waiting too!The narrative has been taken without permission. Report any sightings. ¡°¡­Diana, slow.¡± ¡°H-Hey!¡± ¡°What took you so long, dumbass?¡± ¡°I-It wasn¡¯t that long!¡± Hey! She wasn¡¯t as strong as these two broken ass characters, alright? #plznerf2018 That aside, the big trio was now reunited, and the door leading to the next challenge was open! It¡¯s time for the third challenge! ¡°Ooh, it¡¯s a puzzle!¡± Yep! You heard that right! No battles, the third challenge will be a puzzle! This could be quite fun! Fun, if your meaning of fun is trying to finish a hard ass puzzle by decrypting little hints and trying to put that into context. And the first thing they see, was a sign filled with words she couldn¡¯t read! Yay~, the writing looks like moon runes or something~ ¡°Umm¡­Crystal, can you, uh, read it?¡± ¡°Ha? The f*ck? Can¡¯t you read it yourself?¡± ¡°Umm¡­No?¡± ¡°¡­¡­¡­What the f*ck? I¡­You¡¯re-, ugh, whatever. It reads, ¡®The path is brought by a torch, as the remnants of what was once lost ignites once more. The ashes of the fallen shall rise again, as the flame blazes alight. The light returns as the hands of time move by.¡¯ There.¡± Hoo, boy! Now that¡¯s one interesting message to put on a sign! No doubt that this was a hint for what to come, so she should probably take mental notes about this. And¡­There! All noted down in her imaginary N-Gear! Aside from the sign, there was also a clock in the room, and also a path, the most likely led to the next area. The clock was out of juice, both hands stuck at the number 10. Alright, note that down. Alright, everything has been mentally noted, time to move on to the next room! With that, they headed through the door, and- Found themselves in the exact, same room as before. ¡°¡­Eh?¡± It was the exact same room! Same interior, same wall ¡®decorations¡¯, same floor, and same sign-, wait, no. The writings on it looks¡­different. Oh! And the clock¡¯s missing too! Guess this is a different room! ¡®Teleportation¡­Awesome.¡¯ Putting aside Crystal¡¯s odd internal thought, yes, what just occurred was actually teleportation! The door they went through actually didn¡¯t lead anywhere, but the instant teleportation made the illusion that these two rooms were connected. ¡°Crystal, read it!¡± ¡°I¡¯m not your f*cking trans-, whatever. ¡®The fading light of the torch burns towards the setting sun, illuminating the incoming darkness. The wolves howl towards the stars as the moon rises. The flame of the torch fizzles away.¡¯ It says.¡± Hmm¡­Okay. Noted down! This time, there weren¡¯t anything else of interest besides the sign itself, so the hints were probably only on the sign. Time for the next room! Just like before, the next room was the same as the previous, but the sign seems to tell something different, and there was also an inverted shield hanged up on the wall, alongside the many other skeletal ¡®decorations¡¯ of course. ¡°Crystal!¡± ¡°Yeah, yeah. ¡®A being bound by time, I am not. Obtuse, I am not, reflected upon the Night. I watch on, as the sand continues to cycle, following and followed by the hands of time.¡¯ Woah, that was more¡­symbolic than she anticipated. Nevertheless, note that down, and¡­done! Alright! Next up is the inverted shield, but there¡¯s nothing else to it, so, yeah. She¡¯ll just remember how it looks, just in case. Okay! All¡¯s done and good, time to advance to the next room! And through the door, the next room, was different! There were no signs, no cryptic hints, no shields or clocks, and no bones! Hooray~! This was, the puzzle room! But, holy sh*t, was this place huge! Much bigger than the three rooms before this one! Well, that¡¯s great! Since there were a lot of things put inside this room, and-, what the heck? Is that a giant hourglass? Okay to simplify it, here¡¯s a list of what she could find after looking around: A statue of the head of a wolf, several rotatable mirrors, a stone table that housed a picture-matching puzzle, an unlit torch, a crystal shaped like a star, a picture of the sun hanged on the far right of the room, and, yeah, the giant hourglass. Okay, just, before I start narrating this¡­Hoo, boy~! Haha! This is chapter be one hella hard chapter to write! Heads up, I suck at making puzzles, so¡­yeah! Oh, god¡­Haha¡­Haha, oh, why am I doing this to myself¡­ ¡°Just get on with it already!¡± Haha, yeah, yeah, sure thing! Ahem¡­Phew¡­Okay. From what she could see, there were several different puzzles in this room. One, was the obvious picture matching puzzle on that stone table right there. From what she could see, it seems to be a picture of the inverted shield from before. This one shouldn¡¯t be too hard. Next, was the wolf head statue thingy. Its mouth was open, and there was this barrel coming out from the inside. Most likely, it was a cannon or something, and she was supposed to fire it at the star. Problem was, she couldn¡¯t rotate the head itself! And that¡¯s where the mirrors came in handy! The cannon was already pointed at a mirror, so that¡¯s an obvious hint. She¡¯d probably still need to correctly rotate the mirror so that whatever this statue would shoot out would bounce around and hit the star! Simple stuff! But, there comes another problem. How does this thing shoot? There seems to be a rope hidden under it, and there¡¯s a small hole on all four sides, but they¡¯re too small! She can¡¯t even fit her pinky finger in! And that hourglass¡­Actually, she didn¡¯t really know what to do on that one, so she¡¯ll leave that one be for now. She¡¯ll just come back to it later. Well, alright then! Team, roll out! Okay, here¡¯s how the plan will go. Crystal and Rei will first do their best to align the mirrors so that they would lead the cannon onto the star, while also finding a way to light the cannon, and also possibly how to also light that unburned torch over there. Since she didn¡¯t even know if that hourglass had anything to do with this puzzle challenge, she tasked herself with the one remaining puzzle, the matching puzzle! To explain further, this puzzle required her to spin the many layers of the puzzle to finally match and create the picture. Obviously it ain¡¯t that easy! Spinning one specific layer of the puzzle would result in spinning two other layers, so, yeah! This was gonna be tough! Oh, and by the way, there are 20 LAYERS. If you still don¡¯t know what it looks like, just look up that Uncharted: The Lost Legacy matching puzzle on YouTube, you¡¯ll know immediately. That, and make it 14 times as hard. But, she won¡¯t back down! It may look insane, but her heart was feeling oddly excited at it. No, not because she might lose her mind and she was looking forward to it, but because it felt genuinely fun to find out the solution! ¡°Time to get to work!¡± ¡°Be quiet, moron.¡± ¡­¡­¡­¡­¡­¡­¡­¡­¡­¡­ ¡°¡¯Cause everythin¡¯ that makes me whole, belongs to you, I¡¯ll give my heart and soul~¡­I¡¯m yours~¡± ¡°Holy sh*t, be quiet!¡± ¡°¡­Chill.¡± ¡°You shut up too!¡± The situation was, surprisingly pleasant. Rei and Crystal was constantly arguing over which mirror should look where, while Diana was in her own world humming the lyrics to a certain anime opening as she continued to rotate the many layers to the puzzle. Seriously though, this thing is like an onion! There¡¯s so many pieces to it! Not saying that she¡¯s ever eaten or even peeled off an onion, but I digress. Right now, she¡¯s gotten about¡­a quarter of the whole way. The first five most inner layers of the rotating puzzle¡¯s done, just 17 more, and she¡¯d have gotten herself a home run! And the puzzle¡¯s also steadily getting easier as she finishes more of the layers. Long story short, she¡¯s got PROGRESS! Oh, on a completely random note, while Diana¡¯s busy working on to solve this puzzle, she¡¯s also having some fun with her [Bubble Magic], which caused Crystal to become even more annoyed than she already is. [Congratulations! [Bubble Magic!] is now Level 7!] Ooh, random level up! Nice! On that note, she wondered what kind of cool rewards she would get once she maxed out this useless party trick. As of now, all this magic could do was create bubbles. Oh! Could she then infuse Hamon like Ceasardid?! That¡¯ll be so cool! Hmm¡­Maybe she¡¯s getting too ahead of herself. How about being able to do a Bubble Beam, like Vaporeon can? That¡¯ll be nice too! ¡°Aha! Another one completed!¡± Alright! Another layer done, time to move on to the next layer! On the other hand, Rei and Crystal¡­have made some progress? I guess? Crystal kept on complaining over which mirror needed to face where, while Rei just followed on with what her mouth had to say. Honestly, these two make a bad team. Well, it¡¯d only been about 25 minutes, so them not making too much progress wasn¡¯t that bad. It¡¯s just Diana was just making too much progress in that small time span. Suppose that training she had with Rei helped out, maybe? I won¡¯t specify what the training was, but I¡¯ll just say this, it was very¡­unconventional. Let¡¯s say it helped Diana¡­widen her perspective. Also, Diana was still confused as to what the giant hourglass puzzle was. Heck, she didn¡¯t even know if it was a puzzle or not! Hmm¡­Maybe she was missing something¡­Oh well, she¡¯ll just think about it later. She needed to finish this matching puzzle first! -2 hours later- ¡°Going on and on~, I continue, circling, with nothing but my hate, and this paralysing agony~. And slowly I forget~¡± ¡°Oh my god¡­she just, won¡¯t¡­ugh¡­¡± ¡°¡­Chill.¡± As of now¡­Well, nothing much has changed really. Diana was still working on the puzzle while singing, or humming, can¡¯t forget humming, or playing with bubbles! Meanwhile, just like before, Crystal was still looking ever so annoyed by Diana¡¯s happy attitude, with Rei by her side casually saying ¡°¡­Chill¡±, which ticked her off even more. Oh, right. Progress has been made, baby! She¡¯s now down to the last 8 outer layers! Hell yeah~! Well, that¡¯s still quite a bit to go, but, PROGRESS! And also, since Diana was getting slightly annoyed at seeing Crystal and Rei battle it out, she told them to take a rest, just to cool off their heads before they jump back in. And¡­it worked? I suppose? Crystal was still complaining though¡­ And, that was how the situation was pretty much. Nothing too major was happening in this scene, since Diana was just fiddling with the puzzle and trying to complete it. So, yeah! The F.O.E hasn¡¯t respawned yet, sorry~ ¡°Glassy sky~, above~! As long as I¡¯m alive, you will, be part, of me~¡± ¡°Shut up, moron¡­¡± [22] Puzzle Quest, Completed! Continuing on from the last time, another hour had passed by, and more PROGRESS had been made! Now Diana¡¯s down to the last 2 layers! Overall, this puzzle has been quite fun! The challenge imposed by this puzzle was hard, but it was also fair. It gets a bit tedious over time, but all in all, it was very interesting. She¡¯ll most likely give it a good 8.3 on the famitsu score. Oh! Also, Slimey¡¯s finally back! She didn¡¯t know from where, but he¡¯s back! He won¡¯t do much though. Crystal and Rei were back at it again, and Crystal¡¯s not complaining as much since Diana wasn¡¯t singing out lout anymore, but still, they hadn¡¯t completely matched up the mirrors yet. PROGRESS has been made though! ¡°Got it! One more left to go~!¡± Second last layer was done, now onto the very last one! I wonder if she¡¯s going to get a three star, since she her speed at completing this puzzle could be considered quite fast, by normal standards anyways. Oh, on a random note, her [Bubble Magic] levelled up again! It didn¡¯t do much, of course. This was just a party trick after all. But could there be some kind of upgraded version of this magic after she maxed the level out? But, even if there wasn¡¯t any, she¡¯d still get some [Skill Points] back to spend, so that¡¯s a plus! The available skills to purchase this time was just too good to lose! Her [Slime: Corrosive!] was one of them! [Slime Cloning] Costs 30 Skill Points to unlock It¡¯s in the name. It allows the user to create a clone of themselves. The clone can perform anything the caster could do normally, including casting magic, but the power output is lowered as more clones are created. It¡¯s kinda the Shadow Clone Jutsu from Naruto, but instead of Chakra, it uses mana. The mana cost depends on the level. [Slime: Hardening!] Costs 30 Skill Points to unlock This skill allows the user to apply increased toughness and durability to their slime. At first, the effect is very minor, but the effect increases as the skill grows. The toughness of the slime depends on the user¡¯s magic. This effect obviously breaks when it comes in contact with magic, so don¡¯t go blocking any magic spells with this. [Slime: Scorching!] Costs 30 Skill Points to unlock Just like the name, this allows the user to apply heat to the user¡¯s slime. Despite its name, this does not make the user¡¯s slime burn by any means, but adds a searing heat into it that can be felt on contact. The power of the effect increases as the skill levels. It¡¯s a bit boring, but it¡¯s effective, so that¡¯s nice. Yep, as I said, all of these new exclusive skills were too good to lose! Sadly, she didn¡¯t have enough [Skill Points] to unlock any of them, and she highly doubted that she would get enough to purchase all of them, but there¡¯s still hope! Well, it depends if her maxing out [Bubble Magic] would grant her enough [Skill Points] to be worth the effort. It is a party trick in the end, so she wasn¡¯t expecting that many points to be earned from this. Well, there was also-, oh, hey! She just finished the last layer! Alright then, first puzzle of the third challenge, completed! Ooh~, and there was even a congratulatory message that was given for her! She couldn¡¯t read it though! Luckily, she has her obligatory translator! ¡°Crystal! Read it!¡± ¡°Ugh¡­¡¯Congratulations on finishing this puzzle. Your speed of completion was commendable, and I have prepared a reward. Finish the rest of the puzzles, and it shall be yours.¡¯¡± ¡°Oho~! That¡¯s awesome!¡± See! Even the creator of this place praised her for her speed! But, she¡¯s not done yet! There were still ¡®Two?¡¯ puzzles left to solve, and she wouldn¡¯t be getting her reward if she stayed here all day long. Next, was the mirror puzzle thingy, but she wouldn¡¯t be helping in aligning the mirrors. No, no. Instead, she¡¯ll be trying to find the way on how to light the damn cannon. Because, even if all the mirrors were aligned, they still wouldn¡¯t be able to complete the puzzle if they couldn¡¯t fire the thing in the first place! Well, she couldn¡¯t see anything in the room that could potentially light the cannon, or the torch in that manner. Perhaps it was hidden somewhere? Like in the corners, or behind some hidden wall, or some-, oh, she found something inside the cannon barrel. ¡°This is¡­¡± From the inside of the cannon barrel, she found herself a nice smooth rod of metal. What metal, she did not know, but when it comes to this, an idea immediately struck her mind! ¡®A flint and Steel!¡¯ Yep, that¡¯s right! A flint and steel would most likely do the trick! If she could find the flint, then she could just put them in her crafting grid and, bam! Fire created! Then again, where could she find a piece of flint? It¡¯s not like there was any gravel around here. Well, it didn¡¯t have to be flint, any rock with a sharp edge should work too, but having a portable piece of flint would be much easier. So she started looking around, searching for any flint, or any sharp rock for that matter. But there was none! This room was too clean! There were no sharp edges of the wall, the floor was perfectly flat and smooth, even the stone table from earlier was too smooth to be used for creating a spark! But! Just because there were no sharp edges to be found, didn¡¯t mean she couldn¡¯t create one! With her iron wand in hand, she walked over to the edge of the stone table, and gave it a nice whack! *Bak!* ¡­¡­Nope, it didn¡¯t break. Huh. Maybe she couldn¡¯t create a sharp edge after all¡­No! Let¡¯s not get discouraged first! The stone might just be really hard! Okay, one more swing, up, and down it goes! *Bak!* ¡­Nope. Still not broken. Well, seems like the stone really is that strong. Or, maybe she was just too weak? Oh! Then how about Rei? She should be able to destroy this stone in a flash!You could be reading stolen content. Head to the original site for the genuine story. ¡°Rei! Can you help for a moment?¡± ¡°¡­?¡± ¡°Can you try and break this stone?¡± ¡°¡­Okay.¡± *BAK!!!* Woah! That was one hell of a chop! But, still, even with the incredibly powerful ghoul that is Rei, the stone table was still living its life! Its Haki was too strong for her to break through! ¡°¡­Sorry.¡± ¡°No, no! It¡¯s fine!¡± But, if even Rei couldn¡¯t break it, then what can? She didn¡¯t want to go through the arduous work of trying to find this flint somewhere, but if she couldn¡¯t create any sharp stone to use the metal on, then she¡¯s left with no choi- ¡°Aha! I got it!¡± And that was when, a genius idea struck her mind like Pikachu¡¯s Thunderbolt! If she couldn¡¯t sharpen the rock with brute force, then why not magic?! And she had the perfect tool to do just that! With a whiff of magic, she created a coat of slime on the edge of the table, and applied her corrosion onto it! Yep, she¡¯s going to try and corrode the edge to make it sharper! And¡­it¡¯s not working? Actually, no. It was working, just really, really slowly. Like, a dent was created every 30 seconds or so. Well, it¡¯s really slow, and boring to watch, but it works! Now, all she needed to do was wait! And while waiting, why not continue training her [Bubble Magic], just hella case the skill reaches the max level before she leaves this room. Hopefully! Since she¡¯s pretty much dying to purchase one of those exclusive skills! After 15 minutes of rigorous bubble playing, she, didn¡¯t get a level up on her skill, but the sharp edge she was creating was now done and ready to be used. Now, all she needed was to create a spark and light the torch! Snatching the torch from the wall, she brought it close to the sharp edge of the table she made and struck her rod of metal against it! Sadly, she was really bad at actually doing it, so no sparks were made, at all. She did light the torch after several tries, but the metal rod she was using was badly scratched and chipped from the many clumsy hits and strikes she made. It¡¯s fine though, because she got the fire! The odd thing was¡­Why was it burning to the right?! She wasn¡¯t a master physicist, but even she knew that fire should burn up, not to the right! She¡¯ll just leave it as ¡®It¡¯s Magic, man!¡¯ and move on. Next problem, how was she supposed to light the cannon again? The hole leading to the rope she needed to light was smaller than her pinky finger, so trying to jam the torch into the hole was a big no no. Actually, that wasn¡¯t that big of a problem, was it? She could just let the fire into the hole, and since the fire burns to the right, not up, there was no danger of getting herself burned, so that¡¯s a big plus! ¡°Alright, here you go- *BAM!!* ¡°Uwah?!¡± I¡­Pretty sure there was supposed to be a delay before firing, but it worked, so she¡¯s not complaining! And luckily, the mirrors weren¡¯t aligned towards anything, so the big mana cannonball it fired didn¡¯t hit anyone. Crystal was really pissed though because of that, but just ignore her. But, Crystal¡¯s annoyance aside, she¡¯d found the way to light the cannon, now all the was left was to align the mirrors, and complete this second puzzle! This time, she¡¯ll help them align the mirrors, because they¡¯re quite terrible at doing this. With Diana, the legendary ¡®ProDavin888¡¯, the puzzle was quickly resolved, and the mirrors were precisely aligned from start to finish in just a mere hour. It wasn¡¯t that hard, much easier than the rotating puzzle she did just minutes ago, but there were still about 30 or so mirrors that she needed to align correctly. Nonetheless, that¡¯s now done too, and it¡¯s time to fire the cannon again! ¡°Fire~!!¡± *BAM!!* A loud explosion rang out as the cannonball flew at high speeds, making contact and bouncing off the mirrors, until it finally hit the star they had been aiming for! The star shook and exploded into many tiny pieces, which meant, puzzle completed! But, even with those two puzzles finished, the challenge didn¡¯t seem to be over yet, which meant, that the giant hourglass over there was a puzzle after all. But what was the puzzle? ¡®The path is brought by a torch, as the remnants of what was once lost ignites once more. The ashes of the fallen shall rise again, as the flame blazes alight. The light returns as the hands of time move by.¡¯ ¡®A being bound by time, I am not. Obtuse, I am not, reflected upon the Night. I watch on, as the sand continues to cycle, following and followed by the hands of time.¡¯ These two hints were the ones who had a mention relating to ¡®Time¡¯, which an hourglass would normally be associated with. And even then, the biggest clue to it lies in the second one, where it stated that ¡®The sand continues to cycle, following and followed by the hands of time.¡¯ Was there some hidden meaning behind those words? A metaphor perhaps? Both Crystal and Rei didn¡¯t have a single clue about it, so that¡¯s a dead end. Or could it mean that literally? Like, as in a clock? But there weren¡¯t any clocks around here- ¡°Aha! I remembered something!¡± And then, it struck her! Sure, there weren¡¯t any clocks here, but there was a clock! Back in the first hint room, there was a clock hanging there, with both hands stuck on the number 10! The number itself didn¡¯t matter that much, that¡¯s just a red herring. But with both hands stuck on 10, that meant that the clock wasn¡¯t moving! And remember, ¡®Following and followed by the hands of time¡¯! If the clock from before wasn¡¯t moving, that meant that the hourglass right here needed to follow it and stop flowing! Oh, but wait. How was she going to stop the hourglass? The sand that was flowing inside of it seems to be infinite, flowing out of the drains once it reaches the bottom as new sand comes out from the holes at the top. ¡­Wait up! Holes! There were holes inside the hourglass, which meant that-! ¡®Yeah! This should work!¡¯ ¡°Hey, so? Have an idea, dumbass?¡± ¡°Yep~! Give me sec!¡± There were holes on the top and bottom of the hourglass, and her mission was to try and halt the sand from moving. There might be some kind of contraption the creator put in to somehow stop it, but she¡¯ll do it her own way! And with her trademark slime! ¡°Hap!¡± First up, apply [Slime: Corrosive!], next create some slime and let the corrosion take place! Her plan was plain and simple, use her corrosive slime to drill down and create a path into the holes on the hourglass. After that, jam some slime in and stop the hourglass! Thing is, the corrosion she had was pretty weak, so this would take a while. As she waited, she decided to play with her [Bubble Magic] some more, while also having a pleasant chat with Rei, about food, again. And just like always, Crystal was looking as annoyed as ever, and Slimey¡¯s just havin¡¯ fun, goofing around and hopping all over the place. He seems over excited about something. ¡°¡­Hot, dog?¡± ¡°Yeah, it¡¯s pretty much a sausage put in between bread! I haven¡¯t eaten one in a while, but it¡¯s pretty good!¡± ¡°¡­Cook?¡± ¡°Well¡­I¡¯m not that good at cooking, so¡­¡± Right now, the two were having a pleasant chat about this interesting genre of food called ¡®American Food¡¯. After Diana mentioned about her home state of America, Rei immediately asked about what kind of food there was there. It was interesting to know of this country called ¡®America¡¯. It was surely not a country she had ever heard in her lifetime. And from what she had heard, the food there seems pretty great! She would love to take a visit one day, but Diana said that it was impossibly far away. If only she knew that America didn¡¯t even exist in this world¡­ After they finished talking about American food, they jumped onto desserts, and this magical item Diana described as an ¡®Ice Cream¡¯. Could this literally be flavoured ice? But there was also cream, but doesn¡¯t taste disgusting then? Rei couldn¡¯t wrap her head around this magical invention! It was too complex! And before she knew it, her slime had dug down into the channels leading to the holes! Now, with all ready and set, she conjured a huge amount of slime, and crammed it all into the hole, guiding up through the channels and into the hourglass! Once inside, she spread the slime out and made it cover all the holes that were sucking out the sand! Yep, that¡¯s right! She planned to fill the hourglass until it couldn¡¯t fill anymore! In no time, the hourglass quickly filled up, until it was completely full to its brim! Just like that, the third puzzle of the challenge had been comple- *Crack!* ¡°¡­Um¡­Is it, cracking?¡± ¡°¡­Un.¡± *Crack!!* Eh¡­Is this bad? The glass was cracking, but¡­it should be fine, I suppose? *Crack!!* Ah, it just cracked again¡­Well, this looks very dangerous, so she should probably get out of he- *CRACK!!!* ¡°Oh crap!¡± Since this was getting unsafe, Diana and the rest decided to safely hide at the farthest corner of the room, just in case that thing breaks and glass flies everywhere. Wait, if that happened, wouldn¡¯t the sand also fly out? *CRACK!!!!!* Ara, the sand was starting to spill out¡­This, wasn¡¯t looking good. *BOOOOOMM!!!!!* ¡°Kya?!¡± And with a flash, the glass broke, and sand came flying out like a storm! In, like, half a second, the entire room was covered in sand. Not filled, just covered. Still, everything was now covered under a thick layer of sand¡­Heh, suppose you could call this¡­a ¡®Sand storm!¡¯ Hah! Get it?! Since the sand came flying out like a storm, and it was sand, so, haha¡­haha¡­hah¡­ Well, everyone was covered in the sand, so this would probably take a while to get off¡­ But hey! Challenge completed! [23] Tartarus! Several hours of painful digging and climbing later, they were finally out~! Previously, after Diana had masterfully completed the last puzzle, her amazing idea caused the hourglass to overload, and explode! Which caused the entire room to be flooded with sand¡­yeah¡­ Well, they were out, they completed the puzzle, and most importantly, they survived! So that¡¯s great. And just like promised, once they escaped from the previous room, Diana was greeted by a table, with a note and an amulet laying there. With the help of her trusty translator, who was still very pissed, they read the note together. ¡®Congratulations. To commend the speed of your completion, I have prepared this reward for you. This is the ¡®Phenom Amulet¡¯. A treasure that has been kept within this place. Please take it with you, and good luck.¡¯ Without further ado, Diana took the amulet and equipped it in her Accessory slot, and¡­Huh, nothing much has happened. That¡¯s slightly disappointing. Maybe it just gives her some stat boost. That¡¯s good enough. Anyways, moving on, the next room, was huge! Like, huge huge. Seriously, standing inside this place was giving her reverse-claustrophobia, if that even exists. What kind of titanic being were they going to fight here?! All 12 of the colossus even?! Hmm? There seems to be something just sitting there, in the centre of the room. Ooh~! After they walked closer, they realised that it was sword, stabbed into the ground! It was the fabled sword in the stone! It was not Excalibur though. Wait, its another sword¡­*Gasp!* Oh My Goooddd!! C-Could it be?! Another weapon-based boss?! Uah~! She¡¯s already had enough of these battles! She didn¡¯t want to fight a pseudo-Crystal! ¡­¡­¡­¡­Eh? O-Oh, the sword¡¯s, not moving. Huh. So the sword wasn¡¯t the boss? Heh, this felt odd, but heck, she¡¯ll take it! ¡°¡­Switch.¡± ¡°He~? Really?¡± According to Rei, that sword was apparently a switch! Wait, does that mean that the fourth puzzle wasn¡¯t a boss battle after all? Well, just like you do with a switch, Diana ran up to it, and twisted it¡­! Ara, she couldn¡¯t twist it. The heck? She couldn¡¯t rotate the sword at all! Did the sword get jammed while waiting for someone to turn it around?! When was this place built an-, oh, she just pulled it up. Aah~, that makes sense~! It¡¯s a sword stuck in a stone! Of course you have to pull it out~! *Vvvvrrrrruuuuuuuuuuuuuuuuuu* ¡°W-Woah?! T-The ground¡¯s s-shaking!¡± No, it wasn¡¯t just shaking, the ground was opening! The stone floor was moving away from each other, giving light to the four staircases hidden underneath! Yep, these four staircases were the entrance down into the challenge! This time, the name of the challenge was- [The Prison of Eternity; Tartarus!] You saw it folks! The next challenge was the famous prison of mythology, Tartarus! On the topic of Tartarus, I wonder what time it is now? Let¡¯s hope it wasn¡¯t midnight, or else the Dark Hour will occur. ¡°The challenge was simple, traverse down into [Tartarus], make your way around, or into, the prisons. The deeper you go, the tougher the enemies will get, but that also meant more treasure to take back. At the deepest level, you would find the three judges, and behind them, sits the greatest treasure of this catacomb. It¡¯s kinda like a risk Vs. rewards thing. If you choose to go around the prisons, you would encounter less enemies, and overall compound less stress on your head. If you do choose to enter the prisons however, then at the end of each prison, sits special treasures that are a multitude stronger than those found by simply going down into [Tartarus]. But, know that this challenge is not a puzzle by any means. There are few to no puzzles placed inside this challenge, only enemies, and tough ones at that! If you die here¡­Well, better luck in your next life.¡± This information came from your most trusted translator, Crystal. ¡°Why the hell do I need to translate this?!¡± Such is the comment from our lovely translator! That aside, it¡¯s time to start their adventure, down into [Tartarus]! ¡­¡­¡­¡­¡­¡­¡­¡­¡­ Okay, first up, this place was brutal!! ¡°U-Uwah?! T-That was close!¡± As of now, Diana was engaged in a close-quarter fight against a very tough enemy, a giant rock with hands! No, seriously, it¡¯s a giant rock with hands, and it¡¯s really strong! One strike from it could send her flying! To rewind a bit, right as they entered, a welcoming group of monsters came to party with them, but they were easily dispatched off. But before they knew it, the floor below them opened up, and they were swallowed whole! When Diana came to, she was on a different floor, separated from the rest. And then, this rock guy came along and decided to ruin her day, but jokes on it, since it¡¯s her turn to ruin its day! ¡°Ha!¡± *Boom!* From the inside, the giant rock suddenly cracked and blew apart! Now, the reason why that rock suddenly exploded, was not because of an explosion. Diana wasn¡¯t Megumin. Instead, using her [Slime: Corrosive!], she dug her slime into it and when the time came, made all the slime explode outwards, which caused, this. That battle took 10 minutes of running in total Wave of satisfaction aside, she should probably leave now. She needed to find the rest of her party! Oh, and maybe snag some loot for herself if the opportunity arises. Just like in Persona, the way to go deeper in was to go down, by stairs. The only difference being the fact that it was inverted, and instead of ascending up to tower, she was descending deeper into this eternal prison! Her plan for now was to try and descend further, until she either meets someone by chance, or reunites with her party at the deepest level. The former was very unlikely, but there¡¯s still a slither of a chance, so the possibility¡¯s still-If you encounter this tale on Amazon, note that it''s taken without the author''s consent. Report it. ¡°Woah! New enemy found!¡± This time, the enemy was a, floating book. It¡¯s not as weird as the giant rock with arms, but this was still pretty weird. Now, thoughts aside, how was she going to deal with this¡­since this floating book just shot out a fireball, which meant that it could cast magic! Well, it was nice to know that the book was still pretty slow, so dodging it wasn¡¯t too complicated! Trying to attack it though¡­might prove difficult. First up, it can use magic, which is bad, since her slime sucks against magic. ¡°[Slime Cannon]!¡± With the added benefits of her amulet and iron staff, a speeding slime ball was launched, but there lies the second problem. Just as it was about to hit, a barrier was erected around it, blocking the incoming slime, and sending it back to her! It¡¯s just like the [Reflect] move from Pok¨¦mon, but shot with a requiem arrow! The barrier swiftly melted away as the floating book readied another fireball! But, this was where her ingenious plan would come into action! First, she casted another [Slime Cannon] and shot it out. It quickly cancelled the fireball it was casting and, just like before, erected a magical barrier around it to reflect it back. But! Just as the barrier was melting away- ¡°[Corrosion]!¡± A thick line of slime came down from the ceiling and cut through the book, corroding it as the slime made contact! The book tried to cast another barrier, but the barrier could only erect around the book! Once something was too close, it couldn¡¯t stop it! This was one of the many results of her intensive training! And with that, the book easily melted away, and her second battle was deemed a success! Oho~, and there was loot this time around! As the last of the book was corroded away, there was a single page left behind. Looks like a page of that magical floating book was left intact for her to take and read! Well, she couldn¡¯t exactly read it, but with her obligatory translator, she should be able to decipher this magical page, filled with runes and magical constructs. Now, time to find the stairs and descend further in! ¡­¡­¡­¡­¡­¡­¡­¡­¡­ Meanwhile, with Rei, *BOOM!!!* ¡°¡­Phew.¡± Just then, she had just finished a tough boss fight against a golem-type enemy. I said tough as in that the boss had very high defence, because the entire golem was made out of various tact-on metals and minerals. Sadly, it didn¡¯t make up for a hard boss fight, since all she did was do the ¡®DURARARARARARARA!!!¡¯ and, bam! Explosion! To jump back slightly, after she located where the stairs were, she decided not to go down yet, and went around to explore some more, to maybe try and find Diana and the others. Instead of Diana, she found that big guy, and destroyed him in around, uh¡­19 seconds, tops. But she didn¡¯t fight that boss for nothing! Standing in between her and the giant rubble of what was previously a tough boss fight, was a pair of metallic gauntlets. It seems to be made from some very dense and tough materials. There were also some carvings and letters on it, but she couldn¡¯t read them. And the gauntlets were also quite magical, fitting in to match her hands¡¯ size when she put them on! Tbh, she didn¡¯t really need a weapon, since her fists could do the talking all day long, but some extra bonus physical damage shouldn¡¯t hurt. Sadly, she didn¡¯t find Diana, nor did she find anything she could give her. With nothing left on the floor, left desolate and decimated by Rei¡¯s fists, she went back to where the stairs were and descended deeper into the prison. ¡­¡­¡­¡­¡­¡­¡­¡­ Deeper in, with Crystal, ¡°Gugha?!¡± ¡°Just die already! [Phantom Blade]!¡± *Puchi!* As of that moment, Crystal was busy dealing with a very annoying vampire-like enemy. It¡¯s appearance was that of a young girl, with yellow blonde hair, and red eyes¡­Wait, that¡¯s kinda like Yue from Arifureta-! And just like a certain blonde hair loli vampire, this vampire was not giving up! She¡¯s ensnared it and crushed it with her [Shadow Bind], pierced its body with her [Phantom Needle Rain], and sliced and diced it with countless [Phantom Blades], but it was still alive and kicking! Then again, it was looking kinda pale, so that meant that its mana reserves were on the verge of running dry, which was great! She¡¯s been deadlocked in this battle for about 5 minutes now, and her mana was beginning to take a hit too. But, finally, after all that boring slog and grind, the vampire falls to its knees, and falls apart into chunks of meat and blood, the perfect dinner for the White Glove Society back in New Vegas. References aside, her path was now clear, and the staircase leading down to the next floor was open to go through. Then again, should she dive deeper into this eternal prison? Shouldn¡¯t she wait for Diana and- Nah, they¡¯ll be fine. Waiting here for an eternity would give her an untreatable Boredom Syndrome. Descending further in was genuinely way more fun. Oh, but that wasn¡¯t a copout, no no, that¡¯s simply her trust in her. She knows how damn tenacious that slime girl can be at times, even more than that vampire even. So she¡¯ll be fine! As for that ghoul¡­Well, it¡¯s not like she doesn¡¯t get along with her, but seeing her with Diana all the time ticks her off for some reason. But that ghoul¡¯s strong, really strong. She doubted if she could even beat her at a one on one battle. Is totally not going tsun over Diana Anyways, with the vampire ready to serve, Crystal shrugged her shoulders and descended down the stairs, going deeper into this prison. ¡­¡­¡­¡­¡­¡­¡­¡­¡­¡­ Well, as for Slimey¡­ *Boink, boink!* He was doing what he does best, running and hopping around as it scouted for nearby enemies and treasures, and maybe even find his queen! From the connection the two share, Diana didn¡¯t seem to be in any trouble, but even then, he couldn¡¯t help but be worried! As a small and agile being, he was skilfully moving and snaking around the floor to locate the staircase to descend further in, just like everyone else was doing. Then again¡­there was a treasure chest there, and he could easily gather that¡­ *Boink!* Ah, screw it! It may make him slightly heavier, but the extra effort would be worth it! Anything to make his queen even more powerful, he would gladly undertak- *Ceklunk!* *B-Boink?!* You thought it was a treasure chest, but it was me, DI-, floor trap! The floor he was bouncing on suddenly clipped open, causing him to fall into the darkness! He let out one last *Boink* of help before the floor closed back. One of the four members have fallen prey to the challenge! ¡­¡­¡­¡­¡­¡­¡­¡­ Back with our lovely female protagonist, ¡°Take, this!!¡± *BAK!!* As of now, she was battling(completely dominating) against a giant purple beetle! Just as she finished walking down the stairs, this purple scaled guy appeared suddenly and jumped at her! Because of the shock, she shot out a large amount of sticky slime and glued it onto the nearby wall. She also made a very girly scream. To switch out a bit, and also to make it meet its death as slowly as she could, she pulled out her iron wand and began using it as a disciplinary stick, whacking and hitting it over and over again, in hopes that it would die, and also improve her [Polearm Mastery]. With one last satisfying hit, the beetle let out one feeble screech before it succumbed to the large head trauma it received from her. Sadly, no level ups just of yet, since the bar to the next level was set quite high this time, but she¡¯ll be patient. ¡°Phew¡­Thank goodness no one heard that¡­¡± ¡°My, are you sure, young lady?¡± Yes! Of course she was sure! Her party was separated and spread out across this descending dungeo-, wait¡­did someone just speak to her before? ¡°Are you okay, young lady?¡± ¡°Kya?! W-Who are you?! Where are you?!?!¡± ¡°My, I am right here, young lady.¡± W-What the¡­? Without her noticing, a short, bearded man suddenly appeared before her, like, out of thin air! Like, poof! And he¡¯s there! ¡°W-Who, are you?¡± ¡°Allow me to introduce myself. I, am Igor.¡± Igor, the short man with a hefty beard and a polite attitude, that suddenly appeared before her as she finished her first battle of this floor¡­Huh, this guy sounds like some NPC who would give her some quest or whatnot. ¡°S-So, Igor, what do you, uh, want, exactly?¡± ¡°My reasonings are simple. I have come here to present you a trade.¡± ¡°A, trade?¡± ¡°Yes. I require [3 Large Star Crystals]. If you bring them to me, I shall present you with a gift. How does it sound?¡± Yep, her assumption was exactly on spot too! But, [3 Large Star Crystals]? Where the hell would she find those? Were they monster drops? Or did she need to find them by exploring this entire floor area? ¡°And, uh, where do I, find them?¡± ¡°I believe they could be found at specific locations on this floor. However, I have heard that each crystal is being guarded by a very strong sentinel. A man as weak as myself could not hope to face against those beings.¡± Ah, so it was both. She needed to find the crystals AND battle against a tough enemy to get them. How troublesome¡­But she¡¯ll do it anyways! That ¡®Gift¡¯ of his sounded very tempting, and any help she could get would be nice too! ¡°Uh, alright then! I¡¯ll do it!¡± ¡°My, I must thank you, young lady!¡± Alright, her first side-quest has been acquired! Now, time to commence the mission! [24] Double Trouble To complete [Igor¡¯s Request], Diana must now make her way through the floor to find [3 Large Star Crystals]! Just like its name, a [Large Star Crystal] was a crystal, that was quite big, and shaped like a star. Oh, and no, Igor doesn¡¯t have a really sharp and long nose, just to make that clear. Just like any dungeon floor that has existed in the realm of video gaming, this floor of [Tartarus] was filled with monsters, each of them readily waiting to jump and attack her! Luckily, her training with Rei helped quite a lot in these battles, but there sure were some close encounters! Several minutes after she parted with Igor, when she was just walking around, this bull-shaped robot monster appeared and began charging at her, just like any bull would. Dodging him was pretty easy, but to her surprise, just as she was turning around, a pair of torpedo missiles were charging at her! And they were too close, she couldn¡¯t dodge them! A loud resounding *Boom!* sounded out through the room as smoke exploded outwards. But in the midst of the explosion, a slither of slime managed to make its way under the robot bull, and shot upwards, penetrating into the bull¡¯s metallic body! The corrosion applied instantly, and the effects began to play out, corroding its body from the inside. And then, as the smoke dispersed, Diana could be seen there, still alive, but bruised and slightly burnt in some places. The bull¡¯s eyes flashed red as it prepared to charge once more! But that was not needed, since the bull¡¯s system quickly fell apart as her slime at the bull from the inside. The battle was over, and experience has been gained, but a large chunk of her explosion was sent far away due to those missiles. It wasn¡¯t too much of a bid deal, since she could just meditate and apply her [Slime Mending] to speed up her recovery, but she¡¯s in a dungeon, and being a sitting duck in this kind of place was just inviting Nyx to take her life away. So, she bravely charged onwards, continuing her search for the [Large Star Crystals]! Oh! And also, just when she stumbled upon the first [Large Star Crystal], and was preparing herself to battle against the large golden chalice cup that was the ¡®Sentinel¡¯ Igor warned her about, the walls surrounding her opened up, and a volley of poisonous arrows were shot out! Luckily, those arrows weren¡¯t magical, so she was able to morph into a slime and twist her body to dodge the incoming arrows! Although, her clothes didn¡¯t fare as well as she did, since they got shot and torn apart by the volley of arrows. Now naked, she morphed back to her human form and readied herself for the giant chalice boss! It somewhat reminded her of Yaldabaoth¡¯s first form in Persona 5, but save that for later, the giant chalice was ready to strike! The only attack it had was a high-tier spell in the world of wizardry, aptly named [Judgement]. It was a spell that gathered an intense amount of [Light Magic] into one location, and shot it out at incredible speed, burning away anything that comes in its path! It was a great magic spell to have as an ally, but as an enemy, this spell was devastating! After she saw the power of the spell it unleashed, which she somehow managed to dodge by using some massive slime trickery, she knew that it was a deadly spell that would probably end her life in one go if she wasn¡¯t careful! First up, distraction! The AOE of the spell wasn¡¯t small by any means, but it wasn¡¯t super colossal massive either. And the giant chalice also seems to mainly target the one closest to it, which meant that [Slime Army] should do well here! Morphing into a slime herself, she unleashed a giant wave of slime and gave life to countless Dogoos! When it noticed one Dogoo that was getting slightly too close for comfort, the giant chalice unleased its spell and killed, like, 9 of them in a single blow! But that¡¯s fine! All she needed to do was create even more Dogoos to crowd the room even more! As the chalice was recharging its attack, she ordered her cute Dogoos to swarm the chalice, coating the giant chalice in a cube of slime, and corrosive slime at that! The chalice let out a ¡®cry?¡¯ of pain as it unleashed the half-baked spell it was gathering, causing the slime cube to explode, but there were still more slimes to come to compensate! But the chalice had gotten enough of this annoyance, and unleashed the greatest [Judgement] spell it had even created, completely destroying any and every single drop of slime in its radius! The battlefield was now clear of slimes! The giant chalice ¡®sighed?¡¯ at a job well done and looked around at its-, wait¡­Why was the [Large Star Crystal] missing? No¡­It couldn¡¯t be¡­! It had been tricked!! Diana knew all too well that she was incapable of wounding such a powerful enemy, so she used all the slimes as a distraction, and sneakily made her way to the [Large Star Crystal] and snatched it in the midst of the light show! The chalice ¡®screamed?¡¯ in frustration over its own incompetence. A mere slime girl had tricked it and gotten the upper hand! Now, a third of the quest was complete! 66% of the mission left to complete! Well, she was supposed to look for the second [Large Star Crystal], but looky look! There¡¯s a treasure chest right at that corner! Problem is¡­between her and the chest, was a large gap filled with lava. If she tried to cross it by jumping across, then the dart traps by the side would shoot and impale her with poisonous darts, the flamethrowers on the ceiling would roast her, and her burnt body will fall into the boiling lava~ But such a trap would not stop the slime master that is Diana! Morphing into a slime, she glued her slimy body into the wall, and began to crawl along the wall, skilfully moving through and past the many dart traps, and finally make it onto the other side! Doing a quick JoJo pose as she landed, she giggled for a bit and approached the chest with glee. And inside¡­! Was a red cloak! And a magical cloak with superpowers at that! Sadly, it wasn¡¯t the Cloak Of Levitation, but oh well. When she took out the cloak and put it on, her body felt lighter. She felt as if she almost could just blaze through Konoha in a single flash! And there seems to be a coat of magical residue on the cloak, which was probably for extra defence. Overall, great cloak! 10/10! Ah, but she needed to make her way back first¡­Could she just jump all the way there with her now increased speed?...Nah, the gap¡¯s too wide, she¡¯d probably end up like Chell at the end of Portal 1. So, she went through the painstaking way again, morphing back into a slime, and crawling her way across the wall as she avoided the dart traps, now with the added difficulty of also taking care of her newly acquired cloak as she went. However, this time, she wouldn¡¯t come out so cleanly! ¡°Eep¡­!¡± The edge of her cloak suddenly grazed against one of the dart traps, and, all hell broke loose. All the dart traps fired, the flamethrowers kicked into gears, and the lava began to boil at a rapid pace, causing some flame sparks to emit from the lava! She tried to move again, but the many things that were occurring all at once was becoming too hard to handle, especially with the added stress of keeping her new gear safe from all the stuff! So, with the help of her [Slime Cannon], she shot her magical cloak all the way past the lava and the traps, and onto the floor at the other side! With that, the new gear was safe, but that won¡¯t mean anything if she becomes roasted slime! The poisonous darts were fine, since they couldn¡¯t deal damage to her, but they took up the space she needed to navigate. The only worry were the lava and the flamethrowers. If she gets hit by the flames, then she¡¯ll evaporate. If she touches the lava, then, she evaporates. With the speed of a full-powered Toyota Sprinter Trueno, she twisted and turned her body as she snaked her way across the dart riddled wall, quickly moving past all the traps and the fire!If you discover this narrative on Amazon, be aware that it has been stolen. Please report the violation. But, just as she was about to reach the other side, ¡°Uwah?! M-My hand?!¡± A sudden burst of flames erupted from the flamethrower above her, frying her slimy hand up for dinner time! That loss of concentration also meant getting hit by two poisonous darts, that did no damage, and getting a bit of her body sizzled in the lava. She did make it out alive after all that, but her body was not doing so well¡­ Although she was pretty much able to regenerate any body parts, simply by going to slime form and reshaping her body, but still, she lost her precious HP again! Well, she got this awesome cloak as a reward for her awesomeness, so that¡¯s okay~ With the help of [Alleviation] and [Slime Mending], she sat down and began to heal up, and also recharge her MP and SP battery. Using her [Slime] based techniques at a rapid succession was surprisingly tiring. After that was done, she stood up and donned on her newly acquired magical red cloak. Although her being naked on the inside was slightly uncomfortable, at the least she wasn¡¯t completely naked now. And her magical powers got a boost too! Anyways, back on her mission to track down the last 2 crystals! The journey after that wasn¡¯t all that interesting. She met up with several different monsters, disintegrated them using her [Slime: Corrosive!], and continued on. Ah, but there was one moment when something interesting did happen! Some time after she left that lava pit, she had an encounter with a golem-type enemy. And this one¡¯s an annoying one at that! Using the stone bricks from the nearby walls, the golem was able to infinitely regenerate its lost body parts. Of course, the tactic was simple. Jam in some corrosive slime into it and let it dissolve the core of the tough guy. Problem was, the golem core was immune to corrosion! So, the match was stuck in a deadlock, with the golem attempting to crush Diana up, while Diana was running around the battlefield, using her [Slime Valley] to slip out of tight situations. After a while, she got a bit impatient, and that led to a terrible mistake, causing her to get hit by the golem¡¯s arm! Her body was flung back with intense force, but she was able to morph into a slime quick enough, negating any further damage. And then, she felt something hot, coming from right behind her. Slowly, she turned around, to see the large pit of lava from earlier! And she also saw that her slimy self was quickly heading down towards it! Twisting her body, she was able to safely land back on the ground, but the golem was quickly on her tail. The golem caught sight of her, and was quickly approaching! But then, as the sound of the sizzling lava came into her ears, a brilliant, and very hot idea came into her mind! A plan of pure geniusness has been born! Since her cloak was nearby, she quickly took it and wore it. She¡¯ll need it, since her plan would probably need extra magic power to execute fully. Sadly, her iron wand got crushed by an enemy a while ago, but that¡¯s fine. Just like a man and a bull, she teased the golem to come to her by waving her red cloak around, just to make this guy come here. And come here, he sure did. In fact, since she stepped aside at the last moment, the golem crashed into the wall! Of course, the golem wasn¡¯t damaged at all, and quickly recovered and turned towards its enemy. But the little girl before it seems to be doing something. An incredibly dense ball of slime was floating before her, and the sound of the sizzling lava was- *¡­!* It was then, the golem realised, it f*cked up. ¡°[Slime Railgun]!¡± The newly created [Slime Railgun] fired off at intense speed, quickly closing the gap and crashing into the golem. Such an attack was trivial to an entity like the golem, but the consequence of such an attack was extremely dire! The golem was knocked off its footing, and dropped right into the lava! The golem let out one last attempt at swimming, but his ignorance at his swimming classes caused him to sink into the lava, never to be seen ever again. Her new spell, [Slime Railgun] was, obviously, derived from her [Slime Cannon]. But instead of focusing on the power and density, this new spell focused on intense speed and density, which allowed her to knock the rock hard golem into the lava! [Victory!] ¡°Hmm?¡± I did say earlier that the golem was never to be seen again¡­But guess what? The golem¡¯s core was now floating across the lava! What the hell?! Is that thing resistant to every single type of ailment?! Hmm, now that she had a closer look, the core seems to have lost the light that it previously had as a living golem. Did that mean that the golem was dead, but the core was alive? How was that even possible? The answer, lied in the lava itself! As an example, normally, physical things could not harm Diana¡¯s slime form. This, does not only include physical attacks though! Normal fire, crashing waves of water from the sea, an avalanche, these things could not harm her as a slime! However, if said fire was created from magic instead, then that¡¯s an entirely different story! As long as magic is present, whether in the creation or in the attack itself, Diana will get harmed, no exceptions. The lava in that pit, happens to have been created by magic, which was why it was able to burn Diana, and also why it could destroy that golem¡¯s [Soul]! However, the magical core of a golem was nearly indestructible, with some small exceptions. While the [Soul] residing within it may die, the core itself will keep living on, moving past the grieve and sorrow, and into a new future! That was what happened to-, hmm? Diana seems to have teared up a bit¡­? ¡°S-Such a sad life¡­T-To live on to see your friends die¡­hic¡­¡± ¡­¡­Anyways, that¡¯s what happened to this little core. Now, it was simply a husk, waiting for its next resident to take the space it has provided. ¡®Moved by?¡¯ the sadness of immortality this core had, Diana used her slime as a rope and pulled the core onto the shore. She displayed a ¡®pained?¡¯ smile at the magic core, and continued on her way to the next [Large Star Crystal]. I have no idea what happened there, she wasn¡¯t always that emotional ¡­ Anyways, moving on, after walking around for a bit longer, she began to feel tired, mentally. Her SP was fine and all, but the added stress from that chalice boss fight, to that lava pit nearly killing her, to that golem also nearly killing her was getting to her. So, for the first time, in quite a while I must say, she laid down and slept. She also used the red cloak as a blanket, since the air was quite cold¡­Despite being just metres away from lava. ¡­¡­¡­¡­¡­¡­¡­ After a nice session of pure sleeping, which was surprising since there was monsters in this dungeon, Diana woke up, put on her cloak, and continued on her jour-, ah, and before that, she grabbed her newly acquired magic core, and then left. After some more boring walking, and turning, and fighting, she finally reached the second sentinel! ¡°Woah¡­That looks so cool~!¡± This time, it wasn¡¯t some stupid giant chalice that stayed in one place. Instead! The second sentinel was a large pure white halo, with 6 golden crystals hovering around it! And the crystals were slowly moving around it, almost¡­hypnotically¡­yeah¡­ ¡°Munya~¡­?¡± Uwah~, the halo was slowly moving closer to her¡­But, for some reason, she couldn¡¯t stop watching the crystals, slowly¡­moving¡­and moving¡­and-, uwah?! The halo was already above her!! By the time she came back, the halo was already above her. The battle was already over before it started!! A cylindric shield of light appeared around her, trapping her inside! She tried punching it, kicking it, hitting it, DOOM punching it, but nothing worked! Even her [Slime Cannon] couldn¡¯t break through! Damnit! She got ¡®distracted¡¯ by the spinning of the¡­of the¡­uwah~, staring at the crystals moving around was really niiicee~ And¡­yeah, she got entranced again by the spinning of the crystals. This was, indeed, one of the special powers of the mystical halo. The Halo had three main abilities. One was, the ability to entrance and stop a foe from moving, with Diana as the subject. The second, was to erect a barrier to prevent the foe from escaping. ¡°Hue~¡­¡± ¡­And third, was the ability to charge itself with the ambient mana in the air, and slowly gather them all into the halo, to release a devastating beam attack on its trapped foe! One hit from that, and say goodbye and ascend to the Spirit World. And the halo was already half-way to fully charging itself! ¡°Hue-, hya?! A-Again!!¡± Well, she¡¯s back from the trance! Problem was, the Halo¡¯s half-way done charging, and the sphere of pure concentrated magic power was hovering above her, making escape by jumping away, obviously impossible! Well¡­She¡¯s stuck now. Trying to tank this was impossible, and her slime form wasn¡¯t any help either. Actually, the damage would be even worse as a slime! 3 times more damage in fact! ¡­Meh, you know what? F*ck it. The situation¡¯s not gonna change if she did nothing. [Slime Valley] activated, she morphed into her slime girl form, and then morphed again into a giant cylinder of dense slime. Maybe it¡¯ll soften the impact? Who knows? The Halo simply watched from above as its prey was trying its best to tank the damage. While it wasn¡¯t soul-crushingly powerful, and the AOE definitely wasn¡¯t all that big, since it only destroys the area inside the barrier, but you can bet that it was an insta-kill move! And so, as the last seconds ticked by, the Halo paid its respect towards this prey¡¯s best effort, and unleashed the super beam attack, disintegrating anything and everything inside. Every molecule of the slime within the barrier just went, poof! With the exception of the [Large Star Crystal] and the magic core of course. These things were near damn impossible to destroy! *¡­¡­* There was only silence in the room, with the only sound there being the soft humming of the Halo¡¯s crystals, slowly spinning around. The target, has been eliminated! But then, it noticed an anomaly¡­There were signs of life, in this exact room! ¡°[Slime Wave]!¡± A wave of slime suddenly rose from the side, and crashed into the floating Halo, smashing it down against the cold stone floor! The situation has been flipped! There, from the corner of the room, was Diana! Equipped with her red cloak and everything too! See, Diana¡¯s gotten slightly smarter lately. After her revelation after her training, Diana¡¯s gotten quite adept at using her [Slime] to do many different things, and escape many different clutching situations. When she turned into that giant jelly of slime before, she wasn¡¯t doing that simply because she wanted to tank some of the damage, that wouldn¡¯t work anyways. Instead, she had been using her [Slime: Corrosive!] to slowly dig a path to the corner of the room! She even had some time to pull herself and her cloak to safety too! Of course, or else this novel would be so short~ Now, the glowing¡­pretty¡­and-, no. Now that the Halo was pinned down, she pulled out the [Large Star Crystal] and the magic core. She also snagged the second [Large Star Crystal] the Halo had been guarding. With that, after she ran as quickly as she could away from it, the second [Large Star Crystal] was hers! 66% of quest completed, 33% left to accomplish! Time to reach for the last one! [25] Dianas In Trouble, Again! ¡­Well, she was supposed to search for the last [Large Star Crystal], wasn¡¯t she? To, uh, give it to Igor, right? ¡°But, but, t-treasure!¡± Yes, this damn floor had too many treasures scattered around the place! The first one she found was her awesome red cloak, of course. The second one was this cool looking sword, with a golden emblem on its hilt and stuff! Sadly, she was a magic user, so swords are useless. The third, was this cool set of armour that she found hidden behind a secret wall, which she noticed in an instant due to the uneven padding on the walls. But, speed was her main battle focus, so she had to abandon wearing it. Fifth, was this cool laser cannon that she found by defeating an annoyingly fast laser-shooting bat. A quick [Corrosive Slime Wave] did the trick and defeated it, and this time, she did take the laser cannon, since it was cool and it worked great! The laser cannon was, pretty much a fancy wand, that could only shoot out one spell in its entire shelf life. That spell, being a fast moving death ray that turned anything it touched into dust, including herself. And now, the next treasure was calling out to her! Standing before her, was a giant casing of glass, with a floating orb of darkness in the centre. It looked super edgy and completely evil, but it looked cool, and she at least wanted to touch it! We all know this is a bad idea Surprisingly, smashing the glass casing apart was quite easy. I say easy, because she now had the laser cannon, with the added magic bonus from her red cloak. The glass just went up and, like, melted into, uh, molten glass¡­Yeah¡­ Anyways, with this, the black orb of pure darkness was ready for her taking! Little did she know, when she went up to touch it, the orb of darkness cracked, and a stream of dark energy burst out uncontrollably. It shocked her for a bit, and she closed her eyes from reflex, since, ya know, it looked super evil and edgy. But, nothing, really happened. She opened her eyes after a while and¡­she was just, standing inside the black miasma. Well, actually, this was supposed to be a test of the spirit and the mind, challenging anyone who dared to touch it with a thick miasma that would bring out their greatest fears and terrors. If one failed to challenge, their soul and body would be eaten alive, leaving nothing behind. But, sadly for the creator of this orb thingy, Diana was a dumbass, and also someone who wasn¡¯t really truly scared by anything. Along with the added bonus of her title as the [Soul Conqueror], consuming her soul was as impossible as Oda reviving back Whitebeard. So, since the orb saw her as being ¡®Worthy¡¯ to accept the reward, the miasma thickened, and the surroundings around her changed. The miasma seeped away, and she found herself standing within a corridor that seemed to extend for¡­forever. The wall, floor, and ceiling were a checkerboard of red and black squares, with several posters hanged up on the two sides of the walls. It kinda reminded her of that room Soul went into every time he went into that weird dream-like place. Anyways, she started to walk through the corridor, reading through each of the posters as she went along. Although, after a while, she realised that she just read the same poster as before, which meant that she just looped this corridor. After she had some fun by running a never-ending marathon for a while, she decided to give it a rest and actually count how many different posters there are before they start to loop again. Some terrible mental arithmetic later, ¡®Hmm¡­There are 15 different posters¡­¡¯ And each of those posters had a different cute picture too! Alright, I¡¯ll just list it all down:
  1. A picture of her in slime form, just chibified.
  2. A picture of a knife¡­Yeah, just that.
  3. A picture of a slime ball, with, uh, mana swirling, around it?
  4. A picture of a guy, also chibified, wearing a white hood while holding a dagger.
  5. A picture of someone, who was bald, and also chibified, meditating.
  6. A picture of¡­cooking utensils? Da hell?
  7. A picture of a human body with some curvy lines drawn within the body. Just think that picture of a shinobi¡¯s chakra flow from Naruto.
  8. A picture of, a group of bubbles, with the weird swirling mana again.
  9. A picture of a slime ball, but with green plus signs all around it.
  10. A picture of her awesomely cute Dogoo army.
  11. A picture of an energy symbol, that was on fire, for some reason.
  12. A picture of Chibi Diana looking super scared because of, something?
  13. A picture of Chibi Diana giving some food to a chibi wolf and petting it. Heh, that¡¯s cute.
  14. A picture of a collection of spears, glaives, and poles.
  15. And finally! A picture of a slime ball, but oozing with some green toxic waste.
Phew, that was all of it, all of it! Man, was she tired on trying to look through every single one of them! But it was worth it, since some of them were super cute, like poster 13. Oh my God, that chibi wolf looks so cute~ Ahem, a-anyways, what¡¯s the reason for these posters again? I mean, some are cute looking, and some look just, plain. But the rest are just¡­odd. Like, cooking utensils? What? Was she a chef or what?......Wait¡­Chef¡­Cooks¡­Cooking¡­! Cooking skill! Then! Piece two and two together, and bam! She realised what these posters were representing! That¡¯s right, each of these posters were an illustration of her skills! And it just so happens, that her current skill set consisted of 15 different skills, and each skill had a poster that it could relate to! ¡­No, wait. If so, then what¡¯s the reason to bring her here? There must be more to this place, right? She pondered so as she leaned on the wall, accidentally placing her hands over one of the posters. Then, this appeared. [Do you wish to [Evolve] the skill [Energy Burn]? Yes/No] ¡°E-Eh? Uh, e-eh?¡± [Evolve]¡­That¡¯s what it reads, right? W-Wait, skills can evolve then?! Then¡­She could pick which skill she wanted to evolve, didn¡¯t she? Wow, how generous. Oh, and, she clicked on no for that one. [Energy Burn] wasn¡¯t something she uses often anyways. Sorry~ Does she only get one chance with this? Well, she might have two chances, but she won¡¯t take any chances, if she uses this one on a stupid skill by accident, then, well, that¡¯d suck. So, she thought about it carefully, weighing over which skill she preferred the most. But, after a while, she could only come back to her roots, back to where it all began. The skill, that began her slimy journey through this landscape. The one that had carried her along, and had saved her many times. Even if she denied it at first, without any doubt, this was one of her most useful, if not, the most useful skill in her arsenal. ¡®Yeah¡­It needs to be this one.¡¯ [Do you wish to [Evolve] the skill [Slime Valley]? Yes/No] ¡°Yes please~!¡± [¡­Payment Required. You must sacrifice two skills to proceed] ¡­EH? Was she reading that right? She needed to give away two different skills to evolve her [Slime Valley] to the next stage? Man, that sucks! Was what she thought when she read that, but then, another thought struck her head.Support creative writers by reading their stories on Royal Road, not stolen versions. Now that she was reminded of her 15 skills, she realised just how many of them were just red herrings sitting there disguised as ¡®Useful¡¯ skills. Giving up two useless skills should be fine, in fact, that¡¯ll free up some space, so her status screen wouldn¡¯t be as crowded! [[Knife Mastery] and [Energy Burn] has been selected. Do you wish to continue?] ¡°Count me in!¡± And then, the magical moment arrived! Her two ¡®useless¡¯ skills suddenly just went *Poof*, leaving behind an odd tingling feeling in her tummy. But, the return she got was much better than those two skills! [Slimic Sublimation] Lv 1/25 Allows you to morph into a slime. As a slime, all your stats are boosted by 75% There are no longer any MP and SP penalties for staying as a slime, or when getting hit. Density, transparency, and elasticity are all changeable factors. You are now able to turn only some parts of yourself into a slime, but stats bonus does not apply. As a slime, any physical damage you receive will be nullified. You still receive 300% more damage against magical attacks. ¡°Your inner slime has now risen! Now, take to the world and spread your love~!¡± ¡°¡­¡­Well then! That¡¯s awesome!¡± ¡­Well, that was¡­quite a long list of bonuses and demerits¡­Damn, did this skill change quite a bit after its evolution! First, no more MP or SP lost while in slime form, and no MP or SP are taken away when hit?! That¡¯s awesome! Secondly, she¡¯s able to partially turn into a slime now! Now, she a pure Slime Slime Logia fruit user! One Piece, here she comes!...Ahem. But, well, that last line though¡­Well, guess it wasn¡¯t any better than ¡°Harness your inner slime girl and go *Kupyu~!*¡± or whatever. Well, she¡¯ll just treat that as some extra flavour text, for now. ¡­Oh, and how was she supposed to leave now? [Do you wish to leave?] Ah! Speaking of leaving, that text just conveniently appeared before her eyes just as she was thinking of leaving. And she should really be leaving, since her quest that Igor gave her was still incomplete¡­But¡­She wanted to look around a bit more¡­ Meh, Igor can wait. Side-quests usually pretty long, so he can probably wait patiently, sit down, drink some tea, maybe talk with some of the residents of the Velvet room while he¡¯s at it. She¡¯s quite interested in this room itself. Like, she was pretty sure that she just got swallowed up by a sea of black miasma, so how did she even end up here? And what or where is this place? Who created it? For what purpose? So. Many. Questions! After fiddling around a bit, searching around for any gaps, taking down and looking behind the posters, trying to slime her way out, she found out, that she could do absolutely nothing. This corridor was completely foolproof! So, with a heavy sign and a shrug, she called out for that [Do you wish to leave?] text again, and said yes. And just like MCU¡¯s Bifrost, a beam of rainbow light came down on her, and took her out. The thing is¡­ ¡°¡­Where the hell is this?!¡± W-Wait a sec, this wasn¡¯t on the floor she was just sat. Heck, she didn¡¯t even know if this was Tartarus or not! This was more like a Minecraft Stronghold! The walls were built out of stone bricks, some moldy, some cracked, and most are humid and wet. There was some lighting thankfully, with a torch or two in each room. The layout was, similar, to the floors of Tartarus, with many different rooms that connected to one another. But the atmosphere, and the feel of this place was just¡­eerie. Not that Tartarus was any less eerie, but this place was even more so. And then, she heard¡­g-giggles, coming from, somewhere. ¡®Oh¡­Oh no¡­¡¯ She has a bad feeling about this~. And with each passing seconds, those giggles grew even louder, with the sounds of splashing water accompanying it. Her Ultra Instinct Alarm rang with intense speed! And then, she saw¡­a group of, women? Eh? What? She thought that they were some kind of monstrous beings, or ghosts, that took the shape and the sounds of young women. But¡­They were all, real women! *Mind Blown* They were walking into the room she was just in, chatting and giggling as they carried what appeared to be jars of water on their heads. Luckily, using her slimy espionage skills, she was able to sneak out of the room unnoticed. Or so she thought. Suddenly, they stopped walking. Their giggles stopped, and their body went stiff. Slowly, they cocked their heads around, and- *GGUUUAUAAAAAUAUAUUAAA* ¡°Hya?!¡± A horrifying scream was let out, as their faces and bodies morphed and twisted in many, painful looking ways. Their skinned darkened, and their eyes gleamed purple. A purple smoke began to ooze out of their skin. Without looking back, her mind went into full ¡®NOPE¡¯ mode and ran away. Of course, these horrifying creatures were not stupid programmed AI, so they hissed with a sound unpleasant to any ears and chased after her, with incredible speed to boot! *GGGGUUUAAAUAUUAAUAAAAA* The screams of absolute horror resounded through the rooms as the three ¡®sisters¡¯ searched for their prey. They had just followed it into a new room, but, to their surprise, there wasn¡¯t anyone, or anything there. After looking around some more, they grew bored of trying to find her, morphed back into their pleasant female forms, and then marched back to retrieve a new set of water-filled jars. Slowly, a puddle of slime descended from the ceiling, along with its red cape, and jumbled together back into Diana. Well, she was still in her slime form, since it seems like those things were ultra sensitive to sound and smell. ¡°¡­well¡­sh*t.¡± ¡­¡­¡­¡­¡­¡­¡­ Meanwhile, as Diana was just realising how f*cked she was, within the confines of Tartarus, Rei was going around, absolutely wrecking and one punching every single thing she comes across. She was already fast and strong to begin with. Now, add that with her previously acquired gauntlets, a ring that increased her attack power, and you get absolute chaos and domination throughout the battlefield! Just like everyone else, Rei was on her journey to reach the bottom, where she would most likely meet back with the rest of her friends. Well, just Diana was fine, but the others too. *BAM!* And, there goes down another giant 6-legged lion. Poor little thing~, its stomach was blown open, its body was broken and bruised all over, and its face was just the pure culmination of utter and open ¡®¡­What the f*ck?¡¯. After she had her meal, she continued on, punching and annihilating anything that came into her line of sight. But then, just as she was about to head back for the stairs, her eyes caught something, a hole that led to an entirely different area from here! ¡°¡­?¡± Being intrigued by it, and also by that odd smell of human blood, she decided to wait off on going further in and headed into this secret room. And, just like she expected, all around the walls were a heap of human remains, and frozen blood. Well, she was a ghoul, so this sight wasn¡¯t something to be scared about. From what she could see, these people that had been thrown into here, were most likely previous adventurers that ventured into this place, just like she did. But unlike her, they didn¡¯t survive. ¡°Beautiful, isn¡¯t it~?¡± ¡°¡­!¡± But then! Out from the shadows, came a woman. Her beautiful golden hair and mystic purple eyes. Her curvy body and alluring aura, her sultry voice and enticing look that invited many oblivious adventurers to their untimely deaths. Of course, Rei was a ghoul, so such attractions wouldn¡¯t work on her. If anything, the smell of blood in her surroundings were much more alluring than this mysterious woman who just suddenly appeared out of nowhere. ¡°My~, how rude of me. My name, is Helen. What might your name be, my child~?¡± ¡°¡­¡­¡­¡­Rei.¡± ¡°Oho~! Such a cute name! Was it your name before you became what you are now?¡± ¡°¡­Given.¡± ¡°I see~, but I already knew that.¡± ¡°¡­!¡± Suddenly, her alluring aura dissipated, as if it never existed in the first place. Her smile disappeared, and her eyes grew cold, as if she was a predator that had just found its prey. ¡°Say, why don¡¯t we eat these men together? They make a fine meal, no~?¡± The woman offered with a devilish smile. This was probably her intentions from the start, to lure her in here, get her to start eating and ripping apart the corpses of these men, and then she would come to devour her. But, her plan didn¡¯t turn out as she expected. When Rei came in, while she did have an interested look at the human corpses, she wasn¡¯t eating them on sight. Even Rei herself was unsure as to why that is. It was the nature of her kind, was it not? Fearing that she would soon leave, Helen quickly stepped out of the shadows to greet her, just like how Loki did in the first Avengers movie. Her plan was to, of course, distract and tempt her, so that she could have a fine meal for the day. But, ¡°¡­No.¡± Rei answered with absolute determination! Helen was shaken to her core! She knew, from her first glance, that this girl before her was a ghoul, an eater of mankind. And yet! Why was she not interested in these human corpses?! ¡°W-Why¡­?¡± She couldn¡¯t find it, she couldn¡¯t see why! She had prepared a mountain of food, and yet her prey wasn¡¯t tempted! Where could she have gone wrong?! But with unwavering spirit, Rei closed the gap between them, and delivered her answer! ¡°¡­Too, rotten.¡± ¡°¡­¡­Eh?¡± An answer, so true yet so bizarre. Helen could only take a step back, her face twisted in shock! Sadly, if she had just borrowed some salt from Reigen, this calamitous problem would not have happened. Because now, ¡°¡­Meal.¡± ¡°H-Hii!!¡± The tables, have been turned! *Puchi!* ¡°G¡­Guha¡­gaha¡­¡± In a speed her eyes couldn¡¯t comprehend, Rei¡¯s clawed hand moved, and stabbed right through her abdomen. A fountain of blood poured out from her wound, as Helen could only look on in shock and disbelief, before she finally collapses. And then, just as she did with so many enemies before her, she kneeled down, and began ripping and eating through the remains of what was a fearsome enemy. After she wiped off all the remaining blood on her chin, she turned around and left the room, leaving behind the rotten mountain of corpses. Little did she know, that a change had begun to occur inside her, but such an event would have to patiently wait in hiding, before the fruits of its labour could finally be shown. The seeds of change, has been planted. What the¡­That ending got weird. [26] Im Waiting [Ghouls] They are horrid creatures, forever living without any will or purpose of their own. They run rampant, driven only by their own desires. They are the dead, who did not gain the soft pleasure of death. To men, they are known as the embodiments of desires, of the lust and greed of a man that drives them to surrender to their sinful acts. Stories have been written, time and time again, their tales further diluted by time. Ghouls are naturally, monsters. They are the evolved state of a normal zombie. While zombies themselves are common to the point of becoming a nuisance, it is quite rare to see a zombie that successfully evolves into a ghoul. Mainly because they are hunted before they get the chance to. Beyond being a ghoul, there are several rumoured paths that it could take as an evolution. One such path, is the infamous vampire, a being that steals the lives of men and drink under a banquet of blood. That said, it was quite clear that Rei was slightly different from the casual variants. Unlike those unrefined beings that simply feed on the bodies of the dead, Rei doesn¡¯t choose her prey by random and has a sense of taste, even going so far as having some knowledge on human food. However, even Rei herself didn¡¯t know why she does that, or rather, couldn¡¯t remember why. Her past life as a living being had been convoluted and blurred. How long has she been alive? When was she born? How did she end up at the withered forest? These were all questions that she could not answer. All that she knows, was that she was a ghoul when she came to, she had probably lived for a long while, and that she likes to eat, a lot! She¡¯s seen humans come and go, maybe occasionally interrupt their pleasant time and send them to meet Eiki, with Diana being the first human she hasn¡¯t killed off in a while. Then again, Diana wasn¡¯t exactly human, was she? ¡°¡­Die.¡± But! Let¡¯s save that for later, shall we? The poor zombie¡¯s head that she had just chopped off earlier was gracefully dancing in the air. She wasn¡¯t the hungry as of yet, since she just ate, like, 5 minutes ago. Averting her eyes from her fallen foe, she turned around and ran back towards the exit. The faster she was, the faster she would meet up with Diana, and the sooner she could get to tasting some of her cooking! Well, that¡¯s what Diana promised her anyways. Well, thoughts for yummy food comes later. Right now, this floor¡¯s guardian was in her way, and she needed to get ready to pound it back down to dust! Time to *Wuuann Puuaancchh!!* ¡­¡­¡­¡­¡­¡­¡­¡­ Meanwhile, back with Diana, ¡°UUUAAHH!! GEETT AAAWWAAAYY!!!!¡± *GGGUUAAAUUAUUAUAAAAUUAAAA!!!* Right now, both Diana and her assailant were having a nice game of tag. Just, instead of being it if she got caught, her entire body will get eaten! Well, if she slimed away fast enough, she should be able to survive, but that¡¯s scary! And, as her screams got louder, even more of the ¡®sisters¡¯ came to play along! By the time she looked back, there was a resounding total of 25 of these monsters chasing her slimy tail! ¡°[S-SLIME WAVEEEE]!!!!!!¡± *GGGUUUAAAGAUA???!!!* In her desperation, she stomped her feet down and sent a giant wave of slimy matter onto the incoming monsters! And it worked-, for the most part. Out of the 25 total, 11 of them managed to evade in the confusion and continue chasing her! And then, as she entered the next room, a large gap stood between her and the door leading to the next. Looking down, the bottom of the pit was filled with, a-are those human bones?! *GGGGUUUAAAAA!!* Sh*t! No time to think now! Fully using her newly upgraded skill, [Slimic Sublimation], she pretty much cheated the jump by creeping up the walls and around the gap. She even did a graceful landing and donned her cloak back on- ¡°T-They can jump too?!¡± To her not so pleasant surprise, the ¡®sisters¡¯ were able to jump across the gap, and with insane speeds too! Did she need to- *BAM! BAM! BAM! BAM!* Suddenly, to both their surprise, a sudden collage of gunshots could be heard coming from behind her. And then, a stream of bullets came flying past her, and shot right through the heads of all 11 monsters! Without any strength, they all lost their speed and plummeted down into the depths. ¡°W-Wha?!¡± Turning around, she was almost ready to burst into tears, because, there, standing with what seems to be a modern-day rifle, a young woman could be seen! Yes, that¡¯s right, another human being! ¡°Hua¡­ha¡­? Hya¡­?¡± ¡°Oya, you sure look dead. Are you going to be okay?¡± ¡°Nya¡­? Uh, y-yeah. J-Just, how¡­?¡± Diana was at a complete loss of words! This time, not because of happiness and gratitude, but at utter shock and disbelief, as she eyed that mystical mechanical weapon she was casually holding in her arms. Perhaps, it was a sense of sudden recollection. It¡¯s not like, after she was finished a pop quiz, find herself brought into another world, live as the opposite sex, see and battle against monsters, use magic, turn into a slime, and witness all these amazing things would she ever expect to suddenly encounter a weapon of murder from her previous life. She would-, no, anyone would be shaken. ¡°Hey, wanna sit down for a bit?¡± ¡°Ah, uh, y-yeah! That¡¯ll be nice, un.¡± ¡°Are you thirsty or something? Need some Pocari?¡± ¡°W-What?! E-Even that too?!¡± Ayaya?! What¡¯s with all these modern-day earth items?! Wait, those on her belt, are those grenades?! ¡°W-W-Who are you?!¡± ¡°Mu? Me? The name¡¯s Nestra. Pleasure in meeting you, Diana.¡± ¡°Hunya?! A-And you know my name too?! How?!¡± ¡°Oya? Did you not sense me coming? Muu~, I guess I¡¯m like¡­A support NPC in a shooter? This place created me in your image as your personal helper.¡± ¡°And using game terms too?!¡± Well then~! It seems like this dungeon wasn¡¯t playing around! Because it probably knew that Diana her was way too weak for these guys, the ¡®spirit¡¯ of the dungeon decided to help her and send in her backup! Which means-! ¡°T-Then! You¡¯re here to help me?!¡± ¡°There you go, Diana! Finally see the full picture I see!¡± It was at that moment, that Diana finally broke down, and cried her tears out. Sadly, Nestra wasn¡¯t born with any tissue boxes at her disposal, so she couldn¡¯t give any to her. Some time after crying and drinking some Pocari, ¡°S-So¡­You¡¯re made in my¡­image, right?¡± ¡°Y-Yep! Pretty much!¡± ¡°Does that¡­make you¡­me?¡± ¡°Well¡­not, exactly? How should I say it¡­Umm, okay, uh, so I¡¯m made, not exactly in your image, but something close to, it? I suppose? I don¡¯t really know either. The creator seems to imply that I¡¯m some sort of alternate personality.¡±This book''s true home is on another platform. Check it out there for the real experience. ¡°He~? So, who¡¯s this ¡®Creator¡¯ guy?¡± ¡°It¡¯s the narrator.¡± ¡­¡­Ah, sh*t. I forgot about that. This ¡®Creator¡¯ of theirs made Nestra in Diana¡¯s image, which meant that the personality traits, likes and dislikes, and even the jokes and the references she makes are quite similar to hers. Which then also means, ¡°EH?! You know if that guy too?!¡± ¡°Well, yeah! Since you have a strange aptitude at breaking through the fourth wall and directly talking to that guy, it seems I have that ability too.¡± ¡°Hehe~, Neptune taught me the ways!¡± Well, fourth wall breaching aside, that also meant that Diana now had 3 alternate personalities. One is, the original 616 Diana, the second was the lonely sign, Sig, and the newest instalment was Nestra! But, this was no time to be joking around. There were still many of those monsters walking around, and their talk from before should have caught the attention of several of them. They needed to make their move! ¡°Follow me.¡± ¡°Un.¡± Now this truly feels like role-playing as Solid Snake! Making their way around elaborate areas(This labyrinth), stealthily moving around and taking down the enemy(Those monsters), and trying to reach the exit(The portal back home). Just, Diana¡¯s being the escort target this time. Also, it was quite sad to see that Nestra was pretty much getting a [HEADSHOT] every time she fires her rifle. Anything that came in their way, whether it be the still pleasant female version, or the terrifying monster version, they were all eliminated in style. It kinda reminds her of her previous life back as ¡®ProDavin888¡¯. Ah~, good times~ ¡°Umm¡­Nestra?¡± ¡°Yeah? What¡¯s up?¡± ¡°Can I¡­uh, borrow a gun? So, you know, I can help?¡± At first, seeing the heads of those monstrous beings was quite fun and exciting, but over time, she began to feel sad, and then she begun to feel depressed too. Being a gamer, and a master class sniper, seeing someone else take her job was kinda¡­saddening. Sadly, the answer was, ¡°Not this time. These guns use up the ammo I have, so save all the shooting to me!¡± ¡°U-Umu¡­¡± ¡°And besides, you don¡¯t have the [Shooting] skill, do you? Mine¡¯s at level 7, so my DPS is higher than yours.¡± ¡°¡­¡­Umu¡­¡­¡± Pretty sure she cried a little bit there on the inside, because, one, she has the [Shooting] skill, and two, she¡¯s already at level 7 at that thing! The DPS output that rifle can dish out must be insane! Well, that explains why every single head she snipes turn into a puddle of goo. If only she didn''t lose all her stuff when she teleported, especially that laser cannon! But, as they were walking on, she began to have a suspicion about something. ¡°Hey, Nestra. How many of these monsters are there?¡± ¡°Umm~, pretty sure they respawn every 5 minutes or so.¡± Uwah~, that¡¯s bad! That means that the numbers of these monsters are practically infinite! But, even worse that that, since Nestra¡¯s doing all the killing, all the potential Exp she could get from these things are being lost! ¡°Nestra, can I fight too?¡± ¡°Well¡­I don¡¯t suggest it. I mean, your specialty is turning into a slime, right? If you¡¯re caught, then you won¡¯t be able to respawn, you know?¡± ¡°Eh? But why? I can just slime out!¡± ¡°Nu-uh, I don¡¯t think so. Their Bite attacks also have a cloak of magic on it, so even if you turn into a slime, it¡¯ll still damage you. Actually, it¡¯s completely covered in magic, so, just don¡¯t get hit.¡± ¡°Muu¡­¡± And so, she continued to feel depressed for about 30 minutes after that. ¡­¡­¡­¡­¡­¡­¡­ ¡°Whoa~, what¡¯s this place~?!¡± ¡°It¡¯s a science lab, obviously.¡± It¡¯s been about¡­2 hours, I¡¯d say, and Diana and Nestra had found themselves quite an interesting room. It was a room that definitely did not fit in with the theme of a normal labyrinth, a sci-fi fan¡¯s dream, a futuristic science lab! Everything about it was sci-fi! It¡¯s wall was seemingly made out of titanium, the lights were full on LED, there were rows of tables with stuff on them, and there were even several large titanium test tubes at the back, big enough to fit two or three humans even! ¡°Hey, hey~! Can we look around?¡± ¡°Well, sure. I might get to get some ammo drops from those loot boxes at the side.¡± Abandoning their goal for a moment, Diana and Nestra split up and began searching around the science lab. Nestra was going towards the many sci-fi themed boxes, to try and replenish her supplies. Diana was just, looking around, I suppose. ¡°Ho? This looks dangerous.¡± Right now, Diana was having fun looking around at the tables, particularly the many tubes of chemicals that was placed there. One of those tubes, happen to contain some sort of black liquid, that seems to be, moving. She was somewhat curious as to what would happen if she shattered the chemical tube, but an alien entity might jump out and try to eat her soft face, so, no thanks. *GGUUUAAAUAAA!!* ¡°! Diana! Behind you!¡± ¡°Hya?!¡± Actually, forget it! She¡¯s taking that evil-looking vial, and throwing it into the mouth of the monster! *Pasha!* The grass shattered and the liquid fell into the monster¡¯s mouth¡­Actually, it looks absolutely fine. ¡­Eh? The monster was beginning to glow. A-Actually, the monster was growing in size! Oh no¡­Did that vial enhance the monster?! Did she just bring about the doom of Nestra and herself?! *GGGGUUUUUAAAAAUAUUAUAAAUUAAAAUAUUA!!!!!* Damnit all! She needed to do something, fast! In a frenzy, Diana picked out as many chemical vials she could from around her, and threw them all into the monster¡¯s mouth. Umm¡­The monster just changed colour¡­And its claw was growing in size¡­It was radiating an intense amount of energy¡­And, uh, did it just grow 4 sets of eyes?! What kind of monstrosity did she just create on the fly?! ¡°Damn! Diana! Get in one of those test tubes!¡± ¡°E-Eh?!¡± *GGGGUUUAUUAUUUAUUUAUAUAUAUAUUAAAAAUUUUAAA!!!!* She tried to move, but her legs wouldn¡¯t respond. This wasn¡¯t just some boss, this was something she created, and something that could very well end her in one swipe. Careful or not, strong or not, fast or not, this thing will destroy her. It was the perfect enemy to kill her. That was when it hit her. ¡®Kill¡¯, this thing will kill her. Her slime form was useless, the ground below her was titanium, rendering her corrosion useless. The bullets Nestra was firing didn¡¯t even put a single dent on it. This thing, will kill her, and she will die. ¡°Diana!!¡± ¡°¡­!¡± No! Not yet! Not like this! If she was to die, then make it some final boss, not like this! She has people waiting for her, her slimy pet was waiting for her, Nestra was calling for her! She will not, fall here! ¡°DIANA!!!¡± Standing up, she grit her teeth, and ran as fast as she could! She ran, and ran, and ran, and- *BOOOOOOOOOM!!!!!!* ¡°DIANA!!!!!¡± But it was too late, the gigantic monster¡¯s arm was brought down, and crushed Diana. An attack multitudes stronger than anything she had ever felt before, crushed her, and destroyed her. There was nothing left. ¡°¡­¡­¡­¡± *¡­¡­¡­* Silence, with only the soft hiss of the aftermath filling the atmosphere. With nothing else to see, the beast turned around and left the room, leaving behind Nestra, who was hiding inside the test tube, and an enormous hole in the ground. ¡­¡­¡­¡­¡­¡­¡­ Seconds before the calamity, Rei was in her usual mood, tearing through the monsters on this new floor she was exploring, and eating up her gathered food when she became hungry. Then, it happened. *BOOOOOOOOOM!!!!!!* ¡°¡­!¡± The ground shook, the earth trembled, as a shockwave of continental scale was sent out, pulsing in every direction. The entire tower of Tartarus shook. Everyone could feel it. Rei, Crystal, Nestra, the three judges, Igor, and even Slimey who was trapped. For Rei particularly, the effect was incredibly strong, since she was technically the closest to the blast. Then, she caught sight of the monsters of this floor, running away in a frenzy. And behind them, were the monsters that Diana had fought against just then! ¡°¡­Enemy!¡± Whatever caused that ginormous attack, must be very strong. And if these guys were running away, that meant, that the beast was heading this way. And if so, she needed to leave. And she was about to, until a familiar smell came in. ¡°¡­This, is!¡± Yeah, no doubt about it! It was the smell of Diana, and also blood, lots of it. The friend she had been looking for, was close! But, there was still an entire army of monsters heading her way, so it¡¯s time to bulldoze through! Using the full potential of her *Ora*¡¯s, she punched, kicked, and rammed her way through the first wave of random enemies, before she finally made contact with these dark vile-looking creatures. Rei was, very fair, and gave the same treatment to everyone, which meant that she was also going to send these suckers up into the afterlife! She ran, and ran, and ran, and ran. Monster after monster, fist after fist, she slowly made her way through the enormous wave of unending enemies. Until finally, she saw her, Diana! But- ¡°¡­Diana?¡± Her body was bruised everywhere. An arm and a leg of hers had gotten torn off, most likely because some jerk monster was eating on her before that enemy wave happened. She was bleeding from, everywhere, and she was sinking into her own puddle of blood. Rei got closer, but there was no answer. She touched and called for her, but her mouth didn¡¯t move. She patted her and pinched her cheeks, but her body didn¡¯t move. She tried feeling for any warmth, but it was cold. She couldn¡¯t understand it. Why was she not answering? Usually, she would reply back with a smile, a shriek of surprise, or something else, but why wasn¡¯t she moving at all? Could she have fallen prey to these monsters? Just like those men from before did to that woman? Was Diana now only a corpse? No, that can¡¯t be! She¡¯s a slime! She can just revert back! But, nothing. No sounds, no movement, no signs, nothing. Does that mean, Diana was now only, a meal? ¡°¡­!¡± No! She couldn¡¯t think that! Diana promised her to cook some of those food she talked about from before! She couldn¡¯t just leave like that! It couldn¡¯t end like this! She wanted to try eating ice cream, hot dogs, and go to this place called America! ¡°Diana.¡± She continued to call for her. Diana. Diana. Diana. She called over and over again, waiting for the reply. She needed, to wake, up! ¡°Wake, up.¡± ¡°Wake¡­up.¡± ¡°Wake¡­¡­up.¡± Why? Why was she ignoring her? Did she do something wrong? Was she too late? Did she take too much time? Was she in the wrong for telling her about this place? Was it her mistake to reply to Slimey¡¯s comment? Was it her mistake¡­for meeting them? ¡°¡­¡­¡± What was this, heavy feeling? Somehow, did this place, just get darker? This, pain in her chest, what was it? It felt¡­familiar. Somehow, everything was getting, heavy. Her arms, her legs, her body, and her heart. *Guuuuu* She looked back up, and there, there, along, was a single wolf. It was eyeing Diana¡¯s cold body, and drool was coming out of its mouth. Its eyes were glaring red, full of hunger. Before she knew it, her body moved, and stabbed her hands right through the wolf. Hot. She wasn¡¯t feeling heavy again, but everything was hot. Scorching hot. What was happening to her? Was she becoming sick? Her mind, body, and soul, everything was hot. And then, she felt it, hunger. And there, sinking into her own pool of blood, the perfect meal could be seen. Slowly, she walked to her. She kneeled down, And waited, for her friend to, wake up. ¡°¡­I¡¯m, waiting.¡± [27] To Save Diana! How long has it been since she first got here? How much time has she spent¡­waiting for Diana to, wake up? Will she ever wake up? Could this be it¡­for her? ¡°¡­No.¡± No! Not yet! She might be sinking into her own pool of blood right now, but she¡¯s a slime! She doesn¡¯t need blood to live¡­does she? Actually, can¡¯t she just turn her into a zombie? That way, she¡¯ll be alive, and she wouldn¡¯t ever need to worry about dying anymore! If that happens, then everyone wins! But¡­ ¨CWill she still be the same? When humans are transformed into zombies, it¡¯s widely known that their ego breaks down along with their mind, leaving nothing but an empty husk, living on with no sense of purpose or will of their own. ¨CBut she¡¯ll be alive, wouldn¡¯t she? But could she still call that living? If you¡¯re alive, but you don¡¯t think, can that still be called being alive? Rei was lucky to have some of her old personality stick through her after she was reborn, but would Diana get the same treatment? If she transforms her, will she still¡­be Diana? ¡°DIANA!!!¡± ¡°¡­!¡± Suddenly, from the distance, Rei heard someone else call the name of her friend. It was a woman, wearing an outfit that Rei had never seen before. In her hands was a weapon of some kind, and on her belt hanged many objects that was foreign to her. And the smell of this ¡®person¡¯, wasn¡¯t pleasant. It smelled the same, as this damned dungeon. She couldn¡¯t let anyone close to her, not even one! She¡¯ll wait here by her side, until she wakes up! ¡°Hya?! W-Wait, Rei! I¡¯m not an enemy!!¡± ¡°¡­?¡± She was ready to strike her claws at her, but to her surprise, the ¡®woman¡¯ raised her arms into the air and called out. And, for some reason, this woman knew her name, the name that Diana had given her. ¡°¡­!¡± Actually, after she felt her scent some more, wasn¡¯t her smell similar to Diana¡¯s?! How could this be?! Her face was different, her features were different, and her voice was different, but, somehow, the aura and her smell were¡­similar to hers. ¡°I-Is she okay?!¡± ¡°¡­Waiting.¡± She couldn¡¯t figure out if she was an enemy or not, but she¡¯ll allow her to come close. If she turns out to be enemy, then she¡¯ll make sure she¡¯ll never leave here alive. ¡°N-No¡­Diana¡­¡± Nestra came as fast as she could, but now, she could only look on in horror, as the person she was meant to protect, was lying down into her own blood. An arm and a leg of hers were missing, her face was dirty and bloodied, her magical red cloak was torn apart. She pressed her hands on her cheek. It was cold, but- ¡®There¡¯s still some left!¡¯ It wasn¡¯t as cold as a corpse, which could only mean one thing! Her body may have died, and her blood might be everywhere, but she wasn¡¯t completely dead yet! ¡°But¡­How¡­?¡± Even if she had the ability to turn into a slime, she was still a human nonetheless. If that¡¯s the case, then how was this possible? ¡°¡­Mana.¡± ¡°Eh? What do you¡­I see!¡± No, Rei¡¯s right! This wasn¡¯t Earth, so normal earthly logic wouldn¡¯t work in this fantastical world. Her blood might have left her body, and she herself might not be conscious of it, but her Mana was still there! But, it won¡¯t stay like that forever. Even now, since her consciousness was floating somewhere else, her mana wasn¡¯t being kept in, and was seeping out into the air around her. If she can¡¯t stop that outflow, all her mana will disappear, and with that, ¨CShe¡¯ll die. To make matters worse, this entire prison was in chaos right now. The beast that Diana had helped to create was now rampaging through the underground tower, and the three judges were thrown into chaos. The walls were breaking down, and an enormous amount of magic was dangerously leaking into the outside world. It doesn¡¯t stop there. That monster will eat and absorb everything it comes across. Monsters, people, even its own kin. When that happens, it grows larger and larger, more powerful as more mana circulates within it. And once that beast eats the three judges, and destroys this tower, they will be next. They needed to get out of here, FAST. ¡°Rei! Protect Diana for a sec!¡± ¡°¡­¡­¡­¡­Un.¡± But, her own safety and escape comes later. Right now, she needed to save the person she was created to protect. Luckily, as she was descending down this broken dungeon, she was able to scavenge some mana potions, so this should help prolong the timer for a bit! Although, she had to force feed it a bit, since Diana was, dying and all. ¡°Rei! You can sense mana, right?! How¡¯s Diana doing?!¡± ¡°¡­¡­Mana, fill¡­But, leaking.¡± It worked! It was still leaking out, so Nestra pulled Diana out from her pool of blood and cleaned her up. She wiped the many bruises she had and applied as many rolls of bandages she had stored up in her pack, in hopes that the leaking decreases for a bit. But they couldn¡¯t sit idly here and wait, they needed to leave, NOW. The tremors from that giant beast was still pulsing through the entire tower, and it¡¯ll be here any moment. So, carrying Diana on her back, she was about to run off, but Rei stopped her. ¡°¡­Where?¡± ¡°W-We need to get the treasury, at the last floor! There should be an ultimate potion there!¡± ¡°¡­Ultimate, potion?¡± An ultimate potion, it was something Nestra had never seen herself, but as a creation of the master, she had a vague idea of what its effects were. It¡¯s like the Full Restore in Pok¨¦mon, restoring both her HP and MP.If you spot this narrative on Amazon, know that it has been stolen. Report the violation. If they can get that, then Diana should be good to go! ¡°If we get that, Diana should wake up!¡± ¡°!...Then, follow.¡± ¡°Yeah! Come on, let¡¯s go!¡± ¡°¡­Un!¡± ¡­¡­¡­¡­¡­¡­¡­¡­ Everywhere they went, was a complete and utter disaster. Monsters were running around everywhere, trying to avoid the ¡®sisters¡¯. The walls and floor had cracks and holes all over the place. And many of the stairs had collapsed, making their traversal much harder than it needed to be. If she had been counting correctly, she and Rei should be at the 43rd floor by now. There were only 50 floors in Tartarus, with the last being the boss room with the three judges. And behind them, lied the treasury, and there, lied the Ultimate potion! Obviously, they were in a hurry. The clock was counting down after all, and Nestra¡¯s supply of mana potions weren¡¯t infinite. She was only carrying 15 to begin with, and 9 of them had already been used up. So they should really be running, but¡­ ¡°Eh? Is that Slimey?¡± ¡°¡­Slimey.¡± To their surprise, embedded into the wall like some sort of ornament, was their beloved slimy friend, Slimey! Before, since Slimey was being Slimey, he became prey to a floor trap, and was swallowed up into darkness. After getting his pass checked, and got his designated area, he was sent down into here and was now stuck in a wall of cement. ¡°¡­Break.¡± *Boom!* Although, Nestra had the ultimate punching machine Rei on her side, so this little wall of enchanted cement was nothing to her. And out, came their slimy mascot! *Boink, boink!* Slimey was back, but this was no time to rejoice. Diana was barely hanging on, and the ultimate potion was still 7 floors away. Thankfully, despite being Slimey, he seems to be understand the weight of the situation, and quickly joined up with the rescue team. Although, now that Slimey¡¯s back, where the hell was Crystal? Oh well, Crystal was strong, so she should be able to hold her own fort for a bit. Feeding Diana another mana potion, the rescue team turned towards the hole in the floor, and descended further in. ¡­¡­¡­¡­¡­¡­¡­ Floor 47, 2 more floors to go before the boss room. And that would¡¯ve been great new, if not for this. ¡°What, the¡­f*ck¡­?¡± ¡°¡­¡­¡± *Boink¡­* When they arrived on the floor, it was a complete ruin. No, even calling it simply a ¡®ruin¡¯ might be sugar-coating it a bit. The entire floor was missing, the walls were destroyed complete, and marks of explosions could be seen all around. There was no mistake about it, this kind of damage, could only be caused by that giant beast. While it did mean that they didn¡¯t need to go through floor 47, the floor below it was, a complete hell. A monstrous number of those monsters could be seen roaming around, eating up the other inhabitants of this tower. And, was it just her, or are these monsters bigger than the normal ones? ¡°¡­This, way.¡± ¡°Eh? Wait, that¡¯s¡­¡± W-Wait a sec, Rei¡¯s joking, wasn¡¯t she? There was no way they were going to survive jumping down into that crowd of monsters! ¡°¡­Have, plan.¡± ¡°Huh? O-Oh, what is it?¡± Sadly, Rei was a ghoul, which meant that her thinking would usually be much, simpler. Holding out her fists, she jumped straight into the fray! ¡°H-Hey!¡± What was her plan, you ask? Well- *BOOOOOOMM!!!!!* Using her fists, she struck the floor with as much power she had, and blew open the entire floor, causing everything to tumble down! From the beginning, Rei never planned to fight the monsters, but still! This was madness! ¡°D-Damnit! Slimey, hold on!¡± *B-Boink!!* With Slimey in her hands and Diana on her back, she readied herself, and jumped down! But to her surprise, Rei wasn¡¯t done yet! Once again, she mustered up her strength, and struck the next floor, causing it to crumbled and fall apart, paving the way into the final floor! ¡°T-That¡¯s-!¡± It seems, this job just got a lot harder. Because there, battling against the three judges, the last boss of this prison, was the giant beast Diana accidentally created. And¡­The monster seems even bigger than last time. This was bad! VERY bad! But before all that, she needed to slow her fall, or else she¡¯ll end up flat when she hits the ground. And if that happens, she won¡¯t be able to get the ultimate potion, would she? ¡°R-Rei! I¡¯ll get the ultimate potion! Cover me!¡± ¡°Un.¡± And so, the two had a quick exchange and split ways! Nestra moved her falling body close to the wall and managed to grab on to a ledge that was sticking out from the broken walls. Slimey accidentally let go and fell, but he¡¯ll be alright! Fall damage can¡¯t do anything to him! She also managed to get down onto the floor straight after. Meanwhile, Rei went straight on towards the giant monster. With her fists readied up, she aimed her strike, and sent a good Detroit Smash onto the giant¡¯s head! The ripples that spread out from that attack pulsed through its entire body, even causing it to flinch for a good second! And in that moment, the three judges that were below combined their strengths, and fired off a giant beam of mana, light, and darkness, blasting right into the giant¡¯s stomach. But, even that combined attack, wasn¡¯t enough to put it down. Rei gracefully landed on the ground, and began running around the giant¡¯s legs, punching and clawing it as the giant continued to ignore her. Then again, her attacks were nothing but little pokes for the beast. In fact, it seems to have gotten bigger from last time, and much, much stronger! But of course, defeating this beast wasn¡¯t Rei¡¯s main objective. All she needed to do, was to distract and stop it long enough for Nestra to hack open the treasury¡¯s door, and head in to take the ultimate potion for Diana. *GGGGGGUUUUUUUUUUUUUUUAAAAAAAAAAAUUUUUUUAAAAAUUUUAAAA* Ah, crap, it¡¯s charging up an enormous beam attack in its mouth! The three judges saw that, and the blood in their faces pretty much left them as the monster looked down at them, and fired the beam off! Luckily, the judges were able to survive that beam attack, but things were not looking good! Two of three judges were heavily wounded, and the third was barely holding on. And if they fall, Rei¡¯s coming up next! So, using her sharp claws, she turned into Spiderman and started to climb up the giant¡¯s body. ¡®If the legs are no good, then attacking the head should work¡¯ was what she had in mind as she scaled up the enormous titan. And befitting its size, the beast was very tall, maybe even taller than 40 Diana¡¯s stacked up into one!...That¡¯s a terrible example. Anyways, the two remaining judges quickly caught onto her plan and continued their attack, hopefully distracting it long enough for Rei to reach the giant¡¯s head. This wasn¡¯t supposed to happen, but they¡¯ll make it damn sure that titanic beast meets its death! *GGGGGGGGGGUUUUUUUUUAAAAAAAAAAAAUUUUAAAUUUAAAAUUAAA* ¡°Ngh¡­! Come on, open already!!¡± As Rei was hiking up the beast, Nestra was busy trying to hack open the door to the treasury, and this task was hard as hell! As a creation of this dungeon, Nestra had knowledge of how the mechanisms worked. Normally, this door would open after the challengers defeated the three judges, but they were quite busy right now, so that¡¯s out of the picture! Using her extensive knowledge, both as a creation of this dungeon and as an alternate version of Diana, she broke open the mechanisms of the door, and fiddled around with the controls, trying to find a way to make it open. And also, no, she couldn¡¯t just force the door open by exploding it or something. The door was near indestructible, and the door was forcibly stuck in place until something opens it from the inside. But she¡¯s really on the clock right now! Diana¡¯s MP was still leaking out, and she only had 5 remaining in her- *GGGGGGGGGGUUUUUUUUUUUUUUUUUUUUAAAAAAAAAAAAAAA!!!!!!!!!* ¡°W-What was that?!¡± Suddenly, an ear destroying scream echoed out on full volume. Although she needed to hurry, she took a moment to look outside, just to see what was happening. And- *BOOOOMM!!!* For some reason, a giant eyeball just decided to plummet down onto the stone floor. Obviously, it belonged to that beast, but why the hell did its eyeball just pop out all of a sudden?! She looked up, and instantly knew why. ¡®R-Rei!?¡¯ Like in the Shadow of The Colossus, Rei was running all over the giant monster¡¯s head, stabbing her sharp claws into the monster¡¯s eyes to try and scoop them out. Of course, that¡¯s not so easy, since the monster¡¯s head was quite hard, and there were 8 eyes in total, so, yeah. Not an easy task, could almost call it a ¡®Colossal¡¯ task. ¡­Ahem! Anyways, enough watching, she needed to get back to opening this damn door! And she would¡¯ve immediately continued, but some obstacles had come to mess her day up even more! ¡°Oh, come on.¡± Circling around her, was a total of 4 of these ¡®sisters¡¯, each already transformed and ready to chomp her head out. To make things worse, she¡¯s out of ammo! Which means, she couldn¡¯t use her one-hit KO guns! Woo~! *GGUUAAAAUUAUA!!!* ¡°D-Damniittt!!!!¡± Pulling out her steel knife, she engaged in a melee combat against these vile monsters. Unlike her skills in firing her rifle, her skill with the knife was¡­amateur at best. Maybe even worse than what Diana had back then! Thankfully, she didn¡¯t need to fight against them for very long, because as she was about to strike again, a series of dark blades came in and sliced them in half! That trademark attack, there¡¯s no doubt about it! ¡°Crystal!¡± ¡°Haa? How do you know my name? Agh, whatever. Continue working, I¡¯ll take it from here.¡± ¡°T-Thanks!¡± Crystal has appeared on the battlefield! Being a newcomer to the field, she wasn¡¯t quite sure what was happening, but there was a big monster, Rei was fighting against it, there were also many smaller monsters, and Diana was lying there lifelessly. Put in some thought, and she had the basic gist of what was happening. With this, the team has been assembled, and the battle of survival, continues on! [28] Time For The Last Struggle! 3 Mana Potions left to go. 3 more mana pots, and Diana¡¯ll be on her last count. That¡¯s only a measly approximate of 8 to 10 minutes in total. Crystal¡¯s having her on check right now, but with all the chaos with the incoming monster horde, and the occasional giant falling eye, checking up on her was getting harder and harder. Since Nestra¡¯s completely focused on trying to hack the treasury¡¯s giant door open, she left her belt with the 4 mana potions in Crystal¡¯s good care. She¡¯s also the one who¡¯s (Forcefully)feeding Diana he potions when she needs it. ¡®Damnit! Open, UP!!¡¯ Nestra was on her edge! All the insane mechanisms she needed to work with was driving her mad! And the anxiety and fear of death wasn¡¯t helping much either! The deeper she went in, the more complex and difficult the systems got. And with more complexity, comes a need for more effort. And more effort, means more time invested! After some point, she finally snapped and began to just grenade the entire area. It was a dirty tactic, and it was very dangerous, but hell, as if she could care right now! If Diana was able to corrode the stone with some effort, then her grenades should be able to do the same! Problem is, after about 20 grenades, her pack was out, and she was now left with a room that was filled with little crumbs of burned and exploded machine-, hmm? There seems to be a big dent on that side of the wall. ¡°Tch. [Phantom Blade]!¡± Meanwhile, on the outside, Crystal was having her share of monster hunting, splitting and stabbing the heads of each monster with her trusty [Phantom Blades]. Luckily, they died in one shot. Unluckily, the number of these bastards weren¡¯t decreasing at all! Same with Crystal, Rei was also tackling a monster, she was just fighting against the ¡®Bigger¡¯ picture. With her ingenious plan, and the help from the two judges below, she was now on her way to ripping out the beast¡¯s remaining 2 eyes. Her plan pretty much went like this, ¡®Get the 2 eyes out from the head. Then, SMASH¡¯ That¡¯s pretty much it. A simple plan, but effective, hopefully. There¡¯s also the issue that the giant monster was getting more violent, actively trying to shake Rei off its head. Not like it¡¯s going to work, since Rei¡¯s iron grip wasn¡¯t failing her any time soon. Despite being the calmest of the big trio, even Rei was starting to get fed up with all the monster¡¯s head bangin¡¯. So, with her claws out, she stabbed it into the empty eye sockets, just to try and stop it from moving so much! It didn¡¯t work. In fact, it just made it worse, since the monster was now shaking around in agony. *BOOOOOOOMM!!!!* But, another eye goes down for the count, and only one eye left for her to rip out and throw into the air! Down on the ground, Crystal was quickly feeding Diana another mana potion, which meant that her potion count was now down to 2! A quick [Phantom Blade] forms in her hand and severs the head of an incoming monster. Throwing said blade into another monster¡¯s head, she returns to the fight! And then, finally- *BOOOOOOOMMM!!!!* The final eye was ripped out, and the monster was unable to see!...Or that¡¯s what everyone thought. But them, something magical, and very disturbing, happened! The giant monster began to shake, and out from its belly, came a set of 20 EYES. 20!! What the hell!? You know!? No! She was not going to go through that process all over again and rip out those eyes too! Instead, ¡°Rei!! Come here and help me!¡± She¡¯ll jump down and help Nestra there, not before stabbing the guy several times in the eye socket and then jumping down. She also happened to make a nice Thor entrance and smash the head of a smaller monster that was getting a bit too close to Crystal. ¡°Ugh, just go help her already!¡± ¡°Un.¡± Without further talking, Crystal continued to hold off the monster horde, while Rei gave up on the giant monster and followed Nestra into the area she had just blasted. ¡°You punch hard right!? Face this way, and go wild!!¡± ¡°Un!¡± Feeling delighted, she readied her fists, and her somewhat broken gauntlets, and unleashed a full array of punches at the area Nestra was trying to break into! It¡¯ll take some time, since this wall was tougher than the one in the normal Tartarus, but Rei¡¯s a monster truck, so she¡¯ll get this done pronto! And also finally grab the Ultimate Potion and give it to Diana. Of course, even though Rei was sending her swift myriad punches onto the area that seemed most vulnerable, as Nestra expected, trying to breach into the treasury with mere brute force was gonna be a hard task! Not that some hard task will diminish their spirits! They had come this far, and they¡¯re not going to let go of Diana! But now that Rei was on bulldozing duty, the giant monster out there had all the time and effort in the world to have a nice meal! The two judges were still fighting back, but their attacks were nothing but little pricks on its skin. There was also one more judge, but he¡¯s already knocked out. Pathetic! Bring me more food! Bring a tougher challenge! These were the things that the monster had constantly in mind as it rampaged around. Ever since that lowly human came and threw that black liquid into it, its power and energy rose to incredible heights, and its intelligence increased too! Which then, turned a single small fry into a Calamity Ganon level threat! The two remaining judges, although their spirit was still flaring as bright as the damn sun, they couldn¡¯t hide from the fact that there was no possible outcome of victory. Their strength, was trampled under the beast they had never expected to rise. Actually, if we go by Rei¡¯s or Crystal¡¯s standards, this dungeon was quite easy, and so the bosses followed suit. But then, bam! Sudden threat appears, annihilates the entire population of monsters in the vicinity, and began their march towards a better and more potent meal. *GGGGGGUUUUUUUUUUUAAAAAAAAAAAUUUUUUUAAAAAAAAUUUAAAA!!!!* A howling scream of pain escaped from the monster¡¯s mouth. It wasn¡¯t due to the effort of the two judges, instead, coming from the flank, and piercing right through one of its eyes, a [Phantom Blade] was launched! ¡°Finally, the small fries are gone¡­¡± From down below, Crystal muttered so in annoyance. All that cannon fodder was finally out of the picture, but she¡¯s somewhat tired now, but as if she¡¯ll let something as trivial as exhaustion stop her battle! Although she may not look like it on the outside, she was extremely excited! For the first time in a while, she was facing against a monster of colossal proportions! Just seeing the beast cry in agony from her [Phantom Blade] was getting her blood riled up!Unauthorized use: this story is on Amazon without permission from the author. Report any sightings. I didn¡¯t know Crystal was a battle maniac Of course, the annoying thing about this guy was the fact that its regenerative abilities were top notch, keeping it alive even after Crystal closed off(stabbed) the remaining 19 eyes in a flash. It seems like it hurt for the big guy, but as if she gave a damn. Now realising that sight was useless, it switched up its tactics, and instead enhanced its hearing abilities through the roof! The giant monster was now kinda like Daredevil from the MCU, but I digress! However, now that it didn¡¯t need to worry about eyesight, it leisurely charged up a giant beam attack, and launched it at the injured judges. Easy to say, they didn¡¯t survive. Looking ¡®sad?¡¯, the giant monster lamented the loss of its food, and turned its head towards the next target, Crystal. But unlike those puny judges that looked at it with fear, this little prey was looking at it with excitement! It was time, to reveal her new trump card! She didn¡¯t have enough time to do this beforehand due to the constant enemy wave, but now that those weak monsters are out, it was time to test out her new powers she had gained in this pretty awesome dungeon! Taking a serious stance, Crystal closed her eyes, and began to chant. The chant was long and boring, so the giant monster charged up another beam and fired it at her. The beam exploded, but no casualties! This was due to some new equipment she got while exploring around. One of them, were her [Greaves of Hermes]. It was a nice pair of steel greaves she had found hidden in a secret room, and gave her a nice boost to her speed. Besides also giving her increased speed, she was now also able to fly! Albeit under a time limit, but she could fly nonetheless! So dodging something that was so easily telegraphed wasn¡¯t a challenge for her, even though she was occupied by her chanting and all that. But, now watch in fear and awe, for her new power shall bring forth ruin upon the battlefield! ¡°-I call upon thy, the prisoner of eternal punishment. Come forth, [Ruin Call: Ixion]!¡± A hurricane of dark magical energy surrounded her, forming into her newly acquired magic staff! The length of it was around her own height, and on the tip was a sphere of pure darkness. Around it, floated a pair of crystalline wings that shined a brilliant purple light. This was, one of Tartarus¡¯ special treasures-! [Ruin Call: Ixion] In the myths, Ixion was a king of an ancient tribe. However, due to his hatred to his father, was driven to kill him, tainting him in sin. Because of the god¡¯s pity, he was brought up to the heavens, however, even there, he was consumed by his own lust, and from that came a being now known as the centaurs. Driven by hatred and filled with lust. Tainted by sin but with no way out. His soul was forever trapped inside the prison of Tartarus, forever spinning on a wheel on his own burning lust. Thus, all those emotions, boiled down into their purest form, and this staff was made. Being one of the special treasures, Crystal had to do some insane stuff to get this. First, she had to defeat a tough centaur-like monster that was on par with the judges. Second, she needed to supply enough mana to power seven different orbs. And finally, she had to bring down 157 spinning wheels in the span on 30 seconds. Of course, being a cheat character, this was no big deal for a hot shot like her. Also, despite being a staff, [Ixion] itself isn¡¯t actually a staff. Instead, it would be more appropriate to call it as a skill, that allows her to summon a specialised staff that would aid her dark magic. But more on the staff later, the giant monster wasn¡¯t dead yet! With the added bonus from her new staff, her already insane magic became even more insane! At a moment¡¯s notice, a volley of 20 [Phantom Blades] were summoned at once, and then fired off and stabbed into the monster! *GGGGGGUUUUUUUUUUAAAAAAAAAAUUUUUUUUUUUAAAAAAUUUUAAA!!!* ¡°Not done yet!¡± This time, she went with 40 blades, and then fired. Next, came 60 blades, then 80, then 100, then she got tired of counting and just started firing it rapidly like a safety-off gatling gun. The monster¡¯s audible scream continued on for quite a while¡­ Oh, and while she was at it, she might as well force feed Diana another mana potion, since she was about to run out there. With this, only one mana potion left to go! Anyways, back with Rei and Nestra, they had finally made a breakthrough, literally! *BOOOOOMM!!!* The wall finally succumbed to the many *Ora!*¡¯s Rei sent, and gave way into the treasure room. Now, all they needed to do, was find the damn Ultimate Potion, and feed it to Diana! The final act was coming close! ¡°Rei! Go outside and help Crystal! I¡¯ll search around for the potion!¡± ¡°Un.¡± With that, Rei nodded and ran back outside to assist Crystal. It was for the better really, since this whole place was like a badly managed warehouse, and Rei would just be standing there with a blank expression. Normally, since the judges were the one who would enter and take out the prizes, they knew where everything is in this mess. But for some thief like Nestra, trying to fiddle around and try and find the potion would become her ultimate challenge! With her hopes and dreams held up high on a pedestal somewhere, Nestra steeled her heart with Harden, and began to search for this damn potion! She went searching around everywhere, pillaging through a pile of boxes, hopping around the huge mess, knifing her way through at times, and kicking things away in frustration. If anything, this felt more like Diana¡¯s old gaming room than a treasure room!! To make things even worse than they already are, because of the giant monster¡¯s attacks, the entire dungeon continued to shake, causing some rubble to start falling down into the room! *Boom!* ¡°Oh, come on.¡± Now, she was playing Tetris. But instead of playing as the all powerful player controlling the falling blocks, she was the victim now, trying her best to avoid said falling blocks. But then, in the midst of all her frustration, aid came! *Boink!* In the form of Slimey that is. ¡°O-Oh, it¡¯s you-, h-hey! Wait up! Don¡¯t go there!!¡± But instead of feeling relief, her dread and frustration only piled up even further. Why? Because Slimey was jumping right into the mess, and sliming it all over the place! Muu~, this was the worst!! Was what she thought, until she saw what happened next. *Vuuushhh* With the power of slimy magic, Slimey¡¯s entire slimy body expanded over the entire group of items, swallowed them up, and then organised each item in a swift yet understandable fashion. Now, instead of a broken warehouse, the items were laid out cleanly! She could actually understand which item is what now! Then again, her job wasn¡¯t as easily done as that. Since every consumable items, I.E potions and special pills, were kept inside special green boxes. They were like loot crates, each box containing three random item. And there was only one Ultimate Potion, which meant that, out of the 100 boxes, in which 3 are in each, she would have a 1/100 chance to find it now! What a pain in the ass! Meanwhile, back outside, *GGGGUUUUUUUAAAAAAAAAAUUUAAAAAAAAUUAUAUAAA!!!!* It was just torture for both sides. For the giant monster, the constant piercings it was getting on its body was just¡­yeah, and for Crystal and Rei, their eardrums are just, suffering from this screaming nightmare. Of course, this wasn¡¯t going to last forever. Diana¡¯s on her last mana pot right now, Crystal¡¯s mana pool was being drained out, and the giant monster was taking a huge beating. And since Crystal was constantly firing her [Phantom Blades] and [Phantom Needles] and stuff, Rei couldn¡¯t just climb up it and start beating it down, since she¡¯ll get caught in the crossfire. Now, it was just a contest of who falls first! ¡°¡­Monsters.¡± Just to increase this mess even further, now there was a large number of monsters rallying together and heading their way. They seem quite angry that their home was getting demolished, not that it matters though, since Rei¡¯ll just bash down anyone who comes close. Instead of the ¡®sisters¡¯ they¡¯ve been fighting up ¡®till now, the monster horde she was facing was composed of many different species. Some were actual living monsters, others were magical beings, and some were robotic. And in the middle of all that, there was a stone golem, that was fighting its own allies. ¡°¡­?¡± Instead of advancing towards her, it turned towards it¡¯s brothers and started to attack them! It was a sudden betrayal! The other monsters were shocked at first, but quickly realised that the golem was an enemy and tried to attack it. Of course, knowing that it was an ally, Rei swooped in to help and destroyed the other monsters around it. Rei knew that this golem was an ally, due to the particular mana it had inside its core. It was one that Rei knew very well! The golem core, had inherited some of Diana¡¯s mana! Yep, that¡¯s right! This was the golem core she had picked up before she got sucked into that black orb thingy! Together with her golem buddy, the two readied themselves and sent a flurry of punches at the surrounding monsters! Well, I say ¡®flurry of punches¡¯, but all the golem was doing was launching parts of its rocky self into the enemy and quickly regenerating, and then firing again, and repeat. It was pretty much an endless firing array of Danmaku! Back at the main battle, ¡°Hah¡­Hah¡­Daammmnniittt!!! GO DOWN ALREADY!!!!¡± Crystal was getting desperate. Her mana was reaching near rock bottom, she force fed Diana her last pot, which means it the last round for her, but the giant monster was still stubbornly standing despite its many injuries. The giant monster was even beginning to make counter-attacks, forcing Crystal to start moving around and shielding Diana when needed, drawing her mana nearer and nearer to the dreaded zero. ¡°At¡­this point¡­!!¡± And finally, after about 5 minutes of constant magic casting, *Poof!*, her mana dropped to rock zero, and her magic staff disappeared. Her energy was empty, but her willpower kept her standing. But, it seems, *GGGGGGUUUUUUUUUUUUAAAAAAAAAAAUUUUUUUUUUUAAAAAAA!!!!* This, was it for her. The giant monster was beginning to charge another giant beam, and Crystal didn¡¯t even have any mana left. Rei was far away, Diana was asleep, Nestra was out of ammo. This, is it. *GGGGGGGGGGUUUUUUUUUUUUUAAAAAAAAAAAAAAAAAAAAAAAA!!!!* *BBOOOOOOOOOOOOOMMM!!!!!!!!* And her sight, was filled with light. [29] The End ¡°¡­¡­Seriously¡­?¡± Well¡­¡­She did it. Nestra finally found the oh so famous Ultimate Potion. She should be happier about this, shouldn¡¯t she? But¡­ Right now, in the grip of her hands, was a glass jug, filled with a black liquid that was happily bubbling and moving around. Yeah¡­that¡¯s right, the exact SAME black liquid as the one Diana threw into the mouth of that now gigantic monster. Which meant that¡­That monster, had ingested the Ultimate Potion, and grew into THAT. On one hand, yay for finding the ultimate potion and now being able to bring Diana back, hopefully. But on the other hand, would Diana even survive if she drank some of this monstrous moving black liquid? She won¡¯t just turn into a giant slime monster, would she? Hopefully not, because she better leave this place!! The entire ceiling was crashing down, and if she gets crushed while holding this, that wouldn¡¯t even be funny. So, with that lingering thought, she stood up, shrugged away her doubts about the potion, and bailed out of the treasury room through the hole that Rei had helped create in the wall. And-, oh, Slimey¡¯s been waiting outside the entire time! Well, with Slimey on her side, she strode her way out, back into the battlefield. ¡°I hope Crystal¡¯s doing al-¡° -Right, was what she wanted to say, but her words choked before they could leave her vocal chords. Because there, lying down on the ground, tattered and burned, the figure of Crystal could be seen. ¡°CRYSTAL!!!¡± ¡°Ha¡­? Ah¡­It¡¯s¡­you, gah¡­It hurts¡­everywhere¡­¡± ¡°D-Don¡¯t worry, I¡¯m comin-¡° ¡°NO!! Help¡­Diana¡­first!! She¡¯s¡­about¡­to¡­!!¡± Even if she said that, she couldn¡¯t just leave her like that! Using an empty vial she had in her pack, she poured out some of the ultimate potion into the vial and fed it to Crystal. This potion better work, or else she¡¯s going to demand a refund at Amazon! ¡°Urk?! W-What is this¡­!? I¡­I¡­a¡­ah¡­¡­¡± ¡°Eh!? Crystal!? Crystal, can you hear me!?¡± But, contrary to her expectations, Crystal didn¡¯t even stay conscious! Well, her wounds were closed up, and she seems to be alright now, so the potion worked, sure. But what kind of hellish potion would cause the person who drank it to fall unconscious!? That¡¯s like the Red Potion from Terraria awful! R-References aside, Crystal¡¯s healed up, so it¡¯s time for Diana! Quickly, she made it over to her, and luckily, it seems she didn¡¯t get hit directly by the beam, but she was still blown away by the sheer force of the attack. Her worry was shooting through mars right now, but Slimey seems to say that she was still holding on, so the potion should work! Since the potion was evil, she decided to only feed Diana half of the entire jug, but even that should be enough! Since, ya know, Diana¡¯s entire body was shining right now! Her worry had already reached Orion by this point, ¡®cause, seriously! If that monster ingested that tiny vial and grew to that size, then what the hell will happen if you drink half an entire jug?! And to make it worse, this shine wasn¡¯t the graceful shiny one. No no, Diana was shining a black light. Talk about being ominous! No! She couldn¡¯t be spooked yet! Even if she was doing her best to ignore it right now, that giant monster was eyeing them all, and she could tell that think was hungry. And now that Diana was shining black, its attention was piqued even further. ¡°S-Slimey! You carry Diana back to that cave area, I¡¯ll go get Crystal!¡± *Boink!!* With Diana ¡®recovered?¡¯, Nestra left Diana to Slimey and rushed back to Crystal. The giant monster noticed this, and began charging its beam again! But Nestra was faster! In a haste, she shoulder carried Crystal and ran back to the cave area she breached into. *GGGGGGGUUUUUUUUUUUAAAAAAAAAAUUUUUUAAAAAAUUUAAAAA!!!* The beam fully charged, the monster¡¯s mouth opened, letting the giant beam fire at them! Luckily, just in the nick of time, Nestra jumped, and the force of the explosion behind her propelled her into the cave. She did faceplant her way in though¡­And it hurt, a lot. ¡°Ah¡­My nose¡­¡± Unbeknownst to her, since she was too focused on her nose, the jug she was carrying flew out of her hands and shattered, causing the remaining ultimate potion to splash all over the floor. She also didn¡¯t notice that Slimey had swooped in and ingested all that, without fainting. ¡°Hey, where¡¯s the ultimaaAA!!! THE JUG BROKE!!!¡± It was then she realised her ¡®mistake¡¯. Burdened by her guilt, Nestra could only cry as she lamented the ¡®loss¡¯ of the ultimate potion, not realising that all of it was now contained in the slimy container that is Slimey. *Boink* ¡°A-Ah, right! Diana! Can you hear me!?¡± Nestra tried calling Diana, but as she somewhat expected, there was no reply. Crystal who ingested just a tiny amount of it fainted, so Diana staying asleep for even longer wouldn¡¯t be too far of a stretch. ¡°Ngh¡­What happened¡­?¡± ¡°C-Crystal! You¡¯re back already!¡± ¡°Huh? Who¡¯re-, oh you¡¯re that girl with the weird costume.¡± ¡°W-Weird!?¡± Well, that was offensive! But, nonetheless, it seems the usual Crystal was back! But! It¡¯s time for the moment of truth! ¡°A-Anyways, can you check on Diana?¡± ¡°Huh? Ah, sure, let me see¡­¡­¡± ¡°¡­¡­Umm¡­¡­Crystal¡­?¡± ¡°¡­¡­¡­¡­¡­¡­¡­¡­¡± Hey¡­Why was she staying silent? And w-what¡¯s with that expression? Why did she look so, bitter? ¡°Crystal¡­?¡± ¡°¡­Her mana¡¯s fine¡­and her health¡¯s back too¡­¡­then¡­why¡­?¡± Crystal couldn¡¯t understand it either. Her HP was back. Her MP was back. It wasn¡¯t leaking out either, which means she was fine! If so, then why was did she seem so¡­empty? There wasn¡¯t a single ounce of life beating inside her body.This story has been unlawfully obtained without the author''s consent. Report any appearances on Amazon. ¡°S-She¡¯s¡­alive right!? Diana¡¯s just asleep, isn¡¯t she!?¡± ¡°¡­¡­¡­¡­¡­¡­¡± Not only that, ever since she was first brought out of her dungeon by force, she was bound to Diana, like Slimey is, so she could tell if she was alright or not. But, not anymore. That connection she once had with her, was gone. Yes, that¡¯s right. They were too late. ¡°N-No¡­¡­¡± Here, Nestra forgot one simple thing. No matter where they were, no matter what world they were in, no matter what logic applied, she had forgotten, that Diana was simply human. And what¡¯s the source of life for the human? It was blood. No matter how many potions she chugged down, no matter how many ultimate potions she got, it wouldn¡¯t restore the blood she¡¯s lost. From the moment her heart stopped beating, and her brain stopped functioning, she was dead. A mere ¡®Ultimate Potion¡¯ couldn¡¯t revive a dead body, no matter how much was ingested. ¡°¡­¡­¡­¡­I¡¯m going.¡± Even if she didn¡¯t show it, her entire being was boiling. In this world, the life of a single being didn¡¯t amount to much, but even then, she couldn¡¯t accept this! Diana might be too far gone, but that monster was still there. She didn¡¯t care anymore what circumstances led to that thing being there, but she was angry. So angry, that she might burst anytime soon. She needed to vent her anger. So, with her eyes void of any expressions, and her special staff [Ixion] in her hands, she stepped out into the battlefield once more. The monster saw her and ¡®smiled?¡¯, but froze after a giant [Phantom Blade] was summoned. Normally, this would drain her out immediately, but with the added bonus of the ultimate potion, she¡¯ll make it damn sure that this monster goes down! ¡°[Phantom Blade: God Cleaving]¡± With a voice devoid of any emotions, she chanted out so, and brought the giant sword down on the monster. The giant monster tried to move away, but it was slow, and was received the slice head on. *GGGGGUUUUUUUUUUAAAAAAAAAAAUUUUUUUAAAAAAUUUUUAAAA!!!!* A scream of agony came out, but she didn¡¯t care. It wasn¡¯t dead yet, and that¡¯s wrong. ¡°[Phantom Blade: Unending]¡± This was the same spell she used to attack it earlier. An endless swarm of [Phantom Blades] appeared and flew into the monster¡¯s giant body. Already, her mana was draining out in a flash, but she didn¡¯t care. She wanted the satisfaction to see it dead, and she wanted is NOW!! *GGGGUUUUAAAUAUUAUAUUAAUAUAUUAAAUUAUAAUUAUUAUAUAUAAA!!!* As more and more blades pierced into its body, aided with the already monstrous damage from her earlier [God Cleaving] attack, the monster would reach the light pretty damn soon. The effect of the Ultimate Potion was finished. The mana from all the monsters it had eaten was eaten up. There was no way the giant monster could sustain that large figure for any longer, and began to shrink down to its original size. ¡°¡­So that¡¯s your normal form¡­¡± ¨CDIE With that single word echoing in her mind, she summoned one last [Phantom Blade], and threw it into the monster¡¯s small head. One last scream of agony came out, before it stopped moving, and fell onto the ground, dead. ¡°Hah¡­¡­¡± She¡¯s just refilled her mana, and it¡¯s already out. Her job done, she collapsed onto the floor, her staff slowly dissipating into thin air. Her thoughts were slightly blurry, and she felt rather heavy, but one thing for sure. That thing is DEAD. And the battle¡¯s, finally over. *GGGUUAAA!!* *GGUAAUAA!!* Or so she thought. ¡°Are you¡­f*cking kidding me¡­?¡± You see, Nestra forgot to inform them about one crucial little detail about these bastards. That, although these things could be killed, they will respawn in five minutes, over, and over, and over again. No matter how many she beats down, no matter if the giant beast is dead or not, these guys will not stop coming. If the main core, located at where Nestra first met Diana, was destroyed, then the respawn option would finally disappear, and once the monsters are killed, they stay killed. ¡°Ah¡­sh*t.¡± And now, a horde of newly spawned ¡®sisters¡¯ are heading her way. Rei was busy fighting the monsters together with Diana¡¯s golem, Diana¡¯s revival had failed, and Crystal¡¯s mana was empty. It seems, lady luck wasn¡¯t on her side anymore. *Bam, bam, bam, bam, bam, bam!* ¡°C-Crystal! Are you okay!?¡± But, even if lady luck wasn¡¯t there to help her out, didn¡¯t mean her luck stat has dropped to zero! ¡°Yeah¡­You, whoever you are¡­finish them.¡± ¡°Y-Yeah!¡± She hasn¡¯t been in the spotlight for a while, so it¡¯s time for her to finally shine! Going back a bit, after Crystal left to fight again, and saw that she defeated the giant monster, a spark of hope burned in her heart once more. Even if her plan had failed, didn¡¯t mean the battle was over! Her resolve burning once more, she ran back into the treasury room and scavenged for any useful items she could use to battle the monsters. Her ammo was out, and she wasn¡¯t very good with the knife. She needed something else! The weapon she decided to use, was a specialised magic grenade launcher, that used up her mana to shoot instead of normal grenades. She had no idea why this was here, maybe Nitori left this by accident, but she¡¯ll take it! *GGGUUAAA!!* *GGUAAUAA!!* ¡°Oh¡­Oh no¡­¡± But then, she heard it. The screeches of those dreaded monsters. Then she realised! She completely forgot that they respawn over time! And outside, she saw a nightmare. Another giant horde of those ¡®sisters¡¯ were coming in, and farther away, she could see a mesh of many monsters. Luckily, Rei and a certain golem gone rogue was fighting the other monsters back, but Crystal was defenceless against the incoming monsters! It was time, for her to shine! *Bam, bam, bam, bam, bam, bam!* With her new grenade launcher fired up, she shot several grenades into the horde, causing a series of explosions, and many, many ounces of blood to fly into the air. ¡°Yeah¡­You, whoever you are¡­finish them.¡± ¡°Y-Yeah!¡± It¡¯s time, for the last STAND! *Poses dramatically before firing off some more grenades* ¡­Ahem, anyways, this is troubling. If her sights are correct, there should be around 100 or so inside that group. Since her grenade launcher is not specifically made to counter these guys, her previous grenade shots didn¡¯t do much. It¡¯s still very powerful, that much was apparent! But with the numbers she needed to fight against, and the amount of mana this thing sucks out every time she fired a shot, the mountain to climb was quite steep on this one. And guess what? Their bodies are shock-resistant, which makes her grenade launcher even weaker than before! She could have chosen a sword, but she couldn¡¯t even lift them Muu~, the odds are stacked against her, but she¡¯ll make do! The knockback on this thing was pretty good, so that should get her some advantage to the battle! If she could hold on long enough for Rei to finish her job, this battle was a guaranteed win! She just needed to hold on! ¡°Take, THIS!!!!¡± *Bam! Bam! BAM!!* Meanwhile, back with Rei, ¡°¡­Many.¡± Despite having fought this battle for, about 12 minutes now, the number of the monsters here are endless! *Vuuu!!!* And the golem wasn¡¯t doing very good either. Since it¡¯s core it pretty much infinite, there was no risk of it dying, but the amount of mana it has stored up inside wouldn¡¯t last for much longer! ¡°¡­Golem, jump.¡± *Vuuu!!!* No more words were exchanged, but the golem clearly understood what Rei wanted to do. Building up some energy under it, the golem leaped up into the air. With her friend out of the way, Rei took a deep breath, and sent a good New Hampshire smash to the ground! *BBBBOOOOOOOOOOOMM!!!!* A terrific tremor was sent out, as the ground cracked under the force of her punch. Torrents of wind surged out from the ground, blasting many of the incoming monsters into the air. *Vuuuu!!!* Taking this chance, the golem readied some rocks it had stuck on it, and fired them at the airborne enemies, just to make sure they stay dead. Of course, there were some annoying enemies that just wouldn¡¯t stay dead, but Rei would sort them out. ¡°¡­Kuh.¡± Although, Rei was taking a beating. Although these monsters came from the upper floor of the dungeon, they still hit quite hard. The damage they dealt wasn¡¯t high by any means, but stack them together, and they¡¯d start looking quite dangerous. Even if Rei had super strength and could regenerate, she wasn¡¯t invincible. Just like any normal monster, she had HP and MP, and if her body was intact but her HP drops down to zero, well, she¡¯d be meeting lord death. *BAM!!!* ¡°¡­?¡± Aya? For some reason, an explosion just occurred right beside her, sending a group of monsters flying. Rei wasn¡¯t hurt by it, but who sent that explosion? It was then, she finally noticed the fighting on the other side. And there, she saw Nestra holding her ground against the ¡®sisters¡¯, and Crystal who was lying down on the ground. The battle over there was also quite hectic! ¡°¡­Golem.¡± *Vu!!* Noticing where Rei was pointing at, the golem responded and formed a boulder around its core. And just like any boulder would do, it picked up speed and ran over as many enemies as it could as it made its way to Nestra! What? That¡¯s not what boulders do? Nonsense! ¡°¡­Fuh.¡± Then again, now that the golem wasn¡¯t with her, the entire monster army was her enemy now. Would she be able to pull- ¡°?!¡± But then, just as she was about to contemplate her life choices, a sudden wave of intense energy burst out through the entire battlefield. Rei, no, not just Rei, but everyone in the room, even Nestra could feel the sudden burst of mana. It wasn¡¯t clear if it was an ally or foe, human or monster, but she knew one thing, Something, had just awoken. [30] Her Return A crystalline world. A world of endless skies. A sun that never stops shining. A darkness that will never cease. Such is the world that Diana had found herself in. She recalled everything that led up to here. Her first moments stepping into this world, her shock to find that she was a woman, her fight to leave the forest, the meeting with the dryad, the journey into the crystal caves, a fated meeting, fighting hordes of undead, meeting a certain ghoul, challenging the catacombs, entering the Tartarus, making her mistake, and her death. Her entire life up until that point played over and over again on the monitor she had sitting in front of her, as if it served to remind her how much of an idiot she had been. It¡¯s not like she¡¯s made very good life choices throughout her short life anyways. Before she left the world for good, she never made it up with her mother. She never considered how much of a d*ck she had been to her, and what her feelings were about her. Once she got to this world, and met that Dryad, she selfishly brought her into the crystal caves, simply because of her own curiosity. She had learnt from Crystal that dryads are actually hostile creatures, luring unwary adventurers into their trap and pretending to be welcoming, before showing their true nature and eating them. Yeah, [Top 10 Most Shocking Anime Betrayals] much, am I right? Even then, she still caused her death. Once she finished the Crystal Caves, she didn¡¯t bother to think about Crystal¡¯s or the Admin¡¯s feelings before she forcefully dragged her out from her home. And not learning her lesson, once she heard that there was treasure in the catacombs, she brought everyone there, and caused a chaotic mess that her friends had to clean up for her! And now that she¡¯s dead, she couldn¡¯t even help them clean up over her own mistakes! She could almost laugh as she recalled it all. She could almost go insane in this unending sorrow. Maybe she already did, who knows? She didn¡¯t know anymore, she didn¡¯t want to think about it anymore. ¨CPerhaps, this was my prison, a place she could never escape from. This crystalline world, with an endless sea stretching below her feet. No matter how far she walked, no matter how deep she swam, no matter how high she flew, she would always end up back here, to watch her life play out. Over, and over, and over again. Forever, and ever, and ever. ¨CPerhaps, this was my personal hell. ¨CPerhaps, I was destined to remain here. ¨CTo watch my life play out again and again, never being able to truly die. How long has she been here, sitting lazily on the same blue swivel chair, watching the exact same movie play out over and over again? How many times has she tried to leave this world, only to return back here? How many times has she spent running around aimlessly? How many times has she left herself sinking into the seas? How long has she spent counting the seconds pass by? How many times has she wished for her to finally DIE? ¨CAh, I want to die. ¨CI want to die so badly. ¨CBecause, my life¡¯s finally out, and it¡¯s Game Over. ¨CPlease end me. ¨CPLEASE END IT ALL ALREADY. But, no matter how many times she repeated those words, no matter how many prayers she sent towards the heavens, that wish will never be granted, would it? *Please don¡¯t say that, mistress* But then, she heard a soft cute voice, coming from behind her. A voice that she knew very well, but had never actually heard with her own ears. A voice that she had longed to hear. ¡°S¡­Sli¡­mey¡­?¡± Turning around, there she saw him, standing there like he would always do, staring back at her with a cheery attitude. The first companion that she found in this world, and the slimy blob that had always motivated her. Why? Why was he here? Did he also die? What about the rest? Rei? Crystal? Nestra? How about them? There were so many questions she wanted to ask, but her mouth wouldn¡¯t move. *Don¡¯t worry mistress! They¡¯re all still alive, and so am I! Because I¡¯ll never leave your side!* Why? She wanted to ask. Why would Slimey still follow her, this idiotic example of a master that couldn¡¯t even take care of her own subordinates. Why, despite all that, would he still come here? She wanted to run over to him, to hug him, to simply say the words ¡®Thank you¡¯, but she did nothing. Just like he would always do, he jumped up and sat on her lap. She smiled bitterly, remembering that her lap was his favourite spot to sit and sleep on. For some reason, now, her tears wouldn¡¯t stop. Everything she had felt up until this point, all the sorrow and hate she held towards herself, finally cracked through the glass and spilled out. ¨CAh, I miss them. She felt so. She wanted to meet them so badly, so much that it strained her heart. She wanted to meet back with them, to fight alongside them once again, to joke and laugh with them once more, and to travel the world with them, just one more time. *Have you made up your mind, mistress? Let¡¯s go back!* But, even if she wanted to do so, even if she missed them dearly, she knew very well, ¨CThat I couldn¡¯t come back. *What are we waiting for? Let¡¯s help everyone out!* ¨CI can¡¯t. *Is something the matter, mistress?* ¨CI CAN¡¯T. I¡¯M DEAD. No matter where she was, on Earth on here in fantasy, she can¡¯t escape from death. She was nothing but a mere weak human. No number of skills and stats would ever change that fact, would it? *Oh! Is that it, mistress? Is it because you¡¯re ¡®human¡¯, that you can¡¯t return?* But then, Slimey asked such a question. The answer was, obviously, because she¡¯s dead, she couldn¡¯t return back to the world of the living. But, something told her that Slimey meant something else with that question. *Mistress, when you die in Dark Souls, you don¡¯t give up, do you?* W-What!? Why is Slimey making references to games!? *I don¡¯t know how either, but, again, you don¡¯t just give up, right mistress?* Y-Yeah, that¡¯s right. When she dies in Dark Souls, no matter how dumb it was or how hard the boss fights were, she would always sit back, take a quick breather, and then dive right back into the world, ready to retry the battle once more. *When you¡¯re playing Darkest Dungeon, you don¡¯t just quit after one bad run, do you mistress?*Unauthorized usage: this tale is on Amazon without the author''s consent. Report any sightings. Yeah, that¡¯s also right. Even if I play one run into the dungeon and my entire team of high-level heroes dies, she may sulk about it for a day or two and leave the game for a while, but she¡¯ll come back eventually, sucking up her tears and picking out some more heroes for the next run. *Then, you can¡¯t just quit here, can you mistress?* She would love to, for dear god she would love to click respawn, but she was human, and this was real life. Unlike a game, she didn¡¯t have the privilege to click on the respawn button and spawn back at her comfy bed back at home. ¨CIt¡¯s impossible. *Mistress* ¨CBecause I¡¯m just human. *Yes, that¡¯s exactly right, mistress* ¡­What? At that comment, she was genuinely confused at him. After all, she is a human. Yeah, sure. She might joke around and say that she¡¯s a slime because she could transform into one, but that¡¯s because of her skill. Without it, she¡¯s just a human, right? *Then, mistress. What is a human?* ¡®A jumble of many organs that work together to make me¡­alive? Maybe?¡¯ Was what she wanted to answer to him, but she realised that was not what Slimey was asking. See, it was a trick question. Normally, one would consider a ¡®Human Being¡¯ as a group of organs working together to create intelligent life. That is, if one is a human only in ¡®Flesh¡¯. But what is a human really? Does that word even make sense? Because Rei and Crystal weren¡¯t ¡®Human¡¯ in flesh per se, but they were surely ¡®Human¡¯ in nature. If so, then what is ¡®Human¡¯ nature? Does such a word even have a concrete definition? *In my opinion, a human is someone who strives to live, someone who fights their hardest to see where this life of theirs would lead them. Rei is a ghoul. Crystal is a spirit. But, even then, I still think that they are very much ¡®Human¡¯. And so are you, mistress* *There is no need for you to have a ¡®Human Body¡¯ to be ¡®Human¡¯. That, is what I believe in* ¨CBut, how can I leave this place? And to that question, the monitor that had been playing her entire life on loop suddenly shut off. Only to turn back on with a single question pasted over the white screen behind it. [Specific attributes have been reached. Evolution from: Human to: Slime Queen is now possible. Do you wish to continue? Yes/No?] She smiled wryly when she read that. Seriously, she could almost fall over and cry laughing from reading that! I mean, what the hell man!? Evolving from a human to a Slime Queen!? What kind of sudden development is that!? But then, in the midst of her thoughts, she realised something. ¨CWhat will happen to Slimey then? And to that, *I will become one with Mistress. Once the evolution takes place, I shall become one with you* Was that fine? Are you okay with becoming one with me? She wanted to ask, but there was no hesitation in his words. It seems, from the very beginning he stepped into this empty world to meet her, he had made up his mind to do so. And, damn, he sure did make it work. [Specific attributes have been reached. Evolution from: Human to: Slime Queen is now possible. Do you wish to continue? Yes/No?] Looking back, maybe her life wasn¡¯t so bad after all. Yeah, she¡¯s made mistakes here and there, and that mistakes may have caused her some deep trouble, just like her latest mistake, but her life wasn¡¯t a complete hotpot of tragic sad backstories. One choice after another, one mistake after another, led her to new places she had never explored, and allowed her to experience new things that she could have never imagined. Of course, she hasn¡¯t forgotten everything that she had done. All the past mistakes she had made, will always stay with her. But, even then, she¡¯ll head forward, no matter what lies ahead. In a way, she was glad to have died as a human. Because of that, she could look and examine herself, see where she went wrong, and what she should never repeat. And with a smile, she exclaimed from the bottom of her heart! ¡°Yeah!! I wish to continue!¡± With her choice made, and her resolution rekindled, the empty crystalline world around her crumbles, as she begins her ascension! *Good luck, mistress¡­I¡¯ll shall always be by your side¡­forever* ¡­¡­¡­¡­¡­¡­¡­¡­ ¡°?!¡± Something, had just awoken. Rei didn¡¯t know ¡®what¡¯ it was, whether it was an enemy or an ally, but it was strong, really strong. The density of mana that just got flung out into the atmosphere in the midst of their tense battle was so thick, that the world itself suffered under its pressure. The ground cracked, the walls earth trembled, and the air shook. If she would compare, it was similar-, no, even thicker than the mana that giant monster had. *Tap* It was obvious who that mana belonged to, but at the same time, Rei couldn¡¯t be too sure. She could feel Diana¡¯s mana surging into the air, but there was also something else mixed in there. *Tap* ¡°¡­Diana.¡± And there she was, stepping out from the cave she had been sleeping in. A tattered and torn red cloak was tied around her, hiding her naked body underneath. There was no visible change to her body. Her height was the same, her eyes were the same, yet¡­What was with this overwhelming aura? Well, despite the ¡®Overwhelming¡¯ Aura, it¡¯s still Diana under that skin after all. ¡®Uwah~, it¡¯s a mess here¡­¡¯ Well, she had been expecting to see some chaos when she awoke, but not to this extent! Hey, at least the giant monster¡¯s dead, but what¡¯s with this outrageous number of monsters crawling around the place!? And, uh¡­Why was everyone staring at her? Umu¡­All this attention she was garnering¡¯s making her nervous! She could feel her sweat trailing down her back-¡­Hmm¡­For some reason, she¡¯s sweating¡­slime? That¡¯s odd¡­right? ¡®¡­That¡¯s completely normal. What am I thinking about?¡¯ ¡­Anyways, her mana¡¯s way above her normal capacity, and her friends seems to have gotten themselves in quite the pinch. The monsters were literally giving her a chance for the first strike, and she¡¯ll gladly take it! ¡°[Corrosive Slime Wave]!!¡± First up, swallow the entire room and get her allies to safety! And¡­Well, she did use up her entire mana reserve there, and she did get a nice Power-Up from that evolution, but she didn¡¯t expect it to be so big it ran through the entire room!! ¡­Or did she? Isn¡¯t this amount of slime normal for a slime queen such as her? ¡®Ugh¡­What¡¯s wrong with me suddenly¡­?¡¯ To her surprise, a gigantic wave of corrosive slime appeared and swallowed up the entire room, trapping everything inside and corroding them. Of course, she wouldn¡¯t kill her allies, so she made sure to make a small bubble of safe normal slime and pull them towards her! *Pasha!* The giant blob of slime splashed, and out came her allies! Rei, Crystal, Nestra, and her new golem friend! Crystal and Nestra were unconscious, probably because they¡¯ve been fighting for so long. The golem core was brightly shining, and Rei was just looking at her with interest and caution. But, that didn¡¯t matter right now, because- ¡°!?¡± All she wanted to do right now, was to wrap her hands around her, and hug her. She¡¯s only been dead for about an hour or so, but to her, it felt like an eternity, spent in that lonely world, with nowhere else to go but sit down and lament her own foolishness. She just, wanted to stay like this, for a while. Rei too was confused, but hugged her back. She too was glad to see that Diana was awake and back to her normal self. They stayed like that for a while, before Diana broke off and wiped her tears. She couldn¡¯t cry now! Slimey¡¯s granted her another chance at life, and she couldn¡¯t cry about it forever! ¡°Ugh¡­Where¡­?¡± ¡°C-Crystal!!¡± ¡°Huh? Oh, it¡¯s-, h-hey! D-Don¡¯t j-just hug me a-all of a s-sudden!!¡± Well, spending some more time hugging her friends wasn¡¯t that bad either. Although~, that flustered reaction from Crystal was quite surprising. Perhaps Crystal had been worrying to death over her too, but~, she¡¯ll save that question after they get out of here. Nestra was still unconscious, and it seems like she drained her mana out excessively too. She wouldn¡¯t be waking up anytime soon, but at least she¡¯s alive. So all¡¯s well and good. ¡°H-Hey¡­C-Can you l-let me go a-already¡­?¡± ¡°¡­No.¡± ¡°H-Huh!? I-I mean, i-it¡¯s not like I d-don¡¯t like it a-and whatnot, b-but¡­¡± ¡°¡­No.¡± She still wanted to hug her, so she didn¡¯t let go. That, and she liked this shy and embarrassed side of Crystal, so she¡¯s going to savour it as long as she can. Well, Crystal was also tightly hugging back, so there¡¯s no problem. After about 5 more minutes of hugging, Crystal reluctantly let go of her. Honestly~, this cutesy side of Crystal is just-! Muu~, it makes her so much cuter and endearing now! Makes her want to pinch her cheeks and stuff~! But, all that aside, ¡°Rei, Crystal¡­I¡¯m sorry, for everything.¡± ¡°¡­?¡± ¡°F-For what e-exactly¡­?¡± Taking a deep breath, she readied herself, and began to explain everything that led up to here. Her encounter with that black orb, her skill evolution, that dungeon with the ¡®sisters¡¯, meeting with Nestra, and the deadly mistake that caused her death. ¡°-So, I¡¯m¡­sorry. Please forgive me.¡± Now that they knew her story, and that she was the cause of all that chaos they had to deal with, surely they would hate her by now. So, she could only close her eyes and wish for the best, but to her surprise, ¡°¡­It¡¯s, fine.¡± ¡°¡­¡­¡­Huh?¡± ¡°Yeah, well¡­You¡¯ve always been a bit of an idiot and all, so can¡¯t be helped, can it? And besides! I got to test out my new staff and earn some levels thanks to you, so I guess it¡¯s fine.¡± Were what they answered back to her. There was no hate, not even a single drop of it. Instead, they took it all in stride and brushed it off, saying that it was ¡®just like her¡¯ to cause this mistake. Like hell she could just accept that! ¡°B-But, I-!¡± ¡°Diana, sorry, right? Then, it¡¯s, okay.¡± ¡°Yeah. You¡¯ve noticed your mistakes, so that¡¯s good. Look, everyone makes mistakes from time to time, some bigger than the others, but no one¡¯s perfect. Not you, not her, and not me either. Just make sure to not repeat that again, okay?¡± ¡°W-What¡¯s with that¡­?¡± Why¡­? Why was everyone okay with this? They all almost died because of her! Why are they just shaking it off as it was something normal!? ¡°W-Why!?¡± ¡°O-Oi, don¡¯t just cry all of a sudden-¡° ¡°Why don¡¯t you hate me after all that!? You all almost died because of me! I caused that, all of that! Then why¡­!? Why are you all fine with it!? I-I can¡¯t understand! I-I¡­I¡­¡± ¡°Uh¡­Look, Diana, we¡¯re jus-, H-Hya!? D-D-Don¡¯t j-just hug me s-suddenly!!¡± ¡®Well¡­This is awkward.¡¯ Were the exact words that ran through her mind as she tried to find the best way to handle with this situation. She never expected to see Diana suddenly burst out like that and hug her. And as a spirit, she¡¯s never actually had any experience with dealing with these kinds of things. All Crystal could do was hug her back and softly comfort her. Obviously, Diana was beating herself up over this mess, and while they were fine with it, she clearly was not. Diana was much more fragile than she originally expected. ¡®Is this¡­What it feels like to be a sister¡­?¡¯ Pushing aside that sudden thought, she¡¯s glad that Diana¡¯s calmed down a bit¡­Actually, she wasn¡¯t even crying anymore¡­Wait, she wasn¡¯t moving at all! ¡°D-Diana¡­?¡± ¡­Huh. It seems like Diana cried herself to sleep without realising it. Didn¡¯t she just wake up, like, 15 minutes ago? ¡°¡­Mana, empty.¡± ¡°Wha-, well, that spell from earlier was much bigger than normal, but, still¡­What an idiot, to use such a large spell after waking up¡­¡± Well, they were okay with it, and it¡¯s not like the monsters would be moving anytime soon. They weren¡¯t all dead yet, but Diana¡¯s thick slime wave easily made their movement one hell of a trial to accomplish. And besides, she was also tired out, and Rei was most likely tired too. Her mana¡¯s completely empty right now, and some sleep would probably be best right now. ¡°Hey, uh, Rei, right? Are you going to sleep?¡± ¡°¡­Yes.¡± ¡°¡­I see. Well, sleep well, I guess.¡± ¡°¡­Un.¡± [31] Acceptance! It¡¯s been around 6 hours since everyone went to sleep, and¡­mostly everyone was still asleep. Crystal was the only one awake, blankly staring out into the terrific slimy blob that was Diana¡¯s [Slime Wave]. The more she inspected it, the more it dawned on her just how terrifying this spell could truly be. Just like a certain Enchanter from Log Horizon, she couldn¡¯t deal much pure damage, if at all really. Her [Slime] based attacks weren¡¯t anything too powerful, and her sets of skills don¡¯t make for a very high damage-dealing loadout. But! What came in most important however, were the massive number of uses she could have with it! She could morph her body, slip through and past many conventional enemies, drown and suffocate them in slime, and corrode them away using her new [Slime: Corrosive!]. The corrosion effect won¡¯t work on the stronger enemies, like the regenerating ghoul or the immortal golems, but it works well against small fries, and also on the environment. ¡°Hah¡­¡± Putting Diana¡¯s newfound awesomeness aside, Crystal¡¯s been feeling somewhat odd lately. You know, for her, Diana¡¯s first impression was a bratty, loud, brash, and bold girl that charged at anything with no thought for safety measures. And, yeah! She lived up to that impression for a pretty good amount of time! But then, just hours ago, she saw her, crying and blaming herself for nearly putting them at death¡¯s door. In this world, a single life didn¡¯t amount to very much, and Crystal knew that well. That was just how this world works. In every second, at every moment, at every location, the threat of death always lingers by the edge of your neck, ready to strike at the right moment. So, being put at the door of death wasn¡¯t that scary, at least not for her. That was why she was alright with Diana being an idiot and putting everyone at danger, since that¡¯s what pretty much everyone expects to do, am I right? She wasn¡¯t a human, so she didn¡¯t understand what human morals and cultures were. She also didn¡¯t bother to look into it and learn about them, resulting in the Crystal we all know today. That was why she couldn¡¯t relate very well to this human she knew as ¡®Diana¡¯. Of course, Diana wasn¡¯t human anymore, but she didn¡¯t know that. All that, culminates to this moment, with Crystal sitting down, deep in thought as to what to do next with Diana. It¡¯s odd really. At first, she ¡®sort of¡¯ hated Diana for dragging her out from her home. But, as more time passes by, she began to realise herself that she wanted to leave as much as she did. Maybe it was just the feeling of adventure, or the smell of the fresh air, or seeing the sun rising from the horizon, but she loved this world. All her life, as a mere spirit created to serve the dungeon, she never saw the cool little details that made this world so, magical! She plays herself as a stoic badass that destroys the enemies with no mercy, but really, she also wanted to have as much fun as Diana was having at every moment. She¡¯s just too shy to join And then, there¡¯s also Rei. At first, all she saw her as was an enemy, that Diana somehow manage to make into an ally. Being a former enemy, she was cautious of her, just like anyone would! Diana¡¯s just a bit out of the ordinary. But, as Diana got more intimate with her, they began talking more, and Diana even gave her a name. For some reason, when she noticed both of them happily talking(usually about food), she would feel displeased. Crystal herself didn¡¯t really understand why. And again, she¡¯s too shy to join the talk And, well, they haven¡¯t talked much. The only time they did was when they argued at that puzzle section, and I could hardly call that ¡®Talking¡¯. But, as they say, actions convey more than mere words. It hasn¡¯t been very long since they first met, and they haven¡¯t fought together much either, but at the times they did, like in their previous struggle against that large monster and the monster army, she got a sense of how truly powerful she was, in more ways than one. In an actual battle, she was an unstoppable whirlwind of death, plowing through waves after waves of enemies. If they fought seriously without anything held back, then Crystal would immediately lose with no chance to breath. But, more than that, surely Rei would¡¯ve also noticed that the ultimate potion had failed. Just like her, Rei was sensitive to mana, and her sense of smell was also powerful, so if Diana was still dead despite having drank that ultimate potion, she would¡¯ve known. ¡°¡­Crystal.¡± ¡°U-Uah!? O-Oh, it¡¯s you.¡± Talking about Rei, she just woke up! ¡°¡­¡­¡± ¡°¡­¡­¡± Well, despite that, this¡­this was awkward. Crystal didn¡¯t have anything to speak to her about, and Rei seems to not be the type to break the ice, so here they were, just sitting inside this room, silently passing time by. And, from what she¡¯s seen anyways, Rei seems to be more concerned about food than anything else. Being the locked up person she was, Crystal didn¡¯t have any knowledge of food, or any food related topics. ¡°Crystal? You there?¡± What should she do then? Should she just leave Rei be then? Should she only watch from afar as she and Diana got along without her? No, of course not! But, how was she supposed to do so? How should she start a relationship with her? Should she start with ¡®Hi¡¯? ¡®What do you like?¡¯ maybe? She didn¡¯t know, she didn¡¯t know what to do! ¡°Hey, Crystal, uh¡­are you okay?¡± No, even before that, what should she say do Diana? ¡®It¡¯s okay¡¯? ¡®I¡¯m sorry for not being there¡¯? Can Diana just accept that? Could she even say those words to her? Would she even- ¡°Crystal!¡± ¡°Uah!? W-What!?¡± ¡°Are you okay? You look pale.¡± By the time she realised, Nestra was awake and was staring at her worriedly. Did she just ignore her this whole time? Should she apologise for not listening? More and more, her mind clouded with questions.Stolen story; please report. ¡°Crystal!¡± ¡°Uah!?¡± ¡°Are. You. Okay?¡± ¡°I-I¡¯m fi-¡± No, she wasn¡¯t fine, not in the slightest. ¡°I, I don¡¯t know.¡± ¡°Don¡¯t, know what exactly?¡± What¡¯s wrong with her suddenly? Where did the stoic, badass Crystal that took down that giant monster go? ¡°What¡­should I say to Diana¡­?¡± ¡°What do you mean?¡± ¡°I¡­She was crying, blaming herself for everything¡­But, what should I say then? I¡¯ve never comforted someone before¡­¡± ¡®Oh¡­So that¡¯s it.¡¯ Was what Nestra thought as she looked at the confused Crystal. It seems she was confused as to what to do for Diana, and whether Diana would even listen to her and calm down after that. The problem was simple really. It was, a lack of [Self Confidence]! It was rather confusing as to why the awesomely powerful Crystal would doubt herself on what to say to her fellow friend, but she won¡¯t inquire further. Solving a case like this was quite tricky, since giving someone confidence wasn¡¯t as easy as taking it from someone else and giving it to her. And if she handled it wrong, her confidence might even take a hit and drop even further. Hmm¡­Think, think¡­If this was a visual novel, what option should she pick to say¡­? Wait, no, that¡¯s not an appropriate answer, but, For her, the answer seems simple really. ¡°Just, be honest, I guess?¡± ¡°Be¡­Honest?¡± ¡°Yeah. Just say anything that comes to your heart. Diana might not like it, but it¡¯s better than keeping a lid over it all.¡± ¨CBut, what should I say then? Even if she was keen on being honest, it still doesn¡¯t answer the main question. Though they may seem close, Crystal knew near to none about Diana. She didn¡¯t know why she came into the dungeon, why she wanted her as a companion, what she liked and disliked, what her goals were, she knew none of those things. She didn¡¯t know where she came from, what this place called ¡®America¡¯ was, why she had the powers of a slime, what her stats and level were, what skills she had, nothing. She didn¡¯t know anything. She never bothered to ask anything. And because of her ignorance, all that, boils down, to this very moment. ¡°Hngh¡­? C, Crystal¡­?¡± ¡°D-Diana!?¡± With this, Diana was now awake, and the moment of action has come. ¨CI¡­What should I say to her? She didn¡¯t know. ¨CI, I¡¯m not¡­I can¡¯t be honest. Honesty, was a difficult expression to give. Being genuine with someone needed courage and resolve. Did she have both of those aspects? Could she pull off this without messing it up? No, how can she? Because, ¨CI, can¡¯t even be honest with myself. She may be powerful and bold in battle. Her enemies may fall before her and her magic. But that was it. She was just powerful in battle. Just being powerful in battle wasn¡¯t enough. But¡­ ¡°Hey, Crystal¡­I¡­¡± ¨CNo, I won¡¯t hide, not now. Yeah, she couldn¡¯t hide behind her false fa?ade any longer. What would hiding now do? She would just postpone it, again and again, until one day, everything breaks open, and the weak truth of hers is exposed. She, didn¡¯t want that. ¡°¡­Diana.¡± ¡°w-what is it¡­?¡± Because, ¡°I¡¯m¡­I¡­I¡¯m sorry.¡± ¡°¡­¡­Eh?¡± The face she¡¯s shown until now, the words that had left her mouth, were nothing but a lie. ¡°S-Sorry, for¡­what¡­?¡± ¡°For¡­For lying to you.¡± ¡°L¡­Lying¡­?¡± Diana was obviously confused! She just woke up to see Crystal staring at her. ¡®Maybe she¡¯s finally angry at me¡­¡¯ Was what she thought in her mind as she weakly replied to her call. But why was she sorry? And what did she lie about? All this development was too much, even for a slime queen like her! ¡°Yeah¡­Um¡­Okay, uh, so what, do you think of me?¡± ¡°¡­Huh? O-Oh, um¡­You¡¯re cool¡­really strong¡­and-¡° ¡°That¡¯s¡­all a lie.¡± ¡°¡­¡­So¡­You¡¯re actually really weak?¡± ¡°N-No! I¡¯m strong, you dumba-¡­I mean, yeah, I¡¯m strong, but that part where you said I¡¯m cool? I¡­really doubt that.¡± ¡®Cool and Strong¡¯ These were the two words that Diana had kept in her mind when she thought about Crystal. I mean, who can blame her? She could send magic blades through the air, cleave a giant in two, encase the enemy in a dome of death! That¡¯s amazing! ¡°You see¡­I¡¯m actually still pretty young, so I don¡¯t know much about this world. I¡¯m also¡­a magic fanatic. I love any magic that¡¯s really strong and cool looking! Like, when that time we went ¡®Poof!¡¯ and appeared in that other room because of teleportation magic, I was impressed!¡± Well, this was new. For the first time in, like, ever, Crystal was smiling as she talked! Not just smiling even, she was also laughing as she explained about herself. Not just Diana, but everyone else was also surprised by the sudden change! ¡°I¡¯m also a bit shy¡­and I get embarrassed quickly. When I was first born, Admin said that I needed to be brave as the last boss, so I put on a mask over myself, a persona I suppose. And, I guess it just stuck around¡­But, also because of that, all I could do was hide¡­hide, and nothing else.¡± She smiled wryly as she recalled her first days in the dungeon, having to put on a brave front as she tackled the adventurers head on. Over time, she even grew an arrogant and haughty way of speaking, which only served to hide her inner feelings from others, even her own creator. ¡°So¡­yeah. That¡¯s, pretty much how I really am. Because of that, I¡­I don¡¯t know what to say about your guilt, or anything really. I only said ¡®It¡¯s okay¡¯, because¡­I didn¡¯t know what to say to you. But, I, really think it¡¯s okay, that you put us all through that, because that¡¯s just how life works, right?¡± There. She finally said it all. Everything she¡¯s hidden under her cold exterior, her genuine thoughts and feelings she had kept tucked under the rug, everything was now wide open to see. ¡°Crystal¡­¡± Yet, despite that, she didn¡¯t feel stiff or anxious about it. For the first time, she felt genuinely relaxed, as if a large weight had been lifted from her. But- ¡°H-Hya!? D-Damnit!! D-Don¡¯t j-just hug me s-suddenly!!¡± ¡°Hehe~, sorry. But, I¡¯m sorry too then. I¡¯ve, also been lying too.¡± ¡°¡­?¡± Letting Crystal go, Diana took a deep breath, and looked straight into her eyes. ¡°Will, you listen too, Crystal?¡± ¡°Uh¡­Yeah, sure.¡± ¡­¡­¡­¡­¡­¡­¡­¡­ ¡°¡­Eh? EH!? Y-You¡¯re¡­You¡¯re from another world!?¡± ¡°Ehehe~, yeah, that¡¯s right.¡± Obviously, Crystal was surprised! Since Diana was really keen on explaining this place called ¡®America¡¯, which was a place she had never heard of, she had thought that maybe it was someplace really far away. But, nope! It¡¯s in another world! The fact that another world besides the one she currently knew wasn¡¯t very surprising, since spirits like her came from another world, but for a human like Diana to be brought here from this thing called a ¡®Monitor¡¯!? How unexpected! From what Diana told, the world she was born in was a place without any magic, which was probably due to Earth¡¯s low concentration of mana. Then, what kind of spell was cast to bring her here? [World Travelling] wasn¡¯t something that uncommon, since the human kingdom has a spell capable of doing exactly just that, most often used to summon existences known as ¡®Heroes¡¯, but there didn¡¯t seem to be anyone in Diana¡¯s room, and her monitor definitely wasn¡¯t some kind of magic device! ¡°¡­Then, no, ice, cream?¡± ¡°Yeah, sorry¡­But I can still make hotdogs!¡± And of course, Rei¡¯s first concerns were about the food she was unable to taste. But hey! Hotdogs and hamburgers should still be something she can make! Well, she¡¯d need to increase her cooking skill first though. ¡°¡­Yay.¡± Okay~! Rei¡¯s back to being happy again, so all¡¯s good! Well, while Rei was concerned about food, Crystal wasn¡¯t doing any better either. ¡®T-Then¡­! S-S-Space Magic!?¡¯ If the use of [Space Magic] was a fact, then that should explain all the odd anomalies Diana felt before she woke up in this world, like how the sounds outside her room suddenly vanished, or how she just lost consciousness and woke up. That doesn¡¯t explain why she swapped genders though [Space Magic] was high tier magic. Like, so high tier, that not even master magic casters could even master! It was one of the pinnacles of magic! Similar to that teleport spell from the earlier challenge, [Space Magic] allowed the caster to warp and bend space to their desires, which also allows them to teleport. Of course, with mastery, the user can bend the laws of physics, distort gravity, and even stop time at some occasions! If there was someone who would be able to do all that, he would be an archmage! ¡®Haa~, I wanna meet him~¡¯ ¡°Crystal?¡± ¡°H-Hya!? W-What is it!?¡± ¡°So¡­Do you believe me?¡± ¡°¡­I don¡¯t think I have a choice? It sounds so bizarre that it sounds true.¡± ¡®How does that even work!?¡¯ She retorted softly in her heart as she smiled. Well, she seems rather unsure, but she believed her, I suppose? But, she¡¯s glad to see that they haven¡¯t changed one bit. Rei was still being the silent food-lover she is, and Crystal, while she was much more open and genuine now, was still acting like her usual self. ¡°Ne, Crystal?¡± ¡°Hmm? What is it?¡± ¡°Umm¡­It¡¯s a bit random, but¡­Do, you still want to go home?¡± Ah¡­right. Despite all this, it didn¡¯t change the fact that Diana had forced her out of her own home. And now that she felt the full pressure of her actions, she was feeling guilty over it. But, well, ¡°No, not anymore.¡± ¡°¡­Are you sure?¡± ¡°¡­Yeah. It took me some time, but I think I finally realised my own desire to leave and journey out into the world, together with you of course.¡± ¡°C-Crystal¡­!¡± And so, comes the end of this arc, where the main heroines finally make up and realise each other¡¯s feelings. Together, they shall strive through this world, and discover its many wonders and secrets! And also try and cook some food for Rei to eat too! [32] Time to Continue the Journey! To start off, ¡°Hey, Diana, do you know what Facebook is?¡± ¡°Face¡­Book? Is it an app that records faces or something?¡± Nestra decided to ask a completely random question. Going back a bit, after everyone got along better with each other(and Nestra¡¯s silent lamenting for being left out), the big trio and their trusty golem(in golem core mode) finally stood up and walked towards where the teleport circle was. They did enter this place to gain power and experience, so now that they¡¯re done, it was time to leave. But, there¡¯s been something nagging at Nestra¡¯s mind, so she decided to ask so. ¡®So¡­It¡¯s true after all.¡¯ As an existence created from Diana¡¯s ego, she retained all her memories and some of her personalities. That also meant that every single game reference she said, Diana would also know. But, if Diana didn¡¯t even know Facebook, something must be wrong, right? ¡°¡­¡­¡± ¡°Nestra? What¡¯s wrong?¡± Ever since Diana was brought into this world, and found that she was now a female, her personality has been getting warped from time to time. Like calling things cute, being interesting in things she wouldn¡¯t normally, or other weird stuff Diana pulled off. Does that slowly progressing change affect her mind and memories as well? ¡°Yoohoo~? Nestra?¡± No, that didn¡¯t seem right. Even as her personality became more and more girly, her memories seem to be kept intact. Then, maybe dying caused something inside her to change? After all, you don¡¯t just come back from death saying ¡®I¡¯m fine~!¡¯ without any worries. Something must have been lost as she passed through the Sanzu river. Hmm¡­But that also seems kinda unlikely too¡­ ¡°Nestra~? You okay? Need some orange juice?¡± Then, ¡®¡­Slimey, is it¡­¡¯ Yeah, that¡¯s the only plausible explanation to all this. After Diana came back to life, while she wasn¡¯t sure if Crystal or Rei even noticed this, but Slimey was nowhere to be seen. It was also quite odd to notice that Diana was sweating ¡®Slime¡¯ when they were having that intense talk from earlier. Put two and two together, then she could somewhat guess that Slimey must have done something to Diana to bring her back to life. Either that being allowing himself to become her new literal heart, becoming her life force, or maybe- ¡°Diana, put out your finger for a moment.¡± ¡°Eh? Umm, okay, but what are you-¡± With unmatched speed, Nestra pulled her knife out of her sheath and cut a wound into her hand! ¡°KYAAAaaaaa¡­Eh? It doesn¡¯t hurt¡­? Oya, it¡¯s even healing?!¡± ¡®Guessed it.¡¯ ¡°Ahaha~, I guess my [Slimic Sublimation]¡¯s gotten even stronger!¡± ¡®That¡¯s obviously not the case, you idiot!¡¯ She retorted silently in her heart. The fact that Diana sweats slime now, that Diana couldn¡¯t feel pain anymore and her injuries healing, and the fact that she¡¯s forgotten one of the biggest social medias in recent years, she was now convinced. Slimey and Diana, had merged and become one! ¡°Anyways! What was that for!?¡± ¡°Haha¡­Sorry, just testing something out.¡± Her knowledge was quite limited, but what Slimey must have done might be distantly related to how Nestra herself got created. There does exist the technique to merge two existences together, to create a new existence. This was usually done by merging two different souls into one by force. Slimey must have done something close to that. As to how he managed to do that, she wasn¡¯t quite so sure, but it¡¯s probably related as to the fact that Diana was a slime queen, and Slimey was her loyal servant. Anyways, defining a [Soul] was actually quite simple. In this world, unlike back on Earth, a [Soul] wasn¡¯t a mystical existence that everyone had lying inside them. Instead, a [Soul] was the manifestation of that person¡¯s mana, this being [MP]. To illustrate, think of a [Soul] as an iPhone. When you¡¯re using an iPhone, the iPhone itself doesn¡¯t change much physically, but the battery is slowly being used up as you use it to, I don¡¯t know, play candy crush? The same goes for a [Soul]. When you are using Magic, your MP is used up, but it¡¯ll charge back up in time. The amount of MP you¡¯re carrying doesn¡¯t change, no matter how many Thorn Bind Hostages you cast on Dogmeat for ¡®science¡¯. This meant, when Slimey decided to merge together with Diana, he forcefully fed himself into Diana¡¯s soul. And since Diana was pretty dead at the time, her soul was very weak, so, because Slimey¡¯s [Soul] was stronger, it forcefully expelled some of Diana¡¯s soul and filled the gap. Of course, she wasn¡¯t sure if that was completely correct, but it seems to be the most likely. A [Soul], just like one would think, aside from being MP, was the embodiment of the person having it. Their personalities, memories, likes, dislikes, everything they had inside was stored inside their [Soul].The tale has been stolen; if detected on Amazon, report the violation. So, when Slimey forced his way into Diana¡¯s heart(literally), some(a lot) of Diana¡¯s memories and original personality must have been lost(hopefully not). As how much of Diana had changed, she didn¡¯t know, but one thing still stands, It¡¯s¡­scary really, to have your memories lost. But, Diana was seemingly oblivious to that, and Rei and Crystal don¡¯t seem to mind it that much, so perhaps all will go fine and dandy, yeah? Well, that, and Diana¡¯s a pure slime now, so any pure physical attack will just pass through her, so, yeah! ¡°Well, sorry for cutting you. Make sure you don¡¯t get eaten by a zombie once you¡¯re out, alright?¡± ¡°Yeah~! Will do!¡± ¡°Alright then, see you.¡± ¡°Bye bye!¡± With that, the three stepped into the teleportation circle, and disappeared into thin air, leaving Nestra behind. She somewhat regretted that she couldn¡¯t come with her, but she¡¯s a property of this dungeon, and as such, she was bounded here, no matter what she wanted. Diana suggested trying to sever that connection, but she¡¯ll die, so she immediately said no. ¡°Well¡­time to clean the place up, I suppose.¡± ¡­¡­¡­¡­¡­¡­¡­¡­ *Guuuaaaa* *Crackle, crackle* ¡°Is it just me¡­Or were these peeps waiting for us here?¡± ¡°¡­Food?¡± Once they appeared on the surface, they noticed the large crowd of undead waiting around them. And of course, the first thing Rei thought about was how she wanted to eat them. Well, she¡¯s also kinda hungry, so some zombie meat will be nice~ ¡°Hey, Crystal, let¡¯s crush these guys, alright?¡± ¡°Why don¡¯t you do it? You¡¯re strong enough to do it, right? I-I mean, it¡¯s not like I w-won¡¯t do-¡° ¡°Oh, ok then. [Corrosive Slime Wave]¡± Without waiting for her to finish, she created a wave of corrosive slime around them, and engulfed all and every undead waiting to crunch them up. ¡°Let me finish!¡± ¡°Ehehe~¡± As a result, all the skelly bones and walking rotting corpses were swallowed up by the green slimy substance, and quickly began corroding away as her slime did the work! ¡°¡­Leave, some.¡± ¡°Okay~¡± As commanded, she left some zombies out for dinner. With no waiting, Rei jumped in and devoured the ¡®crying?¡¯ zombie. Diana didn¡¯t wait either, and also began eating another zombie nearby. Hmm? Something about this didn¡¯t seem right¡­? ¡®Ah! We haven¡¯t made it into jerky yet! No wonder it tastes weird!¡¯ Anyways, her stomach¡¯s satisfied now, and the moon was getting pretty high up into the sky, so it¡¯s probably better to call it quits now. They just slept, but some more sleep wouldn¡¯t hurt! So, with Rei as their personal GPS, they returned to the cozy cave Rei had conquered and had a nice sleep. ¡­¡­¡­¡­¡­¡­¡­¡­ The next day came by quickly, along with the nice taste of the zombie jerky Rei had left inside the cave. Also, since she was now naked and all, she created some Dogoos to her command and sent them out to bring back some clothing. She also told them explicitly to bring ones that would seemingly fit her female body. In the end, after many failed attempts by her loyal slimes, she clothed herself with a nice pair of brown leather jeans, white T-shirt, a pair of shoes(no socks though), and a grey cloak to wear around her, ¡®cause it looks cool. Also, this was completely random, but look! [Congratulations! [Bubble Magic] is now Level 10!] [[Bubble Magic] has reached Max Level. All requirements have been fulfilled. Evolve skill?] Yep! After some more playing around with bubbles, her [Bubble Magic] finally got to level 10! Which means, evolution time! Thankfully, there wasn¡¯t any need to sacrifice two more skills, so she quickly clicked [Yes]! [Conditions have been met. [Bubble Magic] evolves into [Arcane Bubble Magic]] [Skill Evolution has occurred. Gained 15 Skill Points.] [Arcane Bubble Magic] Lv 1/25 Allows you to form bubbles. You can control various aspects; Size, speed, and shape. Air Density and Elasticity are now also variable aspects. Woah¡­Woah~! That¡¯s amazing! The once ¡®kind of useless, not really¡¯ party skill has evolved into a cool one! Well, she wasn¡¯t too sure yet, but ¡®Air Density¡¯ and ¡®Elasticity¡¯ can now be controlled?! That sounds amazing! Immediately, she tested the new skill out. First, she pumped the elasticity of the bubble up to max, and created the bubble. The result? Not much actually. It¡¯s just an increase on the ¡®Shape¡¯ aspect of the magic, allowing her to more easily mold the bubble into different interesting shapes. Next, she cracked the the ¡®Air Density¡¯ inside the bubble up to Mt. Everest, and the results were much more interesting this time! Before she even realised, the bubble couldn¡¯t hold on, and popped, causing the insane amount of air inside to burst out like an air bomb. Since it¡¯s also considered magic, and she was hit in point-blank range, it hurt, a lot. But! That meant, That she could probably make an attack with this! So, with her excitement building, she decided to try and experiment, to see and find out how much air she could densely pack into the bubble before it bursts open. And after many trials and error, here¡¯s her result! ¡°[Stray Cat: Composite Bullet]!¡± *Bam!* Summoning the special bubble she made, she aimed it at the wall, and fired! At full speed, the bubble flew slightly slower in comparison to her [Slime Railgun], but it¡¯s destructive power was definitely bigger than her go-to [Slime Cannon]! However, there was one flaw to this spell. Despite having more power and speed in comparison to [Slime Cannon], there was no knockback, meaning that if he needed to push back something, like a golem for example, this spell wouldn¡¯t be great. That, and the spell name was¡­way too long. [Tier 2 Spell [Stray Cat: Composite Bullet] has been acquired. 5 Skill Point gained] The name itself was a reference to a stand from the JoJo series, but no matter how many times she tried, she just couldn¡¯t remember from which JoJo series it belonged to! Well, no matter, it won¡¯t impact much. ¡°¡­Diana, here.¡± ¡°Ah! Thank you~!¡± ¡®Is it just me¡­Or is Diana acting girlier than usual?¡¯ Was the vacant thought that popped into Crystal¡¯s mind as she popped the last piece of the zombie jerky into her mouth. Anyways, after some rest and planning, they would be heading out of this forest, which meant that the ¡®Reaper¡¯ as Rei calls it will get in their way. They¡¯ve definitely improved thanks to the recent incident, but will it be enough? ¡­¡­¡­¡­¡­¡­¡­ Inside a castle, far far away, standing on the lands corrupted by magic and death, a woman could be seen, sitting on her throne as she drank the wine in her hand. Coming in, a man entered and kneeled before her, two small horns showing on his forehead. ¡°Ho~, so it¡¯s that time of the millennia again, is it?¡± ¡°I believe so, milady.¡± The woman smiled when she heard the report. After all, it¡¯s not everyday when an enormous surge of mana would burst out from the ground, causing the earth to crack and tremble under its might. A power that could shake the earth itself, one that could be felt from continents away, could only mean one thing. ¡°I wonder what it¡¯ll look like this time around~¡± She smiled widely, knowing that after the long wait, some fun will finally show itself. ¡­¡­¡­¡­¡­¡­¡­ ¡°Are we just going to let this go!?¡± ¡°Calm down already. Getting angry over it won¡¯t do anything.¡± Inside a secluded wooden shack, standing under the harsh snowstorm outside, an argument between two people could be heard. The first one was from a man. His body was bulging with muscles, and his body exuded an aura that kept many that saw it in fear. Sitting across from him, was a young boy, looking not more than 12 years old. However, his aura was even more mature and powerful than the one standing before him. His actual age was unknown, but he was no normal boy. The golden eyes he possessed, staring deep into his soul as he eyed the man sitting before him. ¡°Besides, this one was particularly strong, wasn¡¯t it? We even felt it here.¡± ¡°I-I know! That¡¯s why I said-!¡± ¡°But, if we charge in recklessly, you know what they¡¯ll do to us, right?¡± ¡°I know damnit¡­But¡­!¡± -I can¡¯t just ignore it! Was what he wanted to shout back, but the shining golden pair of eyes staring back at him shut him up for good. ¡°And besides, I don¡¯t sense that much danger from this one, so we¡¯ll be fine.¡± ¡°I¡­I see¡­¡± ¡°So, we¡¯ll just wait, alright?¡± ¡­¡­¡­¡­¡­¡­¡­ *Ruuuuuuu* ¡°He~, so that¡¯s the ¡®Reaper¡¯¡­¡± *You¡­You¡¯re¡­not¡­afraid¡­?* ¡°Heh, we¡¯ve trained our lives out for this. [Ruin Call: Ixion]!¡± ¡°¡­Ready.¡± As you could probably guess, Diana and co had just reached the edge of the withered forest, and before them, stood a large cloaked figure with a large steel scythe in his hands. This was, no doubt, the ¡®Reaper¡¯! ¡°Get ready everyone! We¡¯ll be taking him down!¡± ¡°Agreed.¡± ¡°¡­Un.¡± Fists ready, golem built, explosive bubbles conjured, and her staff in hand, they all took their stances, and faced off against the ¡®Reaper¡¯! [33] The Reaper Around 10 minutes after where we left off, Diana and her fellow friends were now engaged in a battle against the ¡®Reaper¡¯, a monster that would hunt down any who dared to try and leave the withered forest. And so to say, this guy was no pushover! ¡°¡­Kuh.¡± Here¡¯s how the formation went: Rei and the golem would be the aggro keeper, attacking the reaper head on to keep its attention on them. Meanwhile, Diana would run around the guy as she attacked with her magic. And lastly, Crystal was standing farther away, shooting her [Phantom Blade] when the chance arises. But, even under this intense fire, the reaper was still standing strong. Even worse, its attacks were getting faster! Whether that was it getting agitated or it getting desperate, she didn¡¯t know, but the increased attack speed was getting deadly! *Fools¡­DIE* ¡°Kya!?¡± Suddenly, the reaper held its magic scythe up, and swung it around, knocking Diana back! She was able to soften the landing by creating some slime, but that single attack still took out a pretty good chunk of her HP. Also, it was also quite saddening that she couldn¡¯t use her [Slime] based attacks, since the invisible around it would just repel it back, or even shoot it back at her. So, she¡¯s been using her [Stray Cat] bubbles to cause damage. ¡°¡­Diana.¡± ¡°I¡¯m fine! Keep attacking it!¡± Using the chance, she charged herself up, and sent a strong punch at the thing! Seriously, she could even see ripples shooting out from the impact! The reaper only flinched from the strike, but Crystal quickly followed it up with a set of [Phantom Blades], finally breaking through the barrier and stabbing right into the reaper¡¯s body! *MERE MORTALS. [CONFINE]!* *Vuuu!?* Suddenly, a stream of dark ¡®tentacles?¡¯ came out of the ground and coiled around the golem¡¯s rocky body. Would¡¯ve been a deadly moment, but it¡¯s a golem, so it just discarded its body and rebuilt itself, which seems to have caught the guy off-guard. Which was then rewarded with several exploding bubbles from Diana, a strong punch from Rei, and several more [Phantom Blades] from Crystal. *YOUR FOOLISH ENDEAVORS WILL NOT BRING ANYTHING* ¡°Let¡¯s proof that, shall we!?¡± The reaper probably said that because it was getting desperate, which only served to make Diana even more pumped up to take him down. Now that the barrier was broken, Diana sent a large [Corrosive Slime Wave] to slow its movement, and also deal some damage from the corrosion, but that plan failed since the reaper simply re-casted the barrier and repelled the incoming slime. *I AM IMMORTAL. I CANNOT BE DEFEATED* Not like anyone cared, as Rei sent a full *Ora, ora, ora, ora, ora, ora* at the reaper. It didn¡¯t deal much damage, but it was a good tactic to slow the reaper down, which then Crystal used to cast her [Shadow Bind] and seal its movement for a bit. *FADE INTO DARKNESS! [DEATH TO ALL]* [Death to All], a skill that caused a black mist to ooze out of the reaper¡¯s body. Anything that comes into contact with it, will quickly degrade and die. It was a deadly insta-kill spell! Sadly, they¡¯ve dealt with this spell before(the reaper started the battle with this spell), so Rei and golem quickly stepped away, whilst Diana created a large wall of slime around the reaper, trapping the black mist inside. Of course, since the black mist was touching the slime, the slime was also getting destroyed, but Diana immediately just added more and more layers of slime to back it up, so no worries~ *YOU¡¯RE MORTALS, HOW!?* ¡°Hey~, that¡¯s what Ronan The Accuser said before he died!¡± ¡°¡­?¡± I guess even if her memories are falling apart, references will just keep coming eh? Anyways, the black mist was now gone, and the reaper was on its cooldown time! It¡¯s the perfect time for an all-out attack! ¡°Let¡¯s do this everyone!¡± A volley of explosive bubbles, a full assault from Rei, the golem¡¯s rocky minigun attack, and Crystal¡¯s powerful [Phantom Blades] all launched at ones, easily breaking through the barrier again, and dealing some juicy damage! *D¡­DAMN¡­MORTALS!!!!* ¡°Woah, it¡¯s angry now~¡± Seemingly fed up from all the damage it¡¯s taken, the reaper sheds its initial skin, and exposes its ethereal true form, a pure materialisation of mana! ¡°It¡¯s kinda pretty!¡± ¡°Don¡¯t get distracted. The end is near.¡± Now that its skin(and cloak) was no more, the ¡®Reaper¡¯ was now completely exposed, which means no more extensive defence! *FDEA AYWA YUO IBELCEIM!! TIHS IS TEH EDN!! {DVOEANTAITS]!i!i* *BOOOOOOOOOOOOOOOMMMMMMM!!!!!!* ¡°REI!!!¡± With that word jumble, the large figure of mana shined tremendously and exploded with intense force, swallowing Rei and the golem up, and sending Diana and Crystal flying back! ¡°¡­I¡¯m, Fine.¡± ¡°Thank God~¡­¡± Thankfully, Rei being Rei, although half of her entire body was literally blown apart, she was quickly healing back to her original state. And the golem, well, his core was near unbreakable, so he¡¯s also fine, but his mana seems to have run out. *%@$$&##%@&%&^$%#@%^#^^%&#^$@&^%&%&#%$@&*%^%* Oof~, it seems like the ¡®Reaper¡¯ was truly broken now! It seems like, whatever that attack was, took out quite a lot from the guy. And now, he was just a broken jumble of pure mana, flickering and spinning as it tried its best to retain its ethereal form.Stolen from its rightful place, this narrative is not meant to be on Amazon; report any sightings. ¡°Well, who wants to do the last hit? Crystal?¡± ¡°Hmm¡­Do you mind?¡± ¡°Nope! Go ahead~!¡± ¡°¡­Un.¡± ¡°Alright!¡± Let¡¯s make this ending flashy! ¡°[Phantom Blade: Death Cleave]!!¡± Above her, an enormous [Phantom Blade], probably around the size of a cargo truck appeared, and slashed the wriggling mana monstrosity apart! It ¡®wailed?¡¯ out one last time, before it broke apart and disappeared into the air. With this, the battle with the reaper, was over! [Enemy haS BeEn sLAin? Ga!nEd #%@$ ExpErIEncE} *&%^@#&%!#* ¡­Or, so she thought, but nope! Just as the pure collage of mana was dissipating, it suddenly merged back together, this time looking more jumbled and messed up than before! ¡°Seems like it isn¡¯t over yet~¡­¡± ¡°Seems like it.¡± ¡°¡­Agreed.¡± And everyone was on a consensus about one thing: It¡¯s time, for the second round! First up, a nice serving of several [Phantom Blades] to serve as breakfast, but to their surprise, once the blades hit the thing, they disappeared! No, they didn¡¯t just disappear, they melted down back to mana and got sucked in! ¡°How about this!?¡± To follow up, Diana shot out some explosive bubbles, and they did hit and explode, but did it even take any damage? And Rei also tried punching the damn thing too, but her fists only ended up passing through the thing! *%$#@$*^%%@* ¡°Wha-!?¡± Before Crystal could even react, the ground under her suddenly shined, before it exploded with intense might, swallowing up everyone in the battlefield. So to say, they weren¡¯t in the best of situations right now. That explosion took out an enormous amount of Crystal¡¯s HP. She wasn¡¯t quite dead yet, but even one claw from a nearby zombie could probably kill her. Diana was¡­nowhere to be seen. The only one capable to fight was probably Rei, but even she was having trouble, since her MP was close to emptying out, and when her mana¡¯s out, regeneration would not be possible. I.e., death. ¡°Woo~! I¡¯m falling~¡± ¡°W¡­Wha¡­?¡± But, well, the reason why Diana was nowhere to be seen, was because she was in the sky, and she was falling down, really quickly! Using a technique she recently invented(with the help of Rei), she found out that she could turn herself into a slime, and then [Slime Cannon] herself into the distance, leaving behind quite a bit of slime in her place. It was a technique that was quite costly to her MP, since it took out 40%, but it¡¯s good enough to secure her safety! Although, that means she¡¯s naked, again. Not that she minded it anyways. Gotta get some more clothes after this Anyways, softening her landing with her slime form, she reverted back to human form and quickly met up with Crystal, who was weakly lying down on the scorched ground. ¡°Crystal, you okay?¡± ¡°I¡¯m¡­fine. Just¡­try and¡­kill it.¡± ¡°Hmm¡­¡± Now, how to defeat this thing? Her explosive bubbles don¡¯t seem to work. She tried shooting a [Slime Cannon] at it, but it just got sucked in, and Rei¡¯s fists could only pass through the collage of pure mana. ¡­It seems, they were only left with one choice¡­The Joestar¡¯s special family technique. When everything falls apart, and the end is nowhere in sight, the one choice to take is: ¡°Run away~!¡± ¡°W-Wah!?¡± ¡°¡­Let¡¯s, go.¡± Created some large Dogoos to carry Crystal, she turned towards the green plains on the outside, and ran as fast as her legs could take her! Rei quickly picked the golem core up and followed in suit! *$%#@*^!#$* The pure mass of mana ¡®shouted¡¯ in ¡®anger?¡¯ as it watched Diana and co escape into the green grassy plains waiting outside of the withered forest. It would¡¯ve loved to kill them, but it couldn¡¯t move now, so it save the killing for another day. The escap-, I mean, ¡®Tactical Retreat¡¯ was a complete success! After they made sure that they were nowhere near that damned withered forest anymore, Diana gently placed Crystal down on the grass and applied her [Slime Mending] on her. Well, she also applied some on herself too, since her HP did also take one hella beating. ¡°Phew¡­We¡¯re alive!!¡± Well, they¡¯re alive, but this kinda feels a bit disappointing for her¡­Since, ya know, Diana did just go and fight that monstrous enemy with her friends, and they came out without any Exp or rewards. They did just come out alive, so I guess that¡¯s already plenty enough, but she couldn¡¯t shake off that feeling of dissatisfaction. In fact, everyone on her team was also feeling quite bumped out about it, Crystal especially. Even the golem core shined slightly dimmer than usual. And so, with that lingering taste of defeat, the big trio lied down and slept for the day. It¡¯s still noon, but whatever, they were tired ¡­¡­¡­¡­¡­¡­¡­ Far up in the mountains, where the storm never ceases, and the snow never fades, a single wooden cottage could be seen, standing in the midst of it all. Inside, a fireplace had been lit. The flames flickering and dancing as the embers rose into the air. The soft crackles of the falling firewood filled the atmosphere, breaking through the silence that hung in the air. And inside that exact house, the sight of a single boy could be seen, casually sleeping on his bed like it¡¯s nobody¡¯s business. ¡°Huah¡­I¡¯m so tired¡­¡± He yawned as he complained so, despite having just slept for, like, 10 hours, as he rolled over and dug his face into the pillow he loved to the end of his life. Well, he should be up and going right now, since the kingdom did just send him a mission to accomplish, but¡­Sleep sounded so much better than working~ ¡°*Knock, knock* Uh¡­Master? Are¡­Are you s-still inside?¡± ¡°Muu¡­Who is it¡­?¡± And just as he was about to trail into his dream world again-!, he could hear someone knocking from the outside. From that frail voice that man had, it was probably his student who had gone to train under him. ¡®What was his name again¡­?¡¯ ¡°I-It¡¯s Ilgua M-Master! P-Please let m-me in!¡± Ah, right. Ilgua, that young boy who had somehow managed to climb up all the way here on his own, and begged him to teach him the ways to master the art of battle. ¡°The door¡¯s not locked¡­Just, huah¡­come in already¡­¡± ¡°T-Thank you very much!!¡± With that said and done, the door opened, and in came a young boy, most likely in his early 18¡¯s. He looked like any normal boy from the kingdom, aspiring to become someone special. But, the embers that burned in his eyes initially interested him. As for what and why he wanted to learn under him¡­Who knows, he didn¡¯t listen. ¡°Huah¡­Just, wait there, I¡¯ll get you a drink or something¡­¡± ¡°A-Ah! No need! I have my own!¡± ¡°Riiight¡­Go and sit down¡­¡± At least that¡¯s one thing he liked about this boy. Unlike a certain king who gave him requests after requests, this boy would come to him prepared, with his own food and drinks, and his energy stocked up. Which is needed, since training in this environment can get quite tiring. Heck, even trying to hike this thing without any further help was near suicidal. ¡°Umm¡­Master, can¡­can I ask something?¡± ¡°Hmm¡­? What is it¡­?¡± ¡°I¡­Lately, I¡¯ve been having this feeling of¡­danger, somehow. As if, something ominous had just happened¡­¡± ¡®Something ominous, he says¡­¡¯ He thought over it for a bit. Ilgua, this boy, he¡¯s been training under him for¡­around 5 months now? And he¡¯s gotten a pretty good grasp at his capabilities. Though he might not look like it, this boy had a power that was pretty similar to that of [Clairvoyance]. It doesn¡¯t let him look into the future or the past or whatnot, but it does give him a warning in advance about some danger, and if he¡¯d say anything, that¡¯s quite a useful ability. ¡°¡­Care to describe?¡± His eyes shone golden, Ilgua now knowing that his master had gotten serious. ¡°I¡¯ve been hearing wails and screams about something in my dreams, and this large hooded figure that-¡° ¡°Ah, never mind, it¡¯s just the reaper.¡± Or¡­so he thought. But, nope. As soon as he heard what the ¡®monster¡¯ in his dreams looked like the ¡®Reaper¡¯, his eyes lost the golden shine it just had, and he immediately dropped back onto his lovely pillow. ¡°E-Eh!? T-The ¡®Reaper¡¯!?¡± ¡°Ou¡­Why¡¯re you so surprised¡­?¡± ¡®Of course I am!!¡¯ He retorted silently in his heart, knowing that something as petty as the ¡®Reaper¡¯ won¡¯t be enough to deter this legendary man(Boy?) sleeping before him. Well, either that, or he¡¯s just so lazy that it¡¯s not registered to him yet. Knowing his master, it was probably the latter. ¡°Besides¡­Someone¡¯s already took it down¡­¡± ¡°¡­Eh? EH!? S-Seriously!? Who was it!? Isn¡¯t the reaper immortal!? Is that person a god!?¡± ¡°Don¡¯t be so loud~¡­¡± Ah, and here comes the other annoying side of this kid. Once he gets excited on something, he gets way over the top about it, and it becomes an interrogation. Well, having some enthusiasm like this in his long life wasn¡¯t that bad either. ¡°Don¡¯t ask so many at the same time¡­¡± ¡°Ah¡­s-sorry.¡± ¡°Huah¡­I don¡¯t know who exactly ¡®beat¡¯ it, but¡­she¡¯s one of a kind.¡± Yes, whoever this girl is, who went up against the reaper and managed to break it down into its purest form, was strong. Not, battle-wise. In comparison to the other two girls who fought alongside her, she was way weaker, but her soul¡­It was, a sight to behold. A sight to behold, because even he, a master who had power people could only dream of, couldn¡¯t even look into that girl¡¯s soul. That¡¯s because of her [Soul Conqueror] title btw ¡°¡¯She¡¯? So it¡¯s a female? Is she human? Elf!? A monster!? A dragon even!?¡± ¡°Hua~, stop asking¡­¡± ¡°S-Sorry¡­¡± ¡°As for race¡­I¡¯m not too sure¡­She looks like a human, but she also seems to be a slime¡­she fights like a monster¡­but acts like a human¡­¡± Truth be told, he only knew one thing about her: ¡°But-¡° His eyes shone gold once more. ¡°-She¡¯s not a being of this world.¡± [34] Another (Temporary) Member! ¡°-She¡¯s not a being of this world.¡± ¡°¡­W, What does¡­that mean?¡± Huh? ¡®Not a being of this world¡¯? Eh? Was his master getting too drowsy to think? Eh? EH? Ilgua¡¯s mind pretty much had malfunctioned. Well, hearing that something was ¡®from another world that wasn¡¯t ours¡¯ would surely just make everyone go ¡®¡­ah?¡¯. Either that, or make other people look at you like a crazy person. ¡°Huah¡­Did you not hear¡­? She¡¯s not from this world¡­¡± ¡°Eh? EH!? Seriously!? From another world!? Which world is it!? The spirit world!? Is she a spirit then!? No, wait. You said she¡¯s a human, so¡­¡± Well, this boy sure had some wild imaginations in his head. But, this boy sure was noisy, despite it being morning(evening) right now. Seriously, when¡¯s the sun going to set? He wanted to just go back to sleep already~¡­ The sun¡¯s already setting by the way ¡°Alright¡­Quiet down already¡­¡± ¡°S-Sorry.¡± ¡°¡­¡­¡­¡­Huah¡­I¡¯m sleepy¡­save it for next time¡­Good night~¡± And there he goes, lying back down on his comfy bed and slipping back to sleep. Mm~, maybe he should have some hot tea when he wakes up? Or some coff- ¡°M-Master! Please tell me!!¡± ¡°Hua¡­Fine, fine¡­just stop shaking me already~¡­¡± ¡°A-Ah, sorry.¡± Without facing his disciple(and also while still lying on his bed), he began his little story time. ¡°First¡­You know the concept of being ¡®spirited away¡¯¡­I assume¡­?¡± ¡°You mean¡­When a person or any living being suddenly gets pulled into another world, right? But isn¡¯t that just a myth that was told by one of the ¡®Heroes¡¯?¡± ¡°Riiight~¡­But, you know¡­Those¡­¡¯Heroes¡¯ aren¡¯t wrong¡­By their perception, being brought to our world¡­is the same as being ¡®spirited away¡¯¡­¡± ¡®Then, does that mean the person who ¡®took down¡¯ the Reaper was a hero? Or someone summoned from another world by one of the human kingdoms maybe? But there hasn¡¯t been any info regarding hero summoning yet¡­¡¯ ¡°The ¡®Hero summoning¡¯ has nothing to do with it¡­¡± ¡°Eh!? M-Master read my mind!?¡± ¡°Obviously~¡­Moving on, transportation between different worlds doesn¡¯t only have one route, you know¡­?¡± Also, as a literate student and disciple, as Ilgua was hearing out his master¡¯s explanations, he was also jotting down notes at speeds that would put even Sonic to shame. ¡°As an example¡­umm¡­there¡¯s this phenomenon called a [Rift]. It happens¡­once in a while. For¡­unknown reasons, a tear in space will just¡­open, and connect to another world¡­¡± ¡°I-I didn¡¯t know something like that existed¡­¡± ¡°Another option¡­would be the skill [World Transfer]¡­It does exactly what you¡¯d expect¡­¡± Actually, there was still several more known ways for one to travel between different worlds, but he couldn¡¯t quite remember them all(and he¡¯s too lazy to recall them all). So, that¡¯s when the question arises. Did she travel here ¡®accidentally¡¯, or did she come to this fantastical world intentionally? But! Enough story time, he wanted to sleep now. ¡°Okay~¡­enough story¡­Now, go and get 3 winter feathers from the Ice Phoenix¡­then come back here. I¡¯ll be sleeping here~¡­¡± ¡°E-Eh!? W-Wait, master! Tell me more!!¡± ¡°Zzzz¡­¡± ¡°Ahaha~, he¡¯s already asleep¡­I guess I should head out now¡­and come back alive¡­haha¡­¡± ¡­¡­¡­¡­¡­¡­¡­ Meanwhile, back at the grassy green plains, ¡°Mrm~, it¡¯s evening already, eh~?¡± Standing naked, Diana could be seen, stretching her sore body. Seriously~, that fight with the reaper sure took out a lot from her¡­And she didn¡¯t even get any Exp or loot from that guy! Being bummed out aside, it¡¯s evening now, and she hasn¡¯t eaten in a while, so searching for some food now becomes top priority! Well, that depends if anything even lived in this area, but I digress. Anyways, [Searching for Food] Quest, has begun! Her target for this evening was to find any small monster to kill, cook and eat! Well, more like roast than cook, since she didn¡¯t have any kitchen utensils, and the only thing she could do was gather some sticks from the nearby bushes and make a fire. Turns out, her luck wasn¡¯t as bad as the last time she was in a grassy plain! There in the distance, she spotted her prey, a defenceless grey wolf! I say ¡®defenceless¡¯, because as soon as it tries to bite into her, she could just turn into a slime and smack it unconscious with two [Slime Cannons]. [Enemy has been slain. Gained 55 Experience] ¡°He~, I haven¡¯t seen that in a while.¡± It¡¯s true. If not wrong¡­the last time that appeared was back in¡­Tartarus? Yeah, right before she got sucked in by that black orb. After that¡­A whole lot happened, she happened to die, revive, and then, yeah. On that topic, it¡¯s been a while since she last checked her status. Might as well check! Name: Diana Race: Slime Queen Lv 1 Age: 17 Class: Slime Virtuoso Lv 13/25 Exp: 2750/3300 HP: 176/180 MP: 105/114 SP: 114/116 [Strength]: 58 [Tenacity]: 53 [Agility]: 57 [Intelligence]: 56 [Dexterity]: 57 [Mentality]: 60 [Endurance]: 54 [Wisdom]: 54 [Longevity]: 40 [Skill Points]: 36 {Skills}: [Slimic Sublimation: Lv 1/25], [Slime Magic Lv 6/10], [Assassination Lv 2/10], [Alleviation Lv 1/5], [Cooking Lv 2/10], [Internal Mana Manipulation Lv 2/10], [Arcane Bubble Magic Lv 1/25], [Slime Mend Lv 2/10], [Slime Army Lv 3/10], [Danger Perception Lv 2/10], [Beast Taming Lv 1/10], [Polearm Mastery Lv 3/10], [Slime: Corrosive! Lv 4/10] {Magic}: [Slime Magic Set], [Bubble Magic Set] {Titles}: [Slime Queen], [Conqueror of Slimes], [Soul Conqueror], [Dungeon Crawler] ¡°¡­¡­¡­¡± ¡­¡­Eh? EH!? Level 13¡­? LEVEL 13!? Seriously!? When did that happen!? Last she recalled she was al level 7! She just, like, jumped 6 entire levels! Oh¡­Wait, she did kill quite a lot of monsters back when she engulfed that entire room with corrosive slime, so that explains quite a lot, yeah? Still, seeing that high level still felt quite surreal for her. Also, why was her Slime Queen still at level 1? Well, there might be some special way to gain levels, so that can wait. Anyways, man~, look at her stats! Her HP went up, her SP and MP had a nice boost, all her stats(including her Longevity!) increased(especially Longevity!), her skills levelled up several times, and she even had 36 skill points now! That¡¯s enough for another special skill! But, save that for later. The sun¡¯s setting-, ah, it¡¯d already set, so she should head back as soon as possible. While on her way back, she also picked off some twigs from nearby bushes she happened to come by. By the time she got back, Rei was already awake, her eyes shining as she eyed the dead wolf she was dragging along. Crystal was still asleep, and the golem core was¡­fine? She couldn¡¯t really tell. For starters, she used the twigs she gathered and created a small fire. Then, with the help of butcher Rei who happily sliced up the wolf, she stuck the wolf meat into the sticks as meat skewers and roasted them over the fire. With some twirls and swirls over the fire, and the addition of ¡®taste¡¯ with her [Cooking] skill, the roasted wolf meat skewer, is now done and ready to eat!The narrative has been taken without permission. Report any sightings. ¡°Umm, so~, how does it taste?¡± ¡°¡­Bland.¡± ¡°Well, I didn¡¯t have any seasonings or spices to use, but once I get some, I¡¯ll make some good food for you!¡± ¡°¡­Waiting.¡± Also, while this nice casual conversation was going on, Crystal was actually awake, but she couldn¡¯t find any good moments to jump in(and she¡¯s also too shy to force herself into the conversation). After a while, Rei finally noticed that Crystal was actually awake, and invited her to join the nice casual dinner they were having. In the end though, the conversation ended up with Diana talking about the things she recalled from her home country, and what kind of foods they could buy there. It was then they learnt something known, as ¡®Ramen¡¯. Which happened to confuse them for a bit since Diana kept talking about it ¡®being eaten from a cup¡¯. Anyways, with some more chapters about this thing called ¡®Cup Ramen¡¯ and some more wolf skewers, story time with Diana has officially ended¡­for now. Since they were all energised now, and, well, it¡¯s still night, but heck, why not go and explore this area for a bit? Was what went through Diana¡¯s head as she snuffed out the small fire they had goin¡¯ on. So, under the blanket of twinkling stars, Diana and co got up and began their exploration! And to maybe(hopefully) find some damn clothes for them to wear! Except for Rei of course, since she¡¯ll just eat it if that happens. But¡­Well, it¡¯s night time, so there wasn¡¯t much in terms of monsters or humans, since they should all be asleep right now. That¡¯s a blessing in a sense, since less wasting of energy, but this was just¡­boring. Look, even the golem core agreed! As it shined dimly in agreement. Or that¡¯s how it should be, if not for that conspicuous campfire Rei spotted in the distance. Sitting around the fire, they could see several middle-aged men, with rugged faces and bland clothing. Swords, knives, and bows lie scattered around them. They also seem to be eating something, but she couldn¡¯t tell from this far away. But! If Diana could take a good guess, then those rugged grinning men, must be the oh so infamous, [Bandits]! And that meant that they were hostile enemies, which then meant that a battle was going to occur! ¡°Hey, uh, guys? Mind if I take them all on?¡± Although, she while this was supposed to be a ¡®dangerous¡¯ battle against ruthless bandits, there was something she wanted to try out. So, she wanted to take them all on alone. Technically, anyways. ¡°¡­Sure.¡± ¡°Yeah, go ahead.¡± ¡°Sweet~!¡± If her eyesight hasn¡¯t been declining from all the action she¡¯s been doing, then there should be a total of 8 bandits sitting around that campfire. First up, to prepare her battle regiments! To start, she created herself an army of 8 Dogoos, trained and commanded to specifically leap towards and into the bandits¡¯ mouth and corrode them from the inside. Gross, I know Their tails wiggling with anticipation, the dogoos ran off towards the bandits, cloaked under the darkness of the night-, until they got close enough to the fire that is. ¡°Heyo, boss! Look, a bunch of slimes came our way.¡± The first one to notice was the youngest of the bunch, the ¡®noob¡¯ as they call him. He¡¯s more ¡®level-headed¡¯ than most of them, and handled the bow and arrow. ¡°Pfft, what? Scared or someii-, MMPPFFHH!?¡± The one who replied was the ¡®boss¡¯ of the group, not that it mattered anyways! Since as soon as he opened his mouth, the dogoos suddenly sped up and leapt into his mouth, sliding their way down into his body! As quickly as he was silenced, the corrosion got to work, and his body started to decompose before their very eyes, until only his dirty clothing was left behind. Of course, his bandit crew was absolutely terrified by this display and tried to run away, but the other dogoos quickly jumped into their mouths too and corroded them away. Hmm¡­Although¡­Somehow, something about this feels wrong¡­Wonder why? Just, as she saw those men being killed in an instant, there¡¯s an odd feeling in her stomach, but-, meh, maybe she¡¯s just a bit too full after eating. After their nice meal was done, all the dogoos returned to Diana and merged back with her. With this, she completed two of her missions! First, get her and Crystal some damn clothes to wear, and more interestingly, she found out how to level up her [Slime Queen]! [Enemy has been digested. Energy has been processed and stored] [Congratulations! Slime Queen has levelled up to Level 2! Your stats have improved] So, instead of simple ¡®killing¡¯ them, she needed to ¡®process¡¯ her enemies, if that even made any sense. In other words, she needed to (technically)¡¯eat¡¯ her enemies. By doing that, instead of Exp for her [Slime Virtuoso], she could get Exp for her [Slime Queen]! As for the stat increase¡­It, was pretty much the same as her class. Each stat attribute rose by two or three, and that¡¯s it. It¡¯s still amazing though! Anyways, all that finished and done, they went over to the campfire. As planned, Crystal and Diana picked out some clothing and wore them, which still made them feel uncomfortable, since they didn¡¯t have any panties to¡­yeah. Diana didn¡¯t mind it as much though, since she¡¯s so used to having that exposed all the time. Rei was¡­Oi, Rei was going up and eating the other pieces of clothing. ¡­That aside, there wasn¡¯t much to this bandit camp, aside from the useless rusty weapons and the lingering smell of corroded bandi- ¡°¡­Diana. Here.¡± ¡°Hmm? What is-¡­Who¡¯s this¡­?¡± Never mind! As it turns out, there wasn¡¯t just used weapons and the smell of dead bandits, hidden under a black cloak, Rei found an unconscious young girl, her hands and feet tied up. She was probably kidnapped by these bandits. It seems she was still alive and breathing, just sleeping. ¡°Muu¡­?¡± Oh~! Speaking of which, the girl had just woken up! ¡°Hello! Are you awake now?¡± ¡°Uu¡­? Who¡­are¡­?¡± First off, she got Rei to slice off the rope on her hands and legs and helped her sit up. Alright, the first agenda in human conversation, the introduction! ¡°I¡¯m Diana! Nice to meet you! How about you? What¡¯s your name?¡± ¡°I¡¯m¡­Anna.¡± Now that she thought about it¡­huh¡­wait, this girl was also speaking in English!? ¡­Huh? Why did she think that? That¡¯s normal. After all, English is one of this world¡¯s main languages, right? ¡°Okay, good!......uh, so, where did you come from?¡± When Anna heard that, her expression quickly darkened, and her eyes were cast down. If she could take a guess¡­ ¡°I¡­My village was burned down¡­and I was kidnapped¡­and¡­and¡­¡± Guessed it. It was the clich¨¦ ¡®Oh no, my village was burned down, and my people were killed. I managed to live, but I got taken away by bandits!¡¯ situation. But, still, hearing that story out for real, it just pulls her heart strings to hear it. Since she didn¡¯t know what to do(and she¡¯s a terrible speaker), she could only silently wait as she cried her tears out, as the memories of that fateful day, where everything she had was taken away from her came back to haunt her. After a while, her tears finally dried out. ¡°I¡¯m¡­I¡¯m fine¡­¡± ¡®No you¡¯re not.¡¯ Now that all down and calm, here comes the next question, ¡°So¡­uh, what¡­do you want to do now?¡± ¡°What¡­I want, to do¡­?...I, I don¡¯t know.¡± Well, she did just got kidnapped by a group of bandits who burned down her village and killer her parents, got dragged all the way here, and woke up to see a certain slime queen greet her, so the ¡®what to do¡¯ part of her bucket list was still unfinished. ¡°¡­Eat?¡± ¡°Huh? Who was thaaAAAA!! A-A-A g-ghoul!?¡± For some reason, as she turned around to face Rei, noticing the pale skin, the fanged teeth, and the small claws on her fingers, she freaked out and immediately backed away. Of course, that¡¯s completely normal, since normal human knowledge was to completely back away and run the opposite way from a ghoul, because their bloodthirsty killing machines, that ate up anything in their way. And¡­well, they¡¯re not wrong really. But Rei¡¯s different! ¡°Oh, Rei? Don¡¯t worry! She won¡¯t eat you!......Right, Rei?¡± ¡°¡­¡­Promise.¡± Was what she said, but that seems fairly unconvincing, yeah? She¡¯s got her two eyes locked on her, just in case she makes any suspicious advances. ¡°O-Okay¡­¡± Well, even if that was the case, Anna¡¯s still freaked the hell out, since it¡¯s not everyday you would just stumble upon a ghoul. All that aside, since Anna¡¯s still unsure about what to do herself, then-! ¡°Hey~, why don¡¯t you travel with us for a while? It¡¯ll be fun!¡± ¡°T-Travel¡­with you?¡± Having been born in a small village, raised in a small village, and worked in said small village, she was quite unsure as to how to travel. That, and her strength and stats were all pretty low. Heck, she hasn¡¯t even gotten her first class advancement yet! That sucks, yes, that¡¯s obvious. But that also meant that she could experience the full satisfaction of gaining experience, levelling up, gaining skills, advancing classes, and other RPG-related fun stuff they could have! ¡°B-But, I¡¯m¡­¡± But of course, not everyone was like Diana and her gang, so her mental strength to stand her own ground was quite shaky. Ha! Got what I meant!? Ground, shaky!? Since, ya know-!...haha¡­ha¡­ ¡­¡­Anyways, if she joined up with their group of powerhouses, she would just end up as extra useless baggage that can do nothing to match up against them. But who cares about that stuff anyways~? Travelling the world was supposed to be fun, no matter who or what walks and laughs as you journey around! That¡¯s just the art of adventure! ¡°Nah, it¡¯s fine! Look, you¡¯re fine with this too, right Rei, Crystal?¡± ¡°¡­Sure.¡± ¡°As long as she doesn¡¯t slow us down, I¡¯m fine with it.¡± And there ya go! With those two¡¯s acceptance, Anna will now be travelling with them, for some time at least. When she finally can hold her own and settle down, then that¡¯s probably when they¡¯ll leave her. But, who knows what the future has lying in wait for them? As of now, Diana¡¯s main goal in life was to level up, gain more skills and travel the world in search of dungeons, treasure, and the many wonders this magical world had in store. Well, she¡¯ll need to make sure not to mess up(and nearly gets everyone killed) the next time she goes into the dungeon. Rei was just tagging along with Diana to have a taste at the exquisite array of food this world had to offer. That, and also waiting for Diana to finally start levelling up her [Cooking] skill and cook her some delicious cuisines. And Crystal¡¯s in the gang in search for some cool and awesome powers to gawk at!......Yeah, that¡¯s it really. ¡°P-Please take care of me!¡± ¡°Will do!¡± Alright! All of that¡¯s done and dusted! Now, ¡°Everyone, let¡¯s sleep!¡± Diana declared with a fiery spirit, her fist raised into the air! ¡°¡­¡­?¡± ¡°¡­¡­Huh?¡± ¡°S¡­Sleep?¡± Well, though she did say so with a strong and burning spirit, it was still quite underwhelming to suddenly be told to sleep, wasn¡¯t it? And of course, the other three were just blankly looking at her. ¡°Well, let¡¯s rest, right? Might as well wait for daytime until we travel again, you know?¡± ¡°¡­Just, wake?¡± ¡°Look, Anna¡¯s all tired and ragged! And, besides! We don¡¯t even know where to head next, so when we¡¯re sleeping, I¡¯ll send some of my slimy scouts to look around!¡± ¡°Oi, we just woke up didn-¡° ¡°Okay.¡± ¡°T-Thanks, M-Miss Diana.¡± ¡°¡­Don¡¯t just-! Oi, she¡¯s asleep already?¡± And, in mere seconds, Rei lied down and slid back to her sleep, which was quite shocking, since they did just wake up, like, 30 minutes ago. Anna also tried to go to sleep, using that black cloak she was lying under as a nice warm blanket against the cold night breeze, but, well, she did just get kidnapped by bandits, and then saved, so many things were going on her mind right now. Crystal was the only one reluctant to sleep, since her energy levels were still top-notch. Being the slight battle-lover she is, she decided to go around this grassy plain and fight some monsters, hopefully. Fearing she might be a Zoro and get lost, she created a small Dogoo to sit on her shoulders to help her find her way back here. Diana, as she explained, created several different dogoos, all with the same command to go scout around to see if there are any settlements in the distance. That, and try to kill and digest every monster they see and come back to her the next morning. And so, with all her dogoos marching off with a mission, she yawned and lied down next to Rei and slept. Oh, and she also ended up hugging Rei in her sleep. S-She was asleep, okay? [35] Annas Training! ¡°Hey, hey, when are we gonna start the hunt? I¡¯m so bored¡­¡± It was a nice pleasant morning, and as everyone would do in a pleasant morning, the people were having a nice time, walking and chatting and so forth. The same also applied to the people of [Zestra], a pretty large trading town. Walking through the streets were people of many kinds and ages, all having fun living their daily lives. Children, housewives, tired out men who worked their lives off for the town, and that one pesky guy who keeps on bumping to people all the time. The medieval-style wooden buildings filled the town, each built with their own purposes and occupied by many different people. An occasional tree or two could be seen planted in front of the buildings, and maybe some flowers inside a pot if they¡¯re feeling in the mood. Overall, this was quite a humble little trading town. But among the casual people, a pair of two men could be seen, hiding in the shadows of the alleyways. ¡°Just wait a second¡­Haven¡¯t spotted any good ones yet.¡± With cloaks over their heads, knives sheathed on their waist, and their figures hidden in the shadows, it was pretty obvious that these two weren¡¯t the lawful types. But then, ¡°Oho~, I just saw one. Come on brother, follow me.¡± Just as one of them turned around, he saw it. A beautiful young woman, dressed in casual adventuring outfit, holding a bag of what seems to be a group of fruits in her hands. It was their perfect target. ¡°Comin~¡± If you hadn¡¯t guessed it by now(how haven¡¯t you), these two were thieves, and they had a disturbing habit of always going for unsuspecting women. Merging into the crowd, the two brothers followed the woman, their figures kept low and their knives readied. And-, oh~, and to make it even better, the woman looked around confused for a moment, before she diverged from the crowd and went into the alleyway. With wicked smiles on their faces, the two thieves too broke away from the crowd and followed her into the dark alleyway, their minds already going wild on the odd fantasies they were having. Like catching her off-guard, threatening to kill her, bringing her back to their base to break her, until she finally begs from release, in which they-¡­okay, that¡¯s enough. ¡°Hrmm¡­Which way was it again?¡± ¡®Perfect~, she¡¯s even lost! Aha! Lady luck¡¯s on our side today!¡¯ Their disgusting grins only deepened as he watched the woman look at the two ways she could go, before she took a hopeful right turn, and of course, the two followed after her, and- ¡°¡°¡­Eh?¡±¡± In front of them-, no, all around them, was darkness, pure, unrefined darkness. One which not even the specks of sunlight could pierce through, where only the occasional twinkling of the stars bestowed upon them the much needed light. ¡­Or that¡¯s what they thought at least, until they realised that those twinkling stars, were actually the gleam of the countless [Phantom Blades] surrounding them! ¡°[Phantom Iron Maiden].¡± *PUCHI!!* And in a single stroke, all the blades moved, and sliced the two thieves into pieces, leaving behind only specks of meat, and a large bloody mess. Sadly, while they were doing pretty good at tailing unsuspecting women, this certain ¡®woman¡¯ wasn¡¯t going to take it as lightly as those helpless maidens! ¡°Hah¡­Humans can be so disgusting sometimes¡­Now, where did Diana say we meet up at?¡± Going back a bit, after Diana and co woke up to a new morning, she retrieved the information her scout dogoos had gathered for her, and from what they¡¯ve seen, there was a small trading town North from where they were at. So, being the curious girl she was, Diana led her crew as they walked towards civilisation! Some time later, as she expected, there it was, the small trading town of [Zestra]! She was about to just instantly run there, but then immediately realised(with the help of Anna¡¯s concerned shout), that bringing Rei, a ghoul that liked the taste of human flesh, into a town crowded by humans, chaos will definitely ensue. Rei herself didn¡¯t mind being left out, so she stayed behind. But Diana did give her a small dogoo as a tracker. In case either of them needed some help, the small dogoo will spring to life and charge towards where Diana currently is. But enough backstory, for the current situation, Diana was still registering herself and her friends(except Rei) at the adventurer¡¯s guild, Anna was with her, Crystal was out exploring, and since the three of them hadn¡¯t had breakfast yet, so Crystal used the money Diana got from selling some monsters they killed on the way to buy some fruits. However, Crystal ended up pulling a Zoro and got lost! And this time, she didn¡¯t have a small slime that could help her! She did finally get back to the adventurer¡¯s guild, but she was an hour late, their guild cards were already done around half an hour ago, and Diana was slightly angry at her for being late. But whether that anger was genuine or just her being bubbly, she would never know. Anyways, after they sat down and had their fruity fill for the day, Diana handed over Anna¡¯s and Crystal¡¯s respective guild cards! In this world, the profession of being an adventurer was quite profitable, brought by a lot of fame, was quite dangerous, but most importantly, brought absolute fun as they travelled this wonderful world! As for the way it worked, simply put, the colour of the card¡¯s border determines how high your rank is. As for the rankings, they went according to the colour spectrum, starting from red, and going up all the way until violet. From what she¡¯s also heard, there seems to also be two more colours that were unique to certain people. There was, black, which was for the adventurers who were so high-up in comparison to the others, and gold, which was for royalty. ¡°Anyways~, Crystal! Is there anything interesting here?¡± ¡°Hmm¡­Not really. I mean, there¡¯s a weapon shop, but it didn¡¯t sell anything worth the value, and a trading guild, but I don¡¯t feel like going there.¡± ¡°Yeah, me neither~¡± Well, that¡¯s a bummer. This was the first group of civilisation, and there¡¯s nothing interesting to see or visit? She was extremely disappointed, but at the same time-! ¡°Well, we can just hunt some stuff outside, right~¡± ¡°A-Are you sure, Miss Diana¡­?¡± They could use this boredom to fuel some battles against the monsters! Which was great, both as a way to have some god fun, and also to start Anna¡¯s training to become a capable fighter! ¡°It¡¯ll be fine! And besides, me and Crystal will be there to help out to!¡± ¡°B-But¡­¡± ¡°Don¡¯t be a pussy. If you can¡¯t fight, then don¡¯t bother trying to live.¡± ¡°H-Hii!!¡± Well¡­Crystal tried to¡­¡¯encourage¡¯ her, but that only ended up scaring her even more. And-, oh, she wasn¡¯t sure why, but Crystal¡¯s attitude towards Anna seems to be rather¡­hostile, especially when their having a chat together. ¡­Wait, could Crystal ALSO be a yandere, while also being a tsundere!? Oh...God...Unauthorized usage: this tale is on Amazon without the author''s consent. Report any sightings. But, whether Anna was ready for it or not, this training needs to be done. So, after eating up the last apple in the bag, they got up and made their way out of the town, met up with the silently bored Rei, and walked into a nearby monster forest. So! Here¡¯s how the party composition works: Anna will stand as the leader of the party¡­is what Diana wanted to do, but Anna was quite persistent on not being at the front lines, since she didn¡¯t wanna die! In the end, Rei became the party leader, and Anna will attack the monsters from behind her with her bow and arrow. Rei, as I said, will be the party leader. Any by ¡®party leader¡¯, I mean being the meat shield for Anna to hide behind when things start to go south. She¡¯ll also take on the enemy¡¯s aggro when needed. She¡¯s the Naotsugu of this team, in my honest opinion. Diana and Crystal will stay at the back-lines, casually waiting and having small chats as they watched Anna fight on. If help is needed or an enemy that was too strong for her appears, then they would swoop in and take ¡®em out! And¡­it worked? I guess? If your sense of success was being chased around by a 2 ft boar while bawling your eyes out and occasionally shooting arrows at it while your friends are watching you from the shadows, then yes, Anna definitely succeeded in that sense. Oh, and that fight against the boar took 1 hour of her running around, just for context. Of course, due to the loud sounds they were making, many monsters of the forest came in to try and attack them. But with the unseen help of the big trio, the small fries were easily dealt with and disposed of. ¡®Disposed¡¯, as in corroded away by Diana¡¯s slime of course. ¡°Nice job~! Now, there¡¯s a large wolf hiding behind that tree. Take it out, okay~¡± Diana said as casually as ever as she pointed at the tree behind her, before she quickly leapt off into the shadows, soon followed by her two close friends, leaving poor Anna alone, with the wolf. ¡°W-Wait a mo-, m-miss Diana!? Where did you gooaaAAHH!? G-GET AWAY!!¡± ¡­¡­¡­¡­¡­¡­¡­ A full-on hour later, ¡°Hah¡­hah¡­hic¡­M¡­Miss Diana is c-cruel¡­¡± ¡°¡­Cry?¡± ¡°Oi, Diana, you made her cry again.¡± Well¡­She did live from that sudden encounter with that wolf, and she was now a level 5 peasant, meaning that she could advance classes, but¡­ ¡®Eh? But that¡¯s how I train noobs at MMO¡¯s though¡­¡¯ That¡¯s not how it works in this world, you dumbass. ¡°Who¡¯s a dumbass?¡± ¡°M-Miss¡­Diana¡­?¡± Wierdo. That sudden call out into thin air caused Anna to become even more scared now. No, she¡¯s probably scarred for life because of that, you monster. ¡°¡­Ahem, but, you did it, right~? Then it¡¯s all fine! Because no matter what happens, we¡¯ll always be there for you!¡± ¡°Miss Diana¡­T-Thank you!!¡± Anna bowed deeply with respect as she said that, which did spook her a bit, but, well, she¡¯s back to her normal self now, so her encouragement worked nonetheless, yeah? Okay~, enough chit chats, the sun¡¯s at the peak of the day, and their stomachs were running on dry gas now(especially Rei), so some lunch shall be served next! This time, Diana actually came prepared to cooking, had a small knife she used to cut the meat, and even had ¡®some¡¯ seasonings, which was some salt and pepper, but hey! It¡¯s something! Cutting the boar into several different parts, as usual, she diced the boar meat and placed them on some wooden skewers she bought while waiting for Crystal. Lighting a quick fire with this thing we call ¡®friction¡¯, she poked some holes into the meat chunks, seasoned it with some salt and pepper, and then roasted them over the sizzling fire. Several minutes later, the cooking was done, and lunch time finally began! ¡°So~, how¡¯s it this time?¡± ¡°¡­Better.¡± ¡°Yosh! First step is over!¡± And of course, Rei ended up being the first taste tester and the judge. After all, one of the main reasons as to why Rei was following her in the first place was to have her cook some dishes for her, so her interest in staying with her is at ¡®steak¡¯! Get it? Cause it¡¯s supposed to be ¡®stake¡¯ but I changed it to ¡®steak¡¯ and all¡­how unfunny I am Forgive me for that pun ¡­Moving on, further to Anna¡¯s dismay, the training continued on as usual, with Diana pointing out where the enemy is at, and then leaving her behind on her own to watch with Crystal and Rei. Oh right~, wasn¡¯t Rei supposed to be the ¡®team leader¡¯¡­?...Meh, it¡¯ll be fine. Anna can do it on her own. After all, she¡¯s a level 1 [Novice Archer] now! Using a bow was now her thing! By the end of the day, Anna¡¯s [Novice Archer] class reached up to level 6, her [Archery] skill was now at level 3, and her entire existence was completely tired out. By the time she finished, she fell unconscious actually, so Diana had to carry her back to their camp. And also, since they were too lazy to sell the monster parts now, she just had Rei pull them using a slimy rope, created by Diana, that was attached to the many monster corpses Anna had piled up. For dinner, they had a quick roasted wolf skewer(again), and that¡¯s pretty much it. With all that done, today was officially over! For Anna anyways. Rei was busy eating a ¡®midnight snack¡¯, while Crystal and Diana was lying atop the grass as they watched the starry sky, to, deepen their bond a bit. After all, Diana was from another world, so the simple things people here took from granted looked amazing to her. Same goes for Crystal too. Since she¡¯s been cooped up in her dungeon the entire time of her life, each event that went on was a specialty in her book. Or, well, that¡¯s what they were doing at the start. Their conversation devolved from a thoughtful talk about life, to Diana eagerly listening to Crystal as she rambled on about the many types of magic she¡¯s known, and mastered. Yes! That¡¯s right, she can actually use other types of magic. I know! Mind blown am I right? As for the reason why she doesn¡¯t use them, she simply explained with a ¡®My [Phantom Magic] is the strongest.¡¯ And left it at that. It made sense, but it¡¯d be cool of her to show some of her other magic in battle too. All in all, she had a good fun talk with Crystal, before Crystal decided to finally sleep. Which means¡­Testing time! As you might remember, Diana had just gained some major skill points, and now she¡¯s sitting on a good 36 points to spend. This time around, one special skill costs 30 skill points, which means~, that she could unlock another skill now! [Slime Cloning] Costs 30 Skill Points to unlock It¡¯s in the name. It allows the user to create a clone of themselves. The clone can perform anything the caster could do normally, including casting magic, but the power output is lowered as more clones are created. It¡¯s kinda the Shadow Clone Jutsu from Naruto, but instead of Chakra, it uses mana. The mana cost depends on the level. [Slime: Hardening!] Costs 30 Skill Points to unlock This skill allows the user to apply increased toughness and durability to their slime. At first, the effect is very minor, but the effect increases as the skill grows. The toughness of the slime depends on the user¡¯s magic. This effect obviously breaks when it comes in contact with magic, so don¡¯t go blocking any magic spells with this. [Slime: Scorching!] Costs 30 Skill Points to unlock Just like the name, this allows the user to apply heat to the user¡¯s slime. Despite its name, this does not make the user¡¯s slime burn by any means, but adds a searing heat into it that can be felt on contact. The power of the effect increases as the skill levels. It¡¯s a bit boring, but it¡¯s effective, so that¡¯s nice. For those who¡¯ve forgotten, these three were the choices she could pick. [Slime: Corrosive!] was also a special skill from this set too, but she already unlocked that ages ago. Now, reviewing each of these skills, [Slime: Scorching!] might be good, but her corrosion was already far from enough. [Slime: Hardening!] sounds good on paper, but she¡¯s immune to physical attacks, so why was this here anyways!? So, all that boils down to her last choice, [Slime Cloning]. And obviously, she picked this one, since, who doesn¡¯t want to be able to create a clone of themselves!? That¡¯s awesome! [[Slime Cloning] has been acquired] Alright! Time to test it out then! ¡°[Slime Cloning]-, guha!? Oof, that uses a lot of mana¡­¡± On her command, a puddle of slime rose from the ground and shaped itself into an exact copy of herself. Just like her [Slime Army], this clone of hers worked under her command, and even had her own thoughts. The only difference being that this clone of her was in human form. She could switch between slime and human form of course, but she¡¯ll stick to human form for now. Well, she¡¯s tired now, and her MP¡¯s running low thanks to this skill, so with a command for her clone to ¡®Have some grinding fun¡¯, she sent her clone away and allowed herself to slide into the world of dreams. ¡­¡­¡­¡­¡­¡­¡­ The next day quickly arrives on set. Well, for Diana, it arrived much faster than the others though. Heck, when she awoke, the sun wasn¡¯t even rising yet! The reason for that, being the fact that her clone, the one she created yesterday for testing purposes, was now back! And with many many spoils to hand over too! Since anything her slime, or her clone gathered will be given to her once they merge back with her, any Exp gained from the slime¡¯s battles will all be given to her. So, after she stripped naked, she walked up to her clone and merged together with her, receiving a lot of knowledge and memories from her night battles, but more importantly, this hue influx of Exp for her [Slime Queen]! [Congratulations! Slime Queen has levelled up to Level 3! Your stats have improved] [Congratulations! Slime Queen has levelled up to Level 4! Your stats have improved] [Congratulations! Slime Queen has levelled up to Level 5! Your stats have improved] [Congratulations! Slime Queen has levelled up to Level 6! Your stats have improved] [Congratulations! Slime Queen has levelled up to Level 7! Your stats have improved] [Congratulations! Slime Queen has levelled up to Level 8! Your stats have improved] Woohoo~! Now talk about a huge profit! And this was when she was asleep too! Now, for the moment of truth! Name: Diana Race: Slime Queen Lv 8 Age: 17 Class: Slime Virtuoso Lv 13/25 Exp: 2750/3300 HP: 215/215 MP: 142/142 SP: 146/146 [Strength]: 77 [Tenacity]: 71 [Agility]: 74 [Intelligence]: 80 [Dexterity]: 76 [Mentality]: 79 [Endurance]: 74 [Wisdom]: 71 [Longevity]: 47 [Skill Points]: 16 {Skills}: [Slimic Sublimation: Lv 1/25], [Slime Magic Lv 6/10], [Assassination Lv 2/10], [Alleviation Lv 1/5], [Cooking Lv 2/10], [Internal Mana Manipulation Lv 2/10], [Arcane Bubble Magic Lv 1/25], [Slime Mend Lv 2/10], [Slime Army Lv 3/10], [Danger Perception Lv 2/10], [Beast Taming Lv 1/10], [Polearm Mastery Lv 3/10], [Slime: Corrosive! Lv 4/10], [Slime Cloning Lv 1/10] {Magic}: [Slime Magic Set], [Bubble Magic Set] {Titles}: [Slime Queen], [Conqueror of Slimes], [Soul Conqueror], [Dungeon Crawler] Yep. That¡¯s¡­That¡¯s awesome, alright¡­Man, just, reading the huge boosts to her stat numbers was just, awesome. No other words capable of describing this. Phew~¡­Anyways, today¡¯s plan was to go back to the trading town, sell some of the monster parts they¡¯ve gathered, get some money, buy some equipment(cooking utensils in Diana¡¯s case), and go back to the forest to hunt and power level Anna up! But, that can wait for a bit. For now, she¡¯ll enjoy the beautiful view of the sun, slowly rising out of the horizon. Ah~, a beautiful new dawn, has arrived. [36.1] Monster Troubles As they had planned, today, Diana, Anna, and Crystal will be heading back to the trading town of [Zestra] to sell the monster parts they¡¯ve gathered from Anna¡¯s training yesterday. But, well¡­Aside from the receptionists¡¯ shocked faces from the abundance of monster parts we gathered from just one trip(and also from one person battling), it seems like some trouble has popped up too. ¡°Hey, you girls, do you know anything about the murder of two bandits yesterday?¡± As Diana was busy trying her hardest to organise the different money types into different pouches, an old man with a beautiful long beard came up to her and asked so. And of course, ¡°Huh? No, I haven¡¯t heard anything. Is there something wrong with that?¡± She answered so. She asked Anna, and she too didn¡¯t know anything, which was obvious, since she was with her all day long yesterday! And then, she also asked Crystal, and while she did say no¡­She was fidgeting a bit and she could spot some sweat trailing down her neck, so she probably knows something. And by ¡®know something¡¯, she could somewhat guess that she¡¯s the culprit. ¡°Being honest, I don¡¯t like bandits roaming this town either, but we¡¯ve got a strict rule to not commit murder inside the town, and breaking that law costs money.¡± ¡°I see¡­We should be careful then, right, Crystal?¡± ¡°Y-Yeah.¡± Thankfully, the old man didn¡¯t seem to suspect Crystal about it, so he let it go and turned around with a soft smile. ¡°Well, sorry for taking your time. Good luck out there, girls.¡± ¡°Thank you~¡± And with that, he¡¯s off back into the staff¡¯s room. The sun¡¯s getting quite high in the sky now, so some breakfast would be nice. This time however, Diana and Anna will be the one going to buy the food, while Crystal sat back at a nearby bench. ¡°Stay here and don¡¯t cause any trouble, okay?¡± ¡°Y-Yes ma¡¯am.¡± Hah¡­Seriously, her anxiety over it was so obvious, that she¡¯s rather surprised that the old man hasn¡¯t caught on to it yet¡­Or, maybe, he did catch on, but let them free? She¡¯ll put all her hopes on it being the former. Anyways, some more fruits as today¡¯s breakfast should be nice, and maybe even some as refreshment later in the day too! The fruits aren¡¯t so cheap, but Anna sure gathered them enough money to sustain themselves for a while! Oh! Talking about money, the money system in this world works around coins, and different types of coins(just like in many ¡®other world¡¯ light novels she¡¯s read). It started from copper, being the lowest, silver, then gold, before platinum(also known as ¡®white gold¡¯ apparently). Each coin is worth 10 coins of the lower tier, except for copper of course. Today¡¯s market list will be some apples, pears, and oranges. ¡®If she wanted to buy around 5 of each, then¡­wait *much mental calculations happening*¡­if a fruit¡¯s about 8 copper each, then¡­around 120 copper coins? Then that¡¯s about¡­11-, no, 12 silver coins? Yeah, 12.¡¯ Phew, all that mental arithmetic was making her tired. She¡¯s rather surprised she hasn¡¯t received an [Arithmetic] skill or something from all that. Or, does knowledge-based skills not count as [Skills] per se? That¡¯s something she should keep in mind. Either ways, 12 silver coins goes down the register, and a bag of 15 fruits received. Now, time to head back to where Crystal was! ¡°U-Umm¡­Where did Miss Crystal go?¡± ¡­Or that¡¯s supposed to be the plan, but¡­Once they returned back to her latest known location, she wasn¡¯t there anymore. Alright! Switch of plans! Time to look for Crystal! First up, they went to the adventurer¡¯s guild and asked if they knew where their friend was, and lo and behold, she was being interrogated behind the scenes!...Wait, what? Okay, plan to look for Crystal, finished! Luckily, it wasn¡¯t about the murder she committed on those two bandits, but she seems to have gotten angry on someone who provoked her, and nearly sent him to his death bed. He¡¯s still alive(somehow), so she didn¡¯t get pressured by the fine, but, just¡­she¡¯s a bit of a dunce sometimes, isn¡¯t she? ¡®So she¡¯s a battle-junkie, a magic nerd, a tsundere(confirmed), a ¡®yandere?¡¯, and a dunce, huh¡­¡¯ Huh, it somewhat reminds her of Team RWBY, in a loose sense. That aside, she managed to come out fine, but she did receive a warning from the guild master, so she should¡¯ve learnt her lesson¡­hopefully. With that finished, the three returned back to the camp(the one they stole from the bandits), had a nice fruity breakfast before they went back to the forest to supervise as Anna battled the monsters that lived inside. This time, now that she¡¯s improved her skill with the bow, the monsters were easily dealt with, most of the time. Actually, as more time went by, more and more monsters that were much stronger showed up, forcing Rei to intervene. Which was, weird, since the receptionist back at the guild said that this forest was relatively easy. The deeper you go in, the tougher the monsters are, but last time they were here, the monsters were definitely not this strong, so what happened? Being suspicious of it, after she created a small dogoo and left it in Crystal¡¯s care, she moved away from her party and went deeper into the forest. She didn¡¯t know what¡¯s happening deeper inside, but those tougher monsters looked like they were running away in a hurry, as if they were just being chased. Which could mean that either: A strong monster has appeared, or a strong person has appeared. Whatever the case, it¡¯s exciting, and she wanted to get a look herself! And, yep! As she guessed, a strong looking werewolf-like monster was standing there, just idly looking up to the sky, contemplating his life choices or something.Unauthorized duplication: this narrative has been taken without consent. Report sightings. He stood over 2 meters tall, his body and limbs were huge, his purple coloured fur ruffled with magical energy, and those teeth in his jaws, man~. Getting bit by those teeth would probably kill a human in one go! Well, she should be fine, since any physical attacks will just faze through her. Then again¡­it looks like its emanating some intense MP there, so she would probably still take damage even from getting hit by its large arm. *Awwoooo* Ara, and it seems like it just noticed her too, watching idly from the treetops. As a greeting, the wolf sent several large wind blades through the air, which she easily avoided by jumping down from the tree. She returned the favour by shooting a quick volley of explosive bubbles at it. Alright then! [Battle Begin]! First up, she created a small [Corrosive Slime Wave] and trapped it inside, suffocating it and corroding it. And while she¡¯s at it, she also forced some of the corrosive slime down its throat to corrode its voice away, just in case no more monsters show up. The slime trap didn¡¯t last long though, since it quickly blew up and scattered the slime prison around using an explosion of mana, similar to what that minotaur did back in the catacombs. *AWWOOOOOO!!!!!* Oya? Even after getting its throat burnt and corroded by her slime, it¡¯s still able to make quite a loud howl, eh? Heck, that howl was actually powerful enough to blow back several trees around it, which created a nice free space for their battle arena. Or, that¡¯s what it intended at least, but when it looked down to see its opponent, she wasn¡¯t even there anymore. All that remained of her was a pile of adventuring clothing, several pouches of coins, and a leather bag of cooking ingredients and utensils. Where did she go, he wondered as it walked over to her pile of dirty clothing, not noticing that Diana was standing behind him, a [Slime Cannon] readily prepared in her hands. Without his notice, and her added [Assassination] damage bonus, she fired down at him, and smashed the werewolf down into the ground! *Bam!* It went as small chunks of dirt and rock was flung into the air! Of course, the werewolf wouldn¡¯t die just from that, so she added another [Slime Cannon] onto him, merged the slime together and trapped the werewolf inside the slime, again. And of course, she also added the corrosive touch and forced her slime into the werewolf¡¯s body through every orifices, including his anus. *A-AWWOO!?* Is the sound she guessed he was making right now as slime was being forced up his ass, but she couldn¡¯t tell, since some more slime was being forced into its open mouth too. Uwah~, this somehow feels wrong¡­but, hey! It¡¯s all in the name of victory! Some time later, some more werewolves appeared on the scene. This time, they weren¡¯t as big as the purple one, which was most likely their leader or whatnot, and their fur was grey coloured instead. Well, not like it mattered, since the purple werewolf finally gave in and died from her slimy assaults! All she hoped was that the werewolf was a male, because if that was female, then¡­Muu, it¡¯s not something she wanted to picture. I¡¯d have to put an R-18 warning on this chapter then Anyways, realising their leader was dead(and corroding away), the werewolves were absolutely terrified and was now trying to run away, but she¡¯s not letting them get away so easily. After all, she¡¯s quite hungry, and lunch was still several hours away. ¡°Ehehe~, time for some lunch~¡± **A-AWWOOO!?!?!?** ¡­¡­¡­¡­¡­¡­¡­ After some running, Rei, together with Anna and Crystal finally made it to where they heard that loud howl, and there, standing in the middle of an empty land, Diana could be seen cheerfully humming along as she was cooking something. ¡°Oi, Diana, we¡¯re he-¡­Why is your mouth all bloody?¡± ¡°Eh~? Really? I didn¡¯t notice at all~!¡± Once she turned around, everyone got a good look at Diana, whose mouth was full of blood, fresh blood mind you. From her expression, it didn¡¯t seem like that was her own blood(she didn¡¯t even have blood), but what the hell did she do? ¡®I swear, is she getting ditzier or something?¡¯ No, seriously. After she revived from the dead and opened herself up, her personality seems to be getting ditzier and more cutesy as time goes by. Not that it¡¯s a bad thing, since Crystal quite enjoyed seeing her like that, even if she couldn¡¯t admit that. But, all that aside, Diana¡¯s trying out a ¡®new¡¯ cooking technique today. And said technique is: Frying. Heck, she even had a mini-sized frying pan she bought at a local utensil store she found in the town. Of course, Diana¡¯s no cook. The only thing she knew about cooking was from that occasional scene in anime about cooking, and the added trivia from Food Wars, so she¡¯s not going on much. But, she at least knew how to fry stuff. It¡¯s simple! Just get some oil, get some meat, pour said oil on pan, heat said pan, place said meat at said pan, then wait as said meat sits and gets cooked. And I said way too many ¡®said¡¯ there. Or, that¡¯s what she assumed at least. From the looks of it, her werewolf meat(yeah, ¡®werewolf¡¯ meat) was looking pretty golden for a simple meat chunk kneaded with some salt and pepper. And so, with the fried werewolf meat chunks placed in four different wooden bowls, the four sat down and happily ate their meal. Of course, nobody knew that it was ¡®werewolf¡¯ meat, but they didn¡¯t need to know that, right? ¡­¡­¡­¡­¡­¡­¡­ Meanwhile, back at a certain snowy mountain, where the snow never stops and the shriek of a terrified young boy is lost in the storm. Standing alone at that snowy mountain, a single wooden cottage could be seen, with a warm fire burning inside and a mug of warm coffee idly sitting at the wooden table. And there by the wall, a boy could be seen, happily sleeping away. But then, something suddenly snapped him out of his beauty sleep. *BANG!* ¡°Guhaa! Haa¡­It¡¯s warm¡­¡± Barging in with no manners whatsoever, Ilgua came in, with a large mound of snow piled up on his short green hair, and many scratches and wounds seen all over his frail body. But most importantly! In his shaking frozen hands, there were 3 blue shining feathers, the quest item that his master had asked him to collect for something he didn¡¯t mention. And now, he¡¯s supposed to get to his master and wake him up, but¡­his body just felt way too heavy, and the wounds he sustained was not light. Before he knew it, his eyes slowly closed, and his consciousness flew away, not realising that his master had just woken up then and there. ¡°Haa~, I heard something loud¡­but it¡¯s just this kid¡­¡± Seeing Ilgua lying there at his death bed, he got up and brought him over to the bed- ¡­Or that¡¯s what he was supposed to do anyways, but he¡¯s just so tired you know~? His body was feeling a bit sore from all the sleeping he¡¯s done in the past centuries, so moving was a no go yeah~ But¡­well, if Ilgua died just then, that¡¯ll suck for several reasons, so he decided to use some of his magic to forcefully close the door and float Ilgua¡¯s unconscious body all the way to his bed using the power of his mind. Of course, he¡¯s also floating in the air now, since he didn¡¯t really want to sleep together with Ilgua and get himself all bloody now, would he? Ah, but on a second though, the sheet was all bloodied now¡­ Anyways, for now, he¡¯s keeping his blood from flowing out, and slowly healing his open wounds. But, still¡­ ¡®He actually got the three feathers I asked him to get¡­How sturdy¡­Or stubborn maybe¡­¡¯ The Ice Phoenix, the monster that resides at the peak of this deadly snowy mountain, the majestic bird that ruled over all the other monsters as ¡®King¡¯. Well, that little birdie¡¯s nothing against him though. Despite that, Ilgua, someone who he measured had terrible physical prowess and would easily lose in a strength contest against a pig, still somehow made it through the snow, hiked all the way to the peak(Which was pretty high up from where they were), and got the feathers. He might not have killed the bird, but getting the feathers was already a commendable effort. That, or the guy somehow got lucky. That aside, he¡¯s done healing up all the wounds Ilgua had now. Muu~, but he¡¯s feeling tired again now¡­ But, being serious for a moment here, he wondered if perhaps, he should actually be serious for once. After all, another one of them had just made an appearance, and that¡¯s sure to attract some company, unwanted ones included. Those who held incredible powers, one that differed and triumphed over the rest, just like him. Even if he didn¡¯t show it face front, a creeping worry lingered at the back of his mind, reminding him of the mess he created 200 years ago. As of recent, he¡¯s been making some dodgy actions here and there, but he didn¡¯t see anything too terrible or suspicious crop up from him, but he might still be planning something. In fact, he had a suspicion that the recent ¡®World Traveller¡¯, and him, was closely related in a way. It might be wise to take a careful approach to this ¡®World Traveller¡¯, just to make sure she wasn¡¯t against them. Alright then! Once Ilgua wakes up from his near-death experience, he¡¯ll send him back out to watch over her! He¡¯ll probably complain for a bit(a lot), but he¡¯ll accept it. And while Ilgua¡¯s out there doing scout duty, he¡¯ll be sitting here, to make sure he won¡¯t do anything dangerous. And while all of this was happening in his mind, Diana was busy explaining to Rei about Cookies, American ones by the way. [36.2] More Monster Troubles Jumping forward quite a bit, the time was now night, and Diana was casually lying down on the grass and watching the stars in the sky. It¡¯s night now, so her friends were all asleep of course. The reason why she was even awake right now was because of a hunch she had in her gut. It¡¯s not much to go on, but she just had a premonition that something¡¯s going to go down, precisely at this night. Even her [Danger Perception] was ringing the bells, and when that happens, it¡¯s usually correct. Since she didn¡¯t want to bother anyone with their beauty sleeps(especially Crystal, she gets grumpy if she¡¯s suddenly awakened), so she made sure to make some distance between them too. ¡°¡­!¡± And again, her [Danger Perception] rang, this time much louder and clearer than before. Which means, that whatever¡¯s on her track, was close to her, really close. ¡°There you are.¡± Then, she heard a female voice, calling out to her from behind her. It was a cold, unfeeling voice, one that, if she could take a guess, probably had full intentions on murdering her, or at least, capturing her for some other purpose she didn¡¯t know. ¡°Ehe~¡± Turning around, she made a cute giggle as she looked at who her enemy was. And, as she guessed, it belonged to a woman, whose silver eyes stared piercingly into the depths of her soul. ¡°Tch, acting cute, despite being a monster.¡± ¡°Is something wrong with that~?¡± Muu, did this woman have a bone to pick with her or something? Or does she just hate monsters in general?...Probably both. From her reply, the woman sneered and pulled out a sword from behind her. From the looks of it, it¡¯s a normal knight¡¯s broadsword, but she couldn¡¯t be too sure. It¡¯s too dark to see, so she couldn¡¯t get a good look at who or what she was. With her sword pointed at Diana, the woman charged at her and sliced off Diana¡¯s neck, which quickly reconnected itself. Her regen speed seems to have caught the woman by surprise, but she quickly recovered to try and attack again! ¡®Can¡¯t this woman use magic?¡¯ Was the single question floating in her mind as she was getting slashed and stabbed in the head, multiple times by the woman, before all the wounds disappeared, leaving a perfectly clean Diana. ¡°W-What the-!?¡± ¡°Careful!¡± Well, she did say ¡®careful¡¯, but the woman didn¡¯t listen, and ended up getting her entire chest area covered in slime, corrosive ones too. Listening closely, Diana could hear the sounds of metal pieces corroding away and falling to the ground, which meant that she was also wearing some kind of armour. Oh, and there was also some kind of emblem there too, but it was slightly too dark to see it clearly, and it¡¯s getting corroded away anyways. Not that the armour did anything, because once the armour faded away, the woman¡¯s skin started sizzling as her corrosion went to work. Worried that she might scream and wake everyone else up, she used some neutral slime and plastered it over her mouth. After the ¡®battle¡¯ ended, the woman was left stuck in the slime, her mouth covered, and her skin burnt and damaged. She could even see some of her insides if she squinted enough, not that she minded or anything. ¡°Now~, mind to speak up?¡± ¡°¡­¡­¡± ¡°Ah! I forgot to take of the slime! Sorry~, here you go!¡± With a bit of force, she put her hands over her mouth, and ripped away the slime on her mouth. ¡°Buah!? Hah¡­hah¡­You¡­monster¡­D¡­¡± ¡°D¡­?¡± ¡°D¡­¡­DIIIEEE!!!¡± Suddenly, she broke out of her slimy prison, reached her hand down to the collar on her belt, and attempted to place the collar around her neck! Of course, as if Diana¡¯ll let that happen. Sending a swift kick to her gut, she took the collar away from the woman and put it on her neck instead. She didn¡¯t know what this collar was, but her danger sense was tingling, so she took three steps back and waited. And waited, and waited, until she finally became bored of counting how many ¡®and waiteds¡¯ has been said and walked up to the woman, who wasn¡¯t even moving an inch, except for her silver eyes which were looking around in horror. Now that she¡¯s close enough, she managed to see what the collar was like. It was a pure, silver collar, one that fit perfectly around the woman¡¯s neck. It wasn¡¯t anything special, aside from that red orb stuck at the centre. If she¡¯d take a guess, this is¡­a slave collar? Like the ones she¡¯s seen in so many fantasy light novels. So¡­uh¡­what should she do with her now? First, she¡¯ll quickly apply some mending slime onto her wounds, since those openings on her look nasty man~. No one would like to see those!...Except maybe Rei, since that girl likes human meat in general. Okay, while she¡¯s waiting for her wound to patch up¡­now what? This woman was completely docile(hopefully), and it seems like she couldn¡¯t speak. Hmm¡­ ¡°Uh¡­Speak¡­?¡± ¡°What should I speak, mistress?¡± Woah. Woah~! She actually spoke! And really politely too! Calling her ¡®Mistress¡¯ and all that! Iya~, somehow getting called that feels somewhat pleasant~ Ahem, anyways, judging that her eyes were looking even more terrified than before, she probably couldn¡¯t control her own mouth, which is great! Now, time to gather some info about why she¡¯s even here! ¡°So, why did you come here?¡± ¡°I was sent here by the king of [Albion], Grazure the Third. He tasked me with dealing with you, mistress.¡± ¡°And¡­why?¡± ¡°I did not know. He said that mistress was a monster, and any further delay would bring chaos to the kingdom. However, he asked me to capture you with this [Slave Collar] and bring you back as a war potential.¡±Stolen story; please report. Yikes. Okay, so, case and point, that king¡¯s a bastard, and he wanted her to become his slave for war. How rude! Instead of trying to capture her, he could have- ¡°¡­Diana.¡± ¡°Huh? Oh! Rei, you¡¯re awake!¡± Suddenly, from beside her, Rei appeared. She seems rather mad though¡­She didn¡¯t show it face-front, but from her eyes, they just¡­looked mad. Was it because this woman tried to capture her? Yeah, the answer¡¯s obvious, isn¡¯t it? ¡°¡­Educate, her¡­Need, docile.¡± ¡­¡­Eh? Wait, ¡®Educate her¡¯? ¡®Need Docile?¡¯? Umm¡­Diana¡¯s purely confused right now, but Rei¡¯s her friend, so she nodded and left it all up to her. With her confirmation, Rei grabbed the woman by her collar and ran into the darkness. ¡­Well, that¡¯s it for that woman then. Her danger sense wasn¡¯t ringing anymore, so all the danger¡¯s gone for now. But, still, whoever this ¡®Grazure the Third¡¯ is, he¡¯s one asshole to try and capture her. She¡¯ll share this info with her friends tomorrow. For now, the moon¡¯s high up in the night sky, so some sleep would be nice to have! ¡­¡­¡­¡­¡­¡­¡­ ¡°¡­Umm¡­Hello¡­?¡± ¡°¡­¡­¡± ¡­Well, it¡¯s morning now, and everyone¡¯s awake and all that. Rei and that woman who tried to capture her last night¡¯s also here too, but¡­ ¡®What¡¯s with those eyes¡­? They¡¯re, kinda scary~¡¯ The woman looked, relatively the same as yesterday, but her eyes, which were moving and twirling in confusion and fear last night, was now an unmoving, dull and greyed out colour instead of the usual bright silver. One question then: What kind of ¡®Education¡¯ was Rei talking about last night then!? ¡°Umm~, Rei? What did you do to her?¡± ¡°¡­¡¯Educated¡¯.¡± Even Crystal was shocked when she looked up to see this woman, here eyes all greyed and dead. Her clothing had also gone a similar treatment. Her armour was already damaged, because of her corrosive slime, but her remaining clothing was all torn and her pants was all but rags, all barely holding on together with that white panties she¡¯s wearing underneath. ¡°Oi, what kind of ¡®education¡¯ are you talking about here?¡± Crystal asked as she stared into those soulless eyes. And for some reason, she seems rather excited about it, which is¡­weird. ¡°¡­[Infect].¡± Rei replied as she lifted the corners of her mouth, showing the sharp teeth she had, which then meant that¡­ ¡°S-She¡¯s a zombie now!?¡± And there ya go. Out of the three, only Anna was surprised and terrified at the zombified woman standing before her. Crystal and Diana were stupefied, but quickly recovered. After all, it¡¯s just zombie, right? They¡¯re nothing but cannon fodder to them now! For further info, here¡¯s the description on the skill: [Infect] Lv 7/10 A typical skill normally used by zombies to turn other living creatures to their kind. Its mechanisms differ slightly for each individual, but it usually requires the user to inject their bodily fluids, usually saliva, into the target¡¯s body to slowly turn them. With enough training, this skill can be used to ¡®condition¡¯ enemies by slowly corrupting their mind. Despite now being classified as a ¡®zombie¡¯, the woman¡¯s skin wasn¡¯t rotting like normal zombies and she definitely wasn¡¯t smelling badly. Which then meant that Rei went with the latter option, and ¡®conditioned¡¯ this woman by biting her(probably). Diana still somewhat doubted that her [Infect] skill did all that, but she won¡¯t inquire further. ¡°Hey hey~, does this girl regenerate like you?¡± Crystal asked with expectant eyes. Again, Diana wasn¡¯t too sure what¡¯s on her mind right now, but she won¡¯t ask about it. ¡°¡­Yes.¡± ¡°Alright!¡± Yep, she¡¯s way too excited for this. Well, the questions can be saved for later. For now, she had some information to relay back to her friends. ¡°Oh, right! I have something to tell to everyone!¡± ¡°Huh? What is it?¡± ¡°So~, last night, I got attacked by this woman, and she said that she came from this kingdom called [Albion]. The king there, I think his name is¡­something the third, I forgot, he sent her to capture me and make me his slave.¡± And from there, she got three different opinions on what to do now. First, from Anna, since she knew well what this kingdom was, she suggested that they steer clear and away from it. From her memory, this kingdom was a mercenary kingdom, built up from the remnants of war and the people there spend their days and nights fighting. The hierarchy there is based from an individual¡¯s power, the more power the have, the higher they stand. Crystal was quite ¡®angry?¡¯ at her being attacked by them, and wanted to just take a stroll there and rain down unlimited death with her [Phantom Blades]. She did say she¡¯s ¡®angry¡¯, but she looks more excited than anything else. And Rei wanted them to go there and destroy the kingdom and eat them all, a typical answer from her. Which, now that she thought about it, isn¡¯t that basically the same as Crystal¡¯s? She¡¯s also quite angry and somewhat wanted to take the fight to them, but let¡¯s not do that yeah? War¡¯s not the answer to everything, or so she convinced herself. Anyways, that info relay done and over with, it¡¯s onwards with the usual routine! Rei stays put in this camp for now with a small dogoo to accompany her, while Diana and the rest went to the town to sell the monster parts and maybe find a new destination to head to. And after they got there and sold off all their stuff, she did! The kingdom¡¯s name was [Gazelle], which was¡­an odd name to use for a kingdom, but she¡¯s not judging. According to the receptionists, it¡¯ll take 2 weeks to the south to reach it. But hey! Even Diana could move faster than a horse now, so they should reach it faster than 2 weeks! Well, but someone would have to spend the entire time carrying Anna while running, since her speed¡¯s the slowest out of all of them. And that¡¯s exactly what they¡¯ll be doing! After they finished up Anna¡¯s training, they quickly sold off all the monster parts they got, bought some bread and other long-term foods, and went back to the camp to have some dinner and sleep. The dinner this time is chicken stock by the way! And by chicken, I mean that giant bird-like monster they encountered in the forest that Diana butchered and put into a small pot and boiled. Anyways, some nice dreams later, morning arrives, the sun waved hello, and the team finally embarks on their journey to [Gazelle]! With Crystal carrying her bag of food and cooking utensils, and Anna being carried on Rei¡¯s back, they journeyed on, full-throttle! Well, Rei still needed to slow herself down, since, one, Crystal and Diana¡¯s speed weren¡¯t as high as hers, and two, Anna fainted once because of the immense speed. Still, even with their speed lowered, they were still movin¡¯ pretty damn fast. I¡¯d say¡­as fast as a dirt bike. Or maybe slightly faster than that. If they kept the pace, which she was sure they won¡¯t, they¡¯ll reach the kingdom in about 5 or 6 days. Oh, and that woman(whose name she still didn¡¯t know) was keeping up with them, which was a pleasant surprise. She did have quite a nice build, and she was most likely a knight of some sort before this, so it made some sense. Now, onwards! ¡­¡­ Or that¡¯s what she wanted to say, but¡­ It hasn¡¯t even been 2 hours, and they¡¯re already getting side-tracked! When they were running, Rei smelled something good cooking in the distance. See, it¡¯s getting near to noon, and they haven¡¯t eaten their breakfast yet, so they¡¯re pretty hungry. After spending some time debating the choices, they decided to go and ¡®investigate¡¯. Hiding under a nearby hill, they saw two men sitting around a fire, with something being cooked over it. They were both wearing clean full-body armour, and they both had a crest on their chest that looked quite similar to the one the woman had back then. Which meant, that those two were in some way related to this woman or the kingdom of [Albion]. Well, they¡¯re conversation was innocent enough, with them talking about what kind of women they liked the best, and they didn¡¯t seem to be hostile. That is, until she heard this. ¡°Hey, I wonder if Lady Paulena is done with killing the ¡®monster¡¯ the king told us about.¡± ¡°Meh, she probably did. If that ¡®monster¡¯ is still alive, we¡¯ll just go and kill ¡®em, right?¡± ¡°You got that right.¡± Okay then, seems like these two were hostile after all. Actually, she wasn¡¯t that sure, they could be talking about something completely different here, but she couldn¡¯t do anything anyways. Because Rei had already charged in and killed them. A short scream echoed out through the grassy hills for no one else to hear, as the two men fell limp on the grass with their blood soaking into the grass. And in typical Rei fashion, she immediately tore off the armour they wore and ate them up. ¡°Ouh~¡­The meat¡¯s all bloody¡­¡± Sadly, their splash of blood did mean that some of that gooey blood made it onto the fire, which put it out, and onto the meat, which made the taste somewhat sour and salty. And their problems weren¡¯t even over! Because suddenly, a ring from her [Danger Perception] came into Diana¡¯s mind, and by reflex, she turned around, to see a young boy, probably around his 18¡¯s, with short dark blue hair and pale yellow eyes, staring fearfully at her with a sword in hand. ¡°I-I-I¡¯m I-Ilgua! C-C-Come a-and f-f-fight me, m-m-monster!!!¡± ¡°¡­Eh?¡± [37] Ilgua -10 minutes before the encounter- ¡°E-Eh!? Y-You want me to go meet the monster!? Right now!?¡± ¡°Why not¡­? We better keep an eye after her¡­¡± Yes, that is a logical explanation to send him out. But why the hell was his master sending Ilgua out to essentially fight the monster!? And just after he got stabbed and injured by an Ice Phoenix, dragged himself through the blizzard, and nearly dropped dead at the front door too!? ¡°B-But-!¡± ¡°Just go already~¡­I¡¯m sleepy¡­¡± ¡°T-Then¡­I have to go myself¡­?¡± Now that he thought about it, that monster was several continents away from where he currently was. It¡¯ll take several years for him to fully make it all the way there, and even then, that monster would have moved to a completely different location. After some thinking, he forcefully took hold of Ilgua and made him float in the air, much to his distress, before creating a portal and throwing him into it. The scream of his young disciple quickly disappeared into the closing void. ¡­¡­¡­¡­¡­¡­¡­ On the other side, quite close to where Diana and her group were, a portal suddenly opened and Ilgua fell out, hitting face-first into the grass. Rubbing his aching nose, he hid behind a nearby hill as he watched them. And then, ¡°¡­!¡± With incredible speed, Rei lunged at the two men and tore them apart, before picking them up and eating them. Diana and Crystal weren¡¯t particularly disgusted, maybe a bit repulsed, while Anna was in full terrified mode and took 7 steps back in fear. And the woman, also known as Paulena was just standing there, ¡®cause she¡¯s a zombie now. Seeing as he didn¡¯t see who or what those men were, or what they did, the first impression he got about them wasn¡¯t pretty. With his trusty iron sword in hand, he stealthily made his way towards them, making sure to silence his steps as he made his way there. But then, a shiver ran down Diana¡¯s spine, and she turned around, to see him slowly approaching. By reflex, and fear of what they would do to him, he stiffened up and took a battle-stance, speaking in a manner that almost sounded like a broken radio. ¡°I-I-I¡¯m I-Ilgua! C-C-Come a-and f-f-fight me, m-m-monster!!!¡± ¡°¡­Eh?¡± And Diana was just staring at him, with her head cutely tilted to the right in confusion. Her friends also happened to hear her and turned towards him too. ¡°H-Hii!!!¡± He was especially scared of Rei, who had blood all over her naked body and was still radiating her bloodlust from earlier. Crystal was just being careful, Anna was silently observing him, and Diana was just looking at him as if he was a lost animal. ¡°Umm~, I don¡¯t think he¡¯s dangerous.¡± But deep inside, Diana was quite excited for this. After all, this was the first male in the story that wasn¡¯t a middle-aged man or some bastard bandit! ¡°¡­Agreed.¡± ¡°That¡¯s obvious. He looks like he¡¯s about to piss his pants or something.¡± ¡°¡­True.¡± Ignoring the two¡¯s casual talk, Diana happily made her way over to Ilgua, who was currently stuck in place from fear. ¡°Hey~! Uh, Ilgua, was it? Don¡¯t worry! We come in peace!¡± She said with the friendliest tone she had, but he seems to have taken that as a taunt from the enemy and let out a soft squeal before he swung his sword, by reflex. Her [Danger Perception] told her beforehand though, so she easily moved out of the way. But, that¡¯s odd. Why would her danger sense ring just from a sword swing? Physical attacks don¡¯t do any damage to her. Unless¡­that sword has some magic inside, which then would cause some serious damage to her. ¡°Hey~! How rude! I¡¯m serious!¡± ¡°R-R-Really?¡± ¡°Yep yep!¡± Thankfully, after that near deadly attack, he seems to have calmed down considerably. She could still see some sweat trailing down his neck and he was still clearly nervous around her, but hey, it¡¯s a start! But first-! ¡°Anyways, wanna join us and eat lunch?¡± ¡°L-Lunch? A-As in, h-h-human meat!?¡± ¡°¡­Huh? No no! Just some bread!¡± ¡°B-Bread with h-human m-meat then!?¡± ¡®Muu~, does this guy like to assume before she even says anything?¡¯ As proof that she wasn¡¯t a part of the Baker Family, she took out some bread from the bag she made Crystal carry and split the bread with him. ¡°See~? No human meat, right?¡± ¡°Y-Yeah¡­T-Thanks.¡± He¡¯s still not fully convinced, so he took a quick nibble at the bread, and no human meat has been inserted! Even then, there were still some doubts lingering in the back of his mind, but the cute smile Diana had convinced him otherwise. And so, with a new temporary addition to the party, the five of them had a quick bready lunch. The bread was meant to be eaten with soup or stock, but they haven¡¯t encountered any monsters yet, so that¡¯s a no go. Taking her chance, while they were eating, Diana asked Ilgua about why he was here in the first place, and- *Cue a long explanation and gloating about the mission he was tasked with* ¡°I see¡­It must have been painful~!¡± ¡°Obviously!! I would have died if not for my master¡¯s healing!¡± In the short span of around 15 minutes of storytelling, Diana and Ilgua had gotten pretty close, with Diana intently listening in on the many experiences he has had in his life. Anyways, with his story over, it was time to extract some information! With a serious face, which was still somewhat dyed in fear, he looked her straight in the eye and asked, ¡°S-So, coming from another world, what do you want to do now?¡± ¡°Eh!? You knew that I¡¯m from another world!?¡± ¡°Hehe! It is due to my master!¡±If you discover this tale on Amazon, be aware that it has been unlawfully taken from Royal Road. Please report it. He~, his master must be amazing! She thought in her head. So, in total, that makes 5 people who knows about her otherworldly origins-, no, wait, 6 people. Because Anna was also there and listening, and her jaw just hit the ground just then. Paulena doesn¡¯t count. Cause she¡¯s dead. ¡°Hmm~, well, nothing much really! All I wanna do is explore the world, fight monsters, and all the other cool JRPG things I can do in this world!¡± ¡°J¡­RP, G? I-Is that some kind of ultimate spell!?¡± She didn¡¯t bother to correct him and simply continued on. ¡°I¡¯m also going around to look and learn new cooking recipes to cook, and other stuff I haven¡¯t thought of yet!¡± With all that said, Ilgua was pleasantly surprised. He knew that he was quite good at sensing anyone¡¯s strengths, and looking at this group of girls, the big trio definitely had some mad power levels. It¡¯s over 9000! Moving on, such a power could bring some about some huge damage if they decided to give everything up and go against the world, but thankfully, they were quite happy as they were, so there¡¯s no harm then! Now, if there¡¯s nothing to worry about, then it¡¯s time to head back to his master!......Wait- ¡°H-How am I supposed to go back!?¡± ¡°Go back? Go back where?¡± Diana did ask that, but put two and two together, then it¡¯s quite obvious that he was talking about getting back to his master. He did fling him through a portal and bring him here without any extra info on how to get back, so¡­he¡¯s pretty much stuck here now! ¡°Hmm¡­? What were you talking about¡­?¡± ¡°Huwa!? M-Master!?¡± Or not. Suddenly, a small rift opened beside them, and on the other side, the face of a young boy could be seen. He was lazily sleeping on his bed, resting his head on a pillow that looked quite comfortable. ¡°Woah~! Your master¡¯s a little kid!? That¡¯s awesome!¡± ¡°Oya~¡­You must be the monster from another world¡­right¡­?¡± ¡°Yep yep! Nice to meet you, uh¡­what¡¯s your name?¡± The boy had a moment of silence, before he answered. ¡°Just¡­call me Leo¡­¡± ¡°Leo it is then! Nice to meet you~!¡± ¡°Nice to meet you too¡­¡± They then shared a slow inter-continental handshake through the portal, which¡­feels kinda weird, but awesome at the same time. After all, she was putting her hand through the portal, and bringing it out several continents away from her current one! That¡¯s awesome! And, of course, Crystal was silently fangirling in the back, staring excitedly at the portal with eyes shining so bright it¡¯ll put the sun to shame! ¡°Alright then~¡­I¡¯m sleepy, so bye bye¡­¡± ¡°E-Eh!? W-Wait! Master! My training-!¡± Before he could say anything else, the small portal closed, leaving a small note behind that read: ¡°This is your training¡± in a badly, written manner that practically looked unreadable to anyone. Ilgua was still able to read it though. ¡°I¡­I see! As expected of my master!¡± ¡®¡­Is this guy Genos or something?¡¯ References aside, with this, there¡¯s another member temporarily added to their party! Now, they¡¯ve got a full party of five people! Either ways, after she shared her plans to go to [Gazelle] with Ilgua, they packed up everything they had, got Rei to carry Anna, and ran off towards their next destination! Oh! And Ilgua¡¯s surprisingly fast at running too! He was able to keep up with Diana and the other¡¯s steady sprint across the grassy hills! ¡­¡­¡­¡­¡­¡­¡­ Skippin¡¯ a bit, later on, at night time, As you would expect, everyone was soundly asleep. Crystal and Anna were silently sleeping separately, Diana was hugging Rei, pretty much snuggling her, and Ilgua was several meters away sleeping alone, due to his ¡®insecurity¡¯ or something. But Diana was having a slightly different experience from the rest, ¡°Hmm~? Isn¡¯t this¡­?¡± She soon found herself in a dream, standing on an empty white plain with a gigantic tree growing at the centre of it all. Her memory wasn¡¯t very clear, but if she recalled, she had a dream like this before, when she fell asleep at the graveyard(which she¡¯s still unsure why that even happened). Pretty sure she tried to cut this tree down using a chainsaw, and then¡­a sign appeared? *Looking for me, Diana?* Talking about signs, before she noticed, a wooden sign suddenly appeared before her, with said words written neatly on it. ¡°Hey~! It¡¯s Sig! How¡¯re you doing?¡± *Me? I¡¯m fine, just living my life out in this empty plain, alone* Somehow, she could guess that Sig was pretty lonely sitting alone. After all, if she was here all alone, she would¡¯ve-¡­Wait, Sig was conscious this whole time then? *Pretty much* Uwah!? This damn sign read my mind!?...Actually, this guy¡¯s another personality of Diana, isn¡¯t he? Then her fourth-wall breaking skills was also inherited¡­Hah¡­How troublesome. ¡°Anyways~, isn¡¯t this place just a dream though?¡± *Actually, while you were busy going around, I looked into this place a bit, and it¡¯s interesting* ¡°So, what is it?¡± *Remember that weird place you were in when you died? That place was similar to this place, but also completely different* Similar but different¡­yeah, no sh*t sherlock. *Shut up. Unlike what we expected at first, this place isn¡¯t some kind of dream or a place inside our heart and soul. No, instead, this place seems to be linked to the gods* ¡°¡­Eh? EH!? Gods!? Gods exist in this world too!?¡± Gods. As she knew them, they were some kind of entity that ruled over human lives and drove them with ¡®fate¡¯. The details differ according to the religion, but they¡¯re usually the creators of humans and stuff. *Apparently. See that giant tree there? The one you tried to cut the first time you got here, like an idiot?* ¡°You don¡¯t need to bring that uupp~¡± *Remember when I said that if you cut it, you¡¯ll die? Apparently not* ¡°Which means that I can cut it, yeah~?¡± *Nope, if you cut it, everyone on this world will die* And after reading that, *Silence¡­*. Not everyday that you could cut down a tree and get everyone on the damn world killed, if ever! *You didn¡¯t let me finish* ¡°¡­¡­So! What am I doing here then~?¡± *Nice topic change. To answer that: I don¡¯t know. For now, it seems you just come in randomly, but once this ¡®dream¡¯ ends, I¡¯ll look into it more* And with that, the important ¡®talk¡¯ was now over. Now¡­What to do? Obviously, she could train, but that¡¯s boring~. She could also just have casual ¡®conversations¡¯ with Sig, but that¡¯s bound to get boring too, so what to- It was at that moment, that an idea struck her mind and kicked its gears into motion. See, one of the interesting quirks of this place was that she could fabricate and create anything her mind can come up with. If so, then-! *Oi oi¡­Seriously?* She could just create her gaming computer and play some games! As she thought so, her gaming computer, kitted out with a nice desk, a blue swivel chair, a pair of red headphones, and a mouse appeared before her. If Sig had hands and a face right now, he would¡¯ve facepalmed himself so hard, even Saitama will be impressed. With no further ado, she booted up her computer, and much to her delight, her huge digital cabinet of games were still there, waiting to be played! Well, she couldn¡¯t do online games anymore, since Wi-Fi wasn¡¯t even a thing here, but offline games should do! After 5 minutes of randomly scrolling through her list of games, she ended up playing a nice relaxing game of Stardew Valley for, about, 2 hours most before she stopped and played something more, thrilling. And it ended up being a nice long session of Call of Duty, with her playing through the whole entire story mission in one sitting, before her head started to feel foggy, ending with her passing out. ¡­¡­¡­¡­¡­¡­¡­¡­ ¡°Nguu~¡­¡± Slowly, she rose up and stretched her arms up into the air. Looking up, the sky was still quite dark, so she woke up too early it seems. But, it¡¯s became quite a habit for her really, since she¡¯s been doing a lot of tests on her [Slime Cloning] skill. Around her, Anna, Crystal, and Rei were all still soundly asleep. And¡­Ah, Ilgua¡¯s not there? To her surprise, Ilgua wasn¡¯t sleeping at the spot she last recalled, which was somewhat worrying. Actually, he probably got up earlier than she did, since, if she recalled, he mentioned something about ¡®training¡¯, so him getting up early wasn¡¯t that odd. But, once again, she had another one of those ¡®dreams¡¯, the one where she stands inside that boring white place with that giant tree and Sig. She did play some games though! Talking about games, she wondered if the gameplay saves¡­ Anyways, now that she¡¯s awake, she might as well- ¡°Huh? You¡¯re already awake, Diana?¡± ¡°Hmm? Aya~! It¡¯s Ilgua! Morning~¡± Speaking of which, here¡¯s Ilgua, standing there with his clothes sweaty and a towel slung over his shoulder-, wait, a towel? And not just any towel, a modern towel, the one you¡¯d usually use to wipe your sweat off. Well, she wasn¡¯t expecting to see that in this fantasy world! ¡°By the way, what were you doing? Training?¡± ¡°Huh? O-Oh, yes. I ran several laps around the area and practiced martial arts.¡± ¡°He~, you practice martial arts? That¡¯s cool! Can you break stone with your hands and stuff!?¡± At that, the boy shook his head and replied, saying, ¡°I-I¡¯m not that strong¡­I still need my magic sword to do that¡­¡± She wasn¡¯t sure if he was just being modest or not though. ¡®Magic swords, huh¡­¡¯ Either ways, it did confirm though that the sword he usually carried around wasn¡¯t any normal sword. It did make her wonder if it was just a sword enchanted with mana, or something else more spectacular. Well, Ilgua¡¯s all sweaty and tired out now, so he sat down as he drank some water from, what seems to be a water canteen? She¡¯s not really sure actually, but that¡¯s what it looked like. And then, silence. A serene, almost pleasant silence floated between the two. Diana was still groggy from waking up, so she didn¡¯t bother starting a conversation, while Ilgua was tired out, and blushing for some odd reason. After a while, she picked up his staring at looked at him, which only seemed to make him even more embarrassed. ¡°Ilgua~? What¡¯s wrong?¡± ¡°U-Umm¡­Y-Y-Your c-clothes¡­¡± ¡°My clothe-, ah.¡± Looking down, she saw that her shirt had several of the top buttons undone, giving quite the nice view for Ilgua there. And for some reason¡­she didn¡¯t mind. ¡°Do you not like it~?¡± Was the question that seemingly slid out of her lips, and of course, she added a bit of an accent to it, just to seem more sensual. After all, she¡¯s seen several of these kind of scenes in anime, and it¡¯s always a pleasure to watch. ¡°I-I do-, I-I mean, p-please button y-your shirt!!¡± ¡°Ehehe~, okay~¡± Just like asked, she buttoned up her loose shirt, not after she gave him one last teasing look though. ¡®His blushing face is cute¡­¡¯ She thought silently as silence dawned on them once again. And with that, the two pleasantly watched as dawn came, and the sun slowly rose from the horizon, painting the dark sky a beautiful gradient of orange and red. [38] Inner Voices Several days later, after some hard travelling and battling, along with some distractions to fulfil their curiosity, Diana and co finally made it to the kingdom of [Gazelle]! So!...One word. ¡°HUGE!!!!¡± Yep, [Gazelle] was huge, very. Well, she knew that it was a kingdom, and it¡¯s common sense that kingdoms are huge, but, still¡­Actually getting to set her eyes on one was just¡­awesome. First off, as of now, they were waiting in line to get checked in through the gate, with guards standing by the opened gates inspecting the people who went in, just in case some outlaw or whatnot decided to appear. So while waiting, Diana was happily marvelling at the towering walls surrounding the kingdom. If anything, it reminded her of one of the stone brick walls from Attack on Titan. Crystal and Anna were also doing the same, since the former had only lived inside the dungeon and the other had lived out her current life at a small village. ¡°Have you three never been to a kingdom?¡± The three shook their heads at Ilgua¡¯s question, eyes still staring in awe at the huge towering walls. But! More than that! They couldn¡¯t wait to see what¡¯s on the inside! ¡­Oh, and since they¡¯ll be entering human civilisation now, Diana forced Rei into some used clothes she ¡®borrowed¡¯, much to her displeasure. She didn¡¯t want anyone seeing her naked, okay!? ¡°Identity.¡± Ah, before they realised, it was their turn next. Diana showed her card and got through, Crystal and Anna did the same, Ilgua pulled out his(his guild card was blue!), Paulena mindlessly showed hers, and Rei got through with the excuse that she was lost hers and got through with a small fee of 1 silver. And, once they were in, the kingdom was just¡­beautiful. The streets were laid out using stone bricks, the houses were medieval style(of course), with some exceptions being the guild buildings, a training academy, and some suspicious looking buildings she wasn¡¯t quite sure what for. And standing in the centre of this all, was the castle, where the king lived comfortably with his wife and children. Most of the populace were humans, but, much to her displeasure, she could spot some people with collars around their neck, similar to the one Paulena was wearing right now. They ranged from young but ragged looking men, to children, and what seemed to be Beastmen, or as humans usually call them, demi-humans. It wasn¡¯t¡­nice to look at, but knowing that Paulena¡¯s in a similar situation because of her, she didn¡¯t have much ground to talk on, did she? Uwah~, now she¡¯s feeling kinda bad for putting her in this state¡­ Well, she did try to kill and capture her first, so her empathy wasn¡¯t made for her, but still¡­ ¡°¡­Diana?¡± ¡°Huya!? O-Oh, what¡¯s up, Rei?¡± She tried to reply with the happiest voice she could muster right now, but, they weren¡¯t convinced. Well, it made sense really. She¡¯s born from Earth, and on that green planet, morals and ethics were a big thing of life there. She was a stuck up NEET, sure, but she still held the morals that her father had taught to her back then. Seeing those people, their expressions twisted in suffering and pain, it made her stomach feel weird. ¡®Muu¡­What¡¯s wrong with me suddenly¡­?¡¯ But, well, human lives don¡¯t seem to hold much value here, and killing was- No, even then, even if killing and slavery was fine, it¡¯s¡­still not super okay in her book. She wasn¡¯t sure why she killed those bandits without much thought back then, maybe she was just groggy having just woken up, but looking back, hearing the bandit leader¡¯s muffled scream was- ¡®N-No, stop it! What am I thinking!?¡¯ Her heart felt heavy. It was beating rapidly, stress was building up, cold sweat began to form on her palm. Her heart kept on beating, pumping the ¡®blood¡¯ that filled her. ¡°Oi. Diana.¡± ¡°Uwah!?¡± ¡°You okay? You look slightly pale.¡± O-Oh¡­It seems like she got sucked into her own world again. Everyone was looking really worried now, and¡­venturing deeper into her thoughts now might not be a good thing. With, somewhat slower pace, and without her usual trademark wide smile, Diana and co slowly made their way to the nearest inn, booked a large room for the six of them, and settled in. ¡®How¡­did I kill them so easily¡­?¡¯ That question echoed in her mind as she slowly slid into her bed sheets, the warmth quickly inviting her to sleep. But without Diana to start a conversation, the five just, sat around, silence in the air. ¡°I-Is Miss Diana okay¡­? She looked rather pale¡­¡± Anna was the first to break the ice, before everyone quickly fell back into their thoughts and silence ruled the air once more. Since Anna and Ilgua didn¡¯t know how Earth was, they weren¡¯t quite sure what¡¯s wrong with her. But, Crystal had an idea. ¡°I think she¡¯s beating herself up over, something.¡± ¡°Beating herself up? What do you mean?¡± Ilgua was rather intrigued. ¡°I¡¯m not sure myself, but last time she¡¯s beating herself up over something, the same thing pretty much happened, aside from her crying and all.¡± ¡°W-Will Miss Diana be okay then?¡± She couldn¡¯t answer Anna¡¯s questions so easily. After all, Diana was goofy and bubbly on the outside, but how was she on the inside? But. Little did they know, Diana was actually still somewhat awake at that moment, and her dark thoughts were¡­getting worse. ¡®I said I hated seeing others get injured, but I corroded Paulena¡¯s skin without a second thought. I said I didn¡¯t like violence, but I killed those bandits so easily. What a f*cking hypocrite I am.¡¯ She didn¡¯t know why, but the regret from all her deeds were only coming to her now. Like water just waiting to break free from a dam. And it was wrecking her. ¡®What the f*ck happened to me?¡¯ Was the first question. ¡®Did fusing with Slimey make me like this?¡¯ Came next. ¡®Am I¡­slowly losing myself?¡¯If you spot this story on Amazon, know that it has been stolen. Report the violation. The prospect itself scared her to her core. If she really was slowly losing herself, like chips of stone carved away in a rough rainstorm, then¡­who was she now? Was she still Davin? The ¡®ProDavin888¡¯, the legendary NEET, the boy turned girl who so wanted to adventure to a world unknown, or someone else? Who¡­is she now? ¡®Am I¡­Can I, kill people¡­now¡­? With¡­such, ease¡­?¡¯ Killing a monster was¡­still unpleasant to think about, but it made sense at least. They didn¡¯t exactly have much intelligence per se, and she needed to kill them to survive after all, but people? It was as if¡­she was becoming a monster herself. Even tracing back further than those bandits, when they first escaped Tartarus, why¡­why did she jump in and eat that zombie alive? As if¡­she was like them. ¡®N-No¡­s-stop it¡­¡¯ It was getting worse, the voices in her head, screaming at her. Her throat was burning, her body felt heavy, her heart felt, strained. It¡¯s¡­She- ¡°She was eyeing those slaves from before. I¡¯m not sure what she was thinking then, but¡­she¡¯s kind, too kind at times. But¡­I suppose it¡¯s what I like about her.¡± Suddenly, Crystal¡¯s soft hands gently ruffled her hair. Slowly, slowly but surely, those voices faded away, locked back into the back of her mind. Honestly though, Crystal gently comforting her was¡­nice. If she¡¯s awake, she¡¯ll probably not do this, but¡­hey, it¡¯s her profit, right? But, it made her happy, seeing as she still thought of her as being kind. She was having to put her entire willpower to stop herself from crying. ¡®¡­Thanks, Crystal.¡¯ Well, for now, perhaps some sleep will clear her head for the rest of the day. As for who she was¡­that can wait for further info. She¡¯ll settle on being ¡®Davin¡¯ for now, yeah? ¡­¡­¡­¡­¡­¡­¡­ ¡°You okay now?¡± ¡°¡­Yeah, sorry.¡± After a nice 2 hour sleep, Diana¡¯s back up, and-¡­well, she wasn¡¯t completely back to her ¡®usual¡¯ self. She wasn¡¯t joking around or being bubbly, but her smile¡¯s there. In fact, her soft smile seemed much more genuine now¡­or maybe that¡¯s just her. Looking out through the window, the sun was getting quite low. It¡¯s not evening just yet, but the sun¡¯s already beginning to dip into the horizon. Adventuring out at this time would not be a good idea. So, they mostly spent the time chatting to each other and resting. ¡­Or that¡¯s what they would¡¯ve done, but no one bothered to start a conversation. So, with no one wanting to speak up, and with no spark to light a conversation, a nice tranquil silence ruled the atmosphere, giving Diana some time to think. She wasn¡¯t showing it, but in fact, she¡¯s feeling much more alive than even right now. Unlike the moments before when she was being bubbly and all, this felt like she¡¯s back to her normal self, the Davin she was. Thinking about it, maybe fusing with Slimey did cause some problems in her psyche, but she¡¯s ¡®back¡¯ now. She hasn¡¯t changed much. She¡¯s still a NEET, who¡¯s dream is to explore this world with her friends and cook some delicacies like in Toriko. Actually, thinking about it more, who was truly in control back then? Back on Earth, born as a proud American, she was¡­was¡­huh? For some reason, she couldn¡¯t remember much about her birth-, no, not just her birth, much of her past life back on Earth was just¡­missing. Things like foods and games were still sticking in her mind(for some reason), but other details, like where her home was, what state she lived in, and other minor stuff, she couldn¡¯t remember. Was this a side effect from coming back to life? It¡¯ll make sense, since you won¡¯t just come out from your death bed saying ¡®Oh! I¡¯m totally fine!¡¯ with no worries cropping up inside your head. Even now, it felt like some things were slowly slipping out of her. Like drops of water leaking from a crack, her knowledge and memories were slowly being drained. Well, it¡¯ll still take a long time, but¡­ ¡­still. If that was true¡­If she really was losing herself more and more as time passes on, what¡­what will be left of her by the end of it all? Will she remember Earth? Will she remember her birthplace? Would she recall herself being human, at all? The possibility sent chills down her back. Because if she losses herself, losses her morals, the lessons that she held deeply, would she then begin killing with a second thought? In her terms, a monster wasn¡¯t a race or a class, it was something that hunted and killed without any thought or remorse, without any conscience telling them that the things they were doing were wrong. Rei, Crystal, Ilgua, and even Anna to an extent didn¡¯t care about life as much as she did. Was it just because they were raised in such different environments? Then¡­was she in the wrong? Should she be the one to dispose of her morals and fight and kill? ¡®S-Stop it¡­¡¯ Should she abandon the morals her father had thought her, and proceed together with this world? Where a single life only amounted to a single grain of sand inside a desert? ¡®S¡­Stop¡­¡¯ The little voices clashed against each other. She could hear it, a voice calling to her, saying that all this was just over-thinking things. That all this regret and remorse from just killing a group of bandits was dumb. And in some aspect, it was. But, while they were bandits, yes. What caused them to become like that? Was it their nature? Greed? Lust? Or was it because life had forced them that way. A betrayal, poverty, a loss of faith. They didn¡¯t show it, but there must have been one or two bandits there that didn¡¯t steal and plunder just because they wanted to. And knowing that she had shut them down, it displeases her. ¡°Diana?¡± ¡°Hya!? W-What is it Crystal?¡± Huh¡­It seems like she got too deep into her thoughts again. Crystal was pretty much getting ill with worry at this point, seeing as Diana did just stay silent and unmoving for around 30 minutes. ¡°Are you really okay? You¡¯re shivering. You sick or somehyaAA!? W-W-What are you d-doing!?¡± Without much thought, she moved and hugged her, much to the other¡¯s shock. Diana herself wasn¡¯t quite sure why she did so, but the little voices in her head began to die down as her warmth comforted her. ¡°Sorry, I¡­just, need this¡­for a bit.¡± ¡°W-W-W-We¡¯re b-being w-watched!!¡± She almost said comically as she eyed the others, no one was actually bothered though. They just stared at the two, still warped in worry for Diana. But, much to their surprise, she answered in a soft, almost weak and defeated voice. ¡°¡­Please.¡± And by that point, not even her shame could stop her from hugging back. ¡°¡­Hah¡­Alright, there there.¡± ¡­¡­¡­¡­¡­¡­¡­ The next day, quite early in the morning, ¡°Alright! Towards the adventurer¡¯s guild it is!!¡± And Diana¡¯s back to her normal self again! It was a great morning for mostly everyone, but a terrible morning for Crystal, who happened to wake up the latest, and was still somewhat groggy. ¡°So loud¡­¡± ¡°H-Hang in there, Miss Crystal!¡± As Diana had just said, they were currently headed for this kingdom¡¯s adventurer¡¯s guild, which from afar, seems more like a Japanese dojo than anything else. Not like she¡¯s seen one in real life, just from pictures on Google. It was mostly made out of wood, had around 3, maybe 4 floors, and was big, really big. Not as big as that castle in the centre of the kingdom, but still big nonetheless. Their objective for the morning was to sign Rei up as an adventurer, and get her a guild card so they could spare themselves from having to pay a fee every time they entered a new kingdom. Once inside, they went up to the second floor and signed Rei up there, since the first floor was actually a tavern-like place, with a bar, a small restaurant combined with it, and what seems to be a place for a musician or whatnot. With her name signed and the fee paid, Rei¡¯s card would take around 30 minutes to fully process, and another 30 minutes to create. The process to create these things were a secret, kept in so that no idiot would try and replicate them. A smart move. While waiting, they just went back down to the first floor to have a nice breakfast together. It was also then that she realised that their money supply was dipping, and buying stuff carelessly would probably be a bad idea. Since it¡¯s still early, there weren¡¯t many people coming in and out, maybe one or two, but the place was mostly silent. Except for Diana¡¯s group of course, as they listened in on Ilgua¡¯s tales. After finishing up their breakfast(which was good by the way), Rei, accompanied by Ilgua and Anna, casually sat back at the first floor, while Diana and Crystal went up to the second floor and looked at the [Quest Billboard]. [Quests], in the receptionist¡¯s own words, ¡®are little missions given out by people when they need something that is faintly related, or directly related to an adventurer¡¯s work line, as in fighting monsters and stuff¡¯. So, it could be a ¡®Kill monster and get monster parts¡¯ quest, or a ¡®protect/safely bring me to certain location¡¯ quest, or even a ¡®deliver this(aka FedEx)¡¯ quest. Of course, there are more interesting quests than that, but most of the billboard was crowded with these three types. After a while, they didn¡¯t find any interesting quests to pick, and Rei¡¯s guild card was finally done, so they headed back down to the first floor, only to find- ¡°H-Hii!! I¡¯m sorry! P-Please forgive meeee!!¡± A large man kneeling before Ilgua, who had his magic sword drawn out, and had seemingly sliced him straight across his chest. Blood was quickly leaking out of his wound, and just seeing that alone was making her nauseous. ¡°You better be.¡± From the looks of it, and from what Anna tried to explain through her gibberish, this man pretty much tried to hook up with Rei and Anna, while scoffing at Ilgua, only to get a punch to his abdomen from Rei, and a clear slash from Ilgua. But¡­She¡¯s not sure how to put it, but¡­something feels¡­different about Ilgua. Maybe it was just her, but¡­there was this, ¡®aura¡¯ around him that just screamed danger. Heck, even her [Danger Perception] was blaring its alarms, and he wasn¡¯t even targeting her! Feeling threatened by this display, the man, and the other two who followed behind him, quickly made haste towards the exit and left, which garnered him a grateful thank you from the bartender, as those three were frequent ¡®jackasses¡¯ as he puts it. Well, he¡¯s back to his normal reserved and humble self, so¡­everything¡¯s good then. [39] The Goblin Tribe ¡°Huah¡­So¡­sleepy¡­¡± ¡°Were you even listening!?¡± Back at the ever-snowing mountain peak, inside the comfy warmth of a small wooden cottage, Leo lied idly on his bed as he yawned, ignoring the complains of the man sitting beside him, his head flashing so red that it¡¯d probably blow up soon enough. After all, who wouldn¡¯t be pissed for getting ignored for an hour straight!? Keeping his promise, after several days, he returned back to this cottage to see if he¡¯s done anything about that recent ¡®monster¡¯ that appeared. But as he voiced his concerns, the boy only lied back at his bed and yawned several times, and almost fell asleep at one point. ¡°Of course not~¡­¡± Not like he cared though. This old man just suddenly barged into his wooden cottage without any pleasantries and sat down, telling the same exact concern he had about that girl he asked Ilgua to watch on. The casual answer he gave only proved to enrage him more, but he couldn¡¯t just lash out. If he did, he would die so fast he wouldn¡¯t even feel the pain of getting his body ripped in half. ¡°Besides~¡­I told you she¡¯s not evil¡­Just let it be already¡­¡± ¡°B-But-!¡± ¡°I said she¡¯s safe.¡± He abruptly said, shutting the old man up. Honestly, speaking to this old man feels like letting his brain cells commit suicide one by one. ¡°And besides, shouldn¡¯t you be more worried about me?¡± The man gulped in fear, realising that he had probably complained to him a bit too much. He couldn¡¯t even look at him without feeling cold sweat pouring out of him like a natural waterfall. The aura he had swirling around him only screamed of death. And the boy wasn¡¯t even looking at him. It only speaks volumes at to just how absurdly powerful this person before him is. He himself hasn¡¯t seen the limits of his powers, but he¡¯s seen him lift an entire continent up into the air and smash it back down like it¡¯s nothing. ¡°Anyways~¡­my disciple is watching her¡­so it¡¯ll be fine¡­¡± ¡°Y-Your disciple? That boy?¡± ¡°Mhm~¡­¡± That boy was timid and weak-willed by nature, but his tenacity and knack at learning things were superb, even compared to Leo. He¡¯s seen him and trained him enough to task him with such a mission. And if anything goes wrong¡­then he still had that, just in case. ¡®What are they doing now I wonder~¡­?¡¯ ¡­¡­¡­¡­¡­¡­¡­ Meanwhile, at a small village several miles away from the kingdom of [Gazelle], Diana and her party were having a chat with the village¡¯s chief. They came here after they took on a quest to slay a nearby goblin tribe that had been hunting down and kidnapping their women recently. Sadly, most of the young men went out to become adventurers or knights, while the women and children were left behind without being able to fight, and the men that did stay behind are either too weak or too old to fight them. The chief himself was an elderly man with many injuries on his legs, forcing him to use two wooden walking sticks to support him. From the sob story he told over some cups of tea, he lost those two legs of his after a battle against a ¡®Goblin Chief¡¯. Actually, there was another quest that asked them to slay a group of bandits near here, but Diana decided not to take it, much to Crystal¡¯s confusion. In fact, Crystal has been suspicious about Diana for a while now. Starting from dawn, Diana hasn¡¯t been the ¡®Diana¡¯ she knew, the bubbly, cutesy, and chill Diana. Instead, she was excited, humble, but ultimately genuine. She didn¡¯t bother questioning it further though, since she liked it either ways. The air around her was much softer and kinder. Her smiles were softer but more expressive than ever. And she seemed to enjoy talking about magic and whatnot a lot more¡­Well, only Crystal has seemed to notice this change though. Maybe she¡¯s paying a little bit too much attention to her. ¡®W-What are you saying idiot!? I-It¡¯s not like I am!!¡¯ How the hell did you even hear that? Anyways, after they finished listening to his request and all, they followed the lead he gave them and set off towards the small forest south from the village. From what the chief said, there¡¯s a layer of trees, before the inside clears out to the goblin tribe. According to his story, the goblins settled there several decades ago, cut down the trees on the inside, and built their camps there. They were a small tribe at first, but as they kidnapped the women from this village and used them as breeding tools, their numbers blossomed and they quickly became a problem. However, as no one bothered to even come here, they were forced to finally make a request. It wasn¡¯t something Diana wanted to imagine, seeing those women get taken away and used for building the goblin tribe. The feelings of loss as the men watched their loved ones get taken away, and the despair the women felt as they were subdued to the goblin¡¯s handling. She could almost hear the cries of help, and the pleas they shouted as the goblins worked on them. That alone almost made her sick. With those feeling bubbling inside her mind, she and her party slowly made their way around the trees, through the foliage, and towards the goblin tribe! But, to their surprise, *GUUUGHHAAA!!!* Just as they were released from the trees, a horde, or an army even, of goblins stood before them, their weapons raised in the air and combat ready. ¡°W-What¡¯s with this stupid number¡­?¡± It was an event unlike anything Ilgua had ever seen, or even heard of! He hasn¡¯t been to many different places, but his master had the power to see anywhere he wanted, so seeing cool little events like this was definitely up his alley. But what¡¯s with this number of goblins!? There¡¯s maybe¡­hundreds? No, thousands. And they even have classes and all that. There¡¯s the goblin paladins, standing in front with their iron shields and swords, which they probably stole from some unlucky adventurer, standing behind them are the archers, and at the back row are the magicians. ¡®Were they planning a raid dungeon or something?¡¯Unauthorized reproduction: this story has been taken without approval. Report sightings. ¡°We were waiting for your arrival.¡± Then, as everyone was getting ready to fight, an elderly goblin stepped out of the crowd. He was short, but his eyes shone with wisdom, and guessing from those two traits, this guy is probably some kind of chief, yeah? ¡°So¡­you guys already knew we were coming? Did you have a sonar or something?¡± ¡°Yes¡­we have been waiting for your, Slime Queen.¡± Woah¡­woah woah, hold the phone. Did he just call her, [Slime Queen]? How did he know that!? She never told anyone about her being a slime queen, not even Crystal knows this stuff! ¡°¡­Slime, queen?¡± ¡°Umm¡­I¡¯ll explain later. So? What do you want?¡± ¡°Our¡­¡¯scouts¡¯ back at the [Zena] Forest informed us about your existence, and sensing your approach, we readied our troops, just in case you went in to kill us all.¡± [Zena]¡­Forest? She never heard of that name, but why does it ring a bell¡­ Hold on- ¡®¡­Wait, was it that forest where I found Slimey and his friends?!¡¯ It seemed like the most likely option. Since, she¡¯s only ever really been to one forest, and when she was there, goblins were attacking her left, right and centre. Hah¡­Good times~ Well, that aside, they were sent here to exterminate these guys, and it won¡¯t be that hard actually, but the old guy wasn¡¯t instantly asking his fellow goblins to fire at her, so her will to commit monster genocide was diminishing as the clock ticked by. But, still, these guys have kidnapped women to expand their tribe, so no forgiveness!...Right? ¡°Oi, old man.¡± ¡°O-Old man?¡± Well, forgiven or not, Crystal didn¡¯t care that much. There¡¯s probably an entire legion standing before her, and oh boy is her battle-junkie heart pounding with excitement at the incoming battle! ¡°We¡¯re here to kill you all anyways, so make this fight worth-¡° ¡°C-Crystal!¡± But not on Diana¡¯s watch! Which did come as a surprise as she turned towards a slightly angry Diana. ¡°Why though? It¡¯s our quest, isn¡¯t it?¡± ¡°Yes, but¡­Just, wait, okay?¡± It¡¯s not like she didn¡¯t want to avenge those women who were stolen away from their loves ones either, but, something felt¡­off? She didn¡¯t really know how to describe it, but there¡¯s an odd feeling in her gut, and she knew damn well that her instincts were usually spot on. And also to maximise this moment, she also gave Crystal her best puppy eyes, just to sway her to not kill everyone. ¡°¡­Alright. But if they attack, I¡¯ll go.¡± Crystal still felt somewhat disappointed, but, hey, no one¡¯s going to escape from Diana¡¯s cute puppy eyes! She won¡¯t say it to anyone, but it was a nice treat to see her like that! It¡¯s almost like having a too-pure for this world little sister! ¡°I¡­thank you for your kindness, Slime Queen.¡± ¡°Just call me Diana. Anyways, we¡¯re here for a quest to hunt you guys down, because the village chief from nearby said that you have been kidnapping women and using them to make more goblins. Is¡­Is that true?¡± ¡°What¡­?¡± The goblin chief¡¯s eyes grew wide from shock. This¡­was not something he knew of. In fact, a lot of the goblins behind him were murmuring the same thing, struck in confusion about these seemingly fabricated lies. Diana-, well, everyone noticed this of course. And they were shocked as much as the goblins were. After all, it¡¯s common sense for goblins to steal young women to use breed. But, if they didn¡¯t do it, then who did? Obviously, bandits are out of the question, because the chief did say that he once spotted goblins attacking and stealing women. Then, could some of them be doing it in secret? ¡°I¡­I didn¡¯t know anything about that¡­¡± ¡°But¡­how, do you give birth to more goblins then? ¡°Even back centuries ago-¡° ¡®Centuries¡­?¡¯ ¡°-our ancestors created a rule to only allow sex between goblins. According to them¡­a baby born from a human and a goblin results in mixed blood, which then lowers the goblin¡¯s expected life span.¡± ¡­huh. She, didn¡¯t think about it that way. But, still, centuries? If these guys stopped breeding with women centuries ago, then what about now? The chief said that it started only several years ago! What¡¯s with this time gap? ¡°But¡­if you wish to prove me wrong, a mix-blooded goblin¡¯s skin would be a much lighter shade of green, while pure-blooded ones are usually darker. Now¡­see for yourself, Slime Queen, are there any mixed bloods here?¡± Umm¡­well, she couldn¡¯t see entirely to the back of the army of goblins, and some of them were even wearing clothes and cloaks and stuff. But, from what she could see, there didn¡¯t¡­seem to be any? Her eyesight¡¯s pretty bad though, especially after the many close-up gaming experiences she had back on her computer. ¡°¡­None.¡± ¡°Eh? Really?¡± ¡°¡­Un.¡± ¡­Well, Rei said there wasn¡¯t any, so she¡¯ll have to trust her here! Out of them all, she had the best senses after all!...There still could be one or two hiding in between them, but the number of ¡®pure-blooded¡¯ goblins in this group was just, huge. ¡°He~, so there¡¯re differences between mixed breeds and pure breeds. Say, say, mister goblin, is there any more differences? Like power? Speed? Are they more durable? How much longer can they live? Why are their skin¡­¡± It seems¡­Ilgua¡¯s gone into his full question mode. His mouth was spitting questions faster than a rapper in his prime. Heck, he was even jotting down notes with his vacant hand as the goblin chief desperately tried to answer back his questions. -Much questioning later- Here¡¯s what Ilgua has noted down from his escapades: Any difference for pure from mixed? -Natural strength higher -Bodies more durable -Age slower -Human lifespan -Evolution more possible (AWESOME) It was literally written like that, so do forgive me for the writing. In reality, it was¡­even worse than this, because his note was absolutely crowded, and his strokes of ink went everywhere. His handwriting was also ¡®beautiful¡¯, so¡­yeah. ¡­Anyways! Goblin traits aside, since there¡¯re no mix-blooded goblins around here, meant that all(or most at least) of the goblins here are bred by two goblins. Which meant-! This goblin tribe didn¡¯t kidnap the women? ¡®But, where did all those women go then?¡¯ The question still remains, but for now¡­ *Gu¡­gha?* They should probably set down their weapons, yeah? Now that they knew that these goblins weren¡¯t the main culprit, it¡¯ll leave a terrible after taste in her mouth if she allowed her friends to kill them all. That, and she was actually feeling slightly tired. The road leading to this forest wasn¡¯t monster clear this time around. So, after they managed to calm down, and set down their weapons and all, a ¡®treaty¡¯ of sorts was made on the spot between her and the goblin chief. They even exchanged a handshake and all. Either ways, because she was a ¡®Slime Queen¡¯, they were treated as guests of honour and such. After all, according to the goblin chief at least, the slime queen was a special existence that is born every millennia and whatnot. This, also meant that she needed to explain why she was the ¡®Slime Queen¡¯, which then meant that she needed to retell the first ¡®experience¡¯ of hers in this world¡­while they were relaxing in a nice hot spring. Yep, that¡¯s right people! This goblin village has a public hot spring! It¡¯s for both men and women, but Ilgua wasn¡¯t determined enough to come in with them, so she¡¯ll tell him about it later. Also, this was the first time Diana had even stepped into a hot spring. Well, it¡¯s a first for most of them actually. But¡­the hot water, and the nice steamy atmosphere¡­Ah~, it really was relaxing~ ¡­Ahem, back on track. She was expecting them to laugh at her or something about her getting assaulted by a group of slimes, but surprisingly, they all just looked at her weird. It¡¯s to be expected really. She is a [Slime Queen], a legendary monster that ruled over slimes after all! Not everyone would have the chance to suddenly realise that this girl they¡¯ve been travelling with was such a powerful existence. It was also a revelation for Crystal as to why she was just so damn good with Slime Magic! Rei seems to have known this before though, probably because she could communicate with Slimey, and knowing that little guy, he probably boasted her status to her. But¡­Slimey, huh¡­His fusion with her hasn¡¯t been that long ago, but¡­it¡­felt like it¡¯s been a long time. She felt somewhat lonely, but Crystal and Rei was with her, so it¡¯s fine. ¡­Anyways, once her story time was over, they just had a nice chatting session, talking about, girl¡¯s stuff, I suppose. After that, they had a nice dinner with the fellow goblins. Thankfully, they weren¡¯t eating human meat or something, so that¡¯s a relief! Instead, they just ate some roasted boar meat from the forest. Well...I say ''Roasted Boar Meat'', but it looked like something straight out of lovecraftian horror, so her appetite to eat that time diminished greatly. Oh! And talking about the forest, apparently, the goblin village they were currently staying in wasn¡¯t the only village in this forest. There are more, and since this forest was pretty big, the distance between each village was pretty large, just to make sure they have enough space to grow. Their total number was unknown, but the chief said that there¡¯s about 5000 goblins all around, and there¡¯s about 22 or 23 villages in this forest, which was¡­a lot. And so, with dinner over, everyone went their separate ways to rest for the night¡­except for Ilgua that is, who kept pestering the goblin elder with questions and statements that he wanted to confirm. His rattling went on for hours on end¡­ ¡­¡­¡­¡­¡­¡­¡­ Meanwhile, back at the village, ¡°I-Impossible¡­¡± The chief of the village could only look on in disbelief, as another wave of goblins struck and stole another young woman from them. It was a bloodbath. The men who remained tried to take her back, but the goblins¡¯ surprising skill in tactical battle caused several deaths for those who fought. And under the cover of the night, their attack was swift and deadly, barely leaving them any room to breathe. And now, battle over, the chief could only survey the corpses of his fellow villagers, their parents and loved ones crying over the deceased. And while all this was happening, a pair of eyes watched from the distance, before it disappeared into the night. [40] Reincarnator Late at midnight, As you¡¯d expect, everyone was asleep. They were all comfortably tucked under their beds inside the goblin houses, which look more like huts than actual houses. It¡¯s also made out of wood with the roof being built out of straw. Fancy. One of the few exceptions was the goblin elder, who was silently enjoying a cup of herbal tea as he stared at the full moon. Today had been quite a hectic one. Not a bad one, just hectic. Ever since Diana first appeared in this world, he felt her presence. And he was terrified, much so. He listened in on how she managed to survive many goblin encounters, slowly amassed power, and even killed several of them. It wasn¡¯t a very good first impression. And so, when she first appeared before him, he had made use of the current alliance the goblin villages had built, and gathered an army to battle¡­only, that while her comrades were ready to shed their blood, she wasn¡¯t as sure. In fact, once she realised that he could speak, and that each of the goblins in the army had their own suspicions and thoughts, it was almost as if she didn¡¯t want to. It was¡­an unusual sight. Time and time again, as a new [Slime Queen] is born, they rule over their slimes and send them out to battle, until someone finally managed to bring her down. And that was how it went over and over again, until she came along. For one, it was already surprising that the new slime queen looked so young. And moreover, she was fighting together with a spirit, a ghoul, and two humans. Thinking about it, he smiled. For once, even though a goblin¡¯s life was short, he was glad to have been born. A goblin is born, raised, then dies. That is the law of life. They were weak, simpleminded, selfish. Over time, that may change of course. It was already a miracle for a goblin to live for over 20 years. So, while his life hasn¡¯t been that long, and his death was surely coming closer, he was glad to have been born in this era, to see such a wonderful person be born, one that did not find solutions merely by battle and blood. With that lingering thought, he slowly slid into his sleep. ¡­¡­¡­¡­¡­¡­. Meanwhile, Diana was sitting out in the cold night air, vacantly watching the stars twinkle and fly by. Unlike the goblin elder, she wasn¡¯t sipping some nice herbal tea, but she made up for it with some leftover food from the dinner. She wasn¡¯t thinking anything really, just¡­enjoying the night scenery. You know, once you leave your home, you begin to realise just how nice it¡¯s been back there, when everything was nicer and simpler. Yeah, sure. Her life back at home wasn¡¯t a very good one. Her habits were bad for her health, and her relationship with her mother was rocky at best, but she wasn¡¯t getting chased around by giant alien monstrosities back there, was she? ¡®I wonder if dad¡¯s still watching me¡­¡¯ Anyways, she wasn¡¯t here contemplating her life choices. Instead, she was waiting for someone-, well, something to arrive. *Wush!* ¡°Ah! There you are!¡± Suddenly, out from the forest, came another Diana. Well, more specifically, her clone that she made in secret to watch if any goblins decided to attack it. Fusing with her, it seems¡­yes, several groups of goblins attacked the village from different sides, k¡­killed several men and stole 4 young women. Even if she wasn¡¯t there per se, just rehearsing the memory was¡­unpleasant. Doing as it was told, her clone followed the goblins, from afar of course. But then, ¡°What¡­?¡± After the goblins made it quite far from the village, they suddenly¡­died. No, they were slaughtered. Their blood was shed as the severed heads rolled onto the dirt, their lifeless bodies sinking into the blood. Thankfully, from what they look like anyways, they seem to be mix-blooded goblins, which meant that they were repeating the same damned act as their parents did. So, she was somewhat relieved that they were slain, but¡­it¡¯s still unpleasant to witness. And then, a large cloaked figure appeared, picked up the 4 young women before it ran off. The clone gave pursuit, following the cloaked figure as it sped through the night, before the figure disappeared into a cave. Her clone stopped following it by that point. Which means¡­ ¡®There¡¯s a chance those women are still alive!¡¯ She quickly finished off the remaining food she was holding before she sped through the woods to head towards that cave! Quest [Save the Kidnapped Women] begins! ¡­¡­¡­¡­¡­¡­ And¡­After much running and jumping, here she was, standing before the large rocky cave entrance. It¡¯s a bit¡­odd, with the damn entrance just standing there with nothing around it. Anyways, steeling her will, she stepped into the cave and began walking down, being careful not to-, ah, she slipped. And then she hit her head on a rock. Which then woke some bats. Said bats then proceeded to try and kill her. After screaming like a little girl(which she is, literally), she slimed them all onto the ceiling and corroded them away. Some Exp was gained, but much dignity was lost. Continuing on, since there was no lighting inside, she made sure to stand close to the walls, in case she trips again or something. After some time walking around in the darkness, she finally started to use her brain again and created several dogoos as scouts! With her loyal slimy scouts sent out, she sat down against the rocky walls and relaxed a bit. She¡¯s not afraid of the dark, but the tense feeling of watching out for monsters while also looking for someone who was able to slay goblins in seconds was pushing down on her. She could almost sympathize with those JRPG characters who keep on getting ambushed every 30 seconds.You might be reading a pirated copy. Look for the official release to support the author. Ah, Final Fantasy VI, how I hate getting ambushed by monsters every single time¡­ ¡®Ah! Found it!¡¯ Nostalgia aside, one of her slimy dogoos found something interesting! Using her slime communication powers, she called all the remaining dogoos to gather at the meeting point. And once they were all there, ¡°Woah¡­Is this a ruin or something?¡± It seems her dogoos have found something quite interesting here! Out from the dark cave sections, she was now standing inside a stone corridor, cleanly carved out. Definitely man-made. There were torches hung up by the walls, which was a nice change. And on the clean stone walls, there seemed to be drawings and words written on it, but she couldn¡¯t read nor understand anything about it. And at the end of this corridor, there stood two large stone door. And if she had to guess, those women and their kidnapper were inside. That aside though, this sure brings back memories! Last time there was a large stone door blocking the way, it was back at the Crystal Caves¡¯ third challenge, and¡­man, that maze sure was puzzling. She wasn¡¯t that strong back then, so she had to discard her knife to get through, and inside, she went on without any food, water, and even nearly died from drinking some liquid that was dripping down the maze walls. Which, looking back, wasn¡¯t a very good idea, was it? Anyways, time has changed, and this time, her strength attribute granted her enough power to push the doors open! And inside-! ¡°Don¡¯t move, intruder!¡± ¡°¡­Eh?¡± A row of females, each holding a sharp weapon of their own, stood before her. They didn¡¯t seem to be anyone special, and they weren¡¯t going to deal any damage to her anytime soon, but¡­man, those eyes¡­They all look like predators¡­ And, well, they were dressed appropriately. They were mostly wearing rags and stuff, with one of them wearing a dirty dress. Behind them, she could see more women sitting, standing, or eating, all staring right into her. So, while they were harmless to her slimy self, this sure was one hell of an intimidating sight. And what¡¯s more, ¡°It¡¯s alright girls, I¡¯ll handle it.¡± From behind her, a towering figure loomed over them all. His skin was deep black, his abs were clearly showing, his dirty white hair was fluttering, his crimson red eyes were piercing into her, a pair of horns extended from his head, and his groin was luckily covered by a loincloth. He stood over them all. Heck, he¡¯s probably 2 and a half meters or something! Whatever his precise height is, he¡¯s huge!! Her [Danger Perception] wasn¡¯t ringing loudly, so it¡¯s fine(probably), but, man, does this guy cut an imposing figure to any enemy that stands in his way! ¡°¡°¡°Okay~!¡±¡±¡± They al lovingly said as they backed away and stood behind him. With the women away from them, he slowly made his way to her, his steps sending shockwaves through the stone as he walked. It was f*cking terrifying!! ¡°So? What¡¯s this young lady doing in my lair?¡± ¡°H-Huh? Oh, umm¡­c, can you return the women you took?¡± He kneeled down and leaned his face close to hers, his eyes practically piercing daggers into her soul. ¡°Return? Return to where exactly? I merely found them being kidnapped by goblins.¡± He said, intimidatingly, but also confused at what she meant. Which meant that¡­he, wasn¡¯t affiliated with those goblins then? ¡°Uh¡­To, their village?¡± ¡°¡­And where exactly and how far is that?¡± ¡­Ah, now that he brought it up, it certainly is quite far away. She was pretty damn fast, so it took only an hour or so, but would they be able to do so? And recalling from her clone¡¯s memories, they seem to be injured. ¡°A-Anyways, uh, what¡­are you planning to do, with them?¡± And now, comes to big moment of truth. Time, to uncover what his true motives- ¡°I just want to keep them safe, is that too much?¡± ¡°¡­¡­Huh?¡± ¡°There¡¯s been a lot of kidnappings recently, so I go out every night to take them to safety. It¡¯s been increasing lately though¡­¡± Now, that was not what she was expecting, and he didn¡¯t seem to be lying. Which makes sense since she could spot the 4 recently saved women lying down as other women patched up their wounds. But, if he wasn¡¯t kidnapping them, then who¡¯s leading those goblins? From what the elder has told her at least, goblins are normally dumber than a goldfish, so them employing tactics to attack the village was¡­odd. ¡°Say, young girl, do you know anything about it?¡± ¡°That¡¯s what I want to find out. Goblins are dumb, but I saw them attacking the village using tactics. Did they evolve or something¡­?¡± It was a possibility, but he was unsure of it too. ¡°¡­Also, uh, what, are you?¡± ¡°Hmm? Me? I¡¯m an ogre. A special one if you will.¡± An ogre¡­huh. From what she¡¯s learnt from Ilgua¡¯s ramblings, an ogre was an evolution of Hobgoblins, and Hobgoblins are evolved from normal goblins. She didn¡¯t exactly understand how it really works, but seeing as she evolved from a human to a slime queen herself, she knew it was real at least. That all aside though, it¡¯s a relief that this ogre wasn¡¯t someone malicious. Well, maybe not, but these women are at least safe in his keeping, and he doesn¡¯t seem to want to use them simply to breed more of his kind. If anything, it looks more like he¡¯s going down the harem route. ¡°Anyways, young girl, is it just me, or¡­do you seem rather similar to me?¡± ¡°Huh? What-, now that I think about it¡­yeah, that¡¯s kinda true. And you¡¯re reminding me a bit too much about a certain black skinned ogre¡­¡± ¡°EH!? You know Re:Monsters too!?¡± ¡°EEHH!? You too?!¡± Well, this was¡­interesting. Not only does he feel somewhat similar to her, he even knows a ¡®somewhat¡¯ popular light novel series!? That¡¯s amazing! Who¡¯s this guy!? Wait- ¡°C-Could you also be¡­f-from E-Earth!?¡± ¡°Yep! That¡¯s right, young lady! And I assume you too?¡± ¡°Un!¡± The large ogre smiled widely, and she did too. After all, it¡¯s not everyday that she could meet someone from Earth, and someone that possibly has similar tastes too! ¡®Wait¡­does this mean-!?¡¯ She leaned in closer to his ear and whispered. ¡°Are you¡­trying to build a harem?¡± ¡°Right on the spot!¡± He said rather enthusiastically, even pulling out a thumbs up just to confirm it! They shared a friendly fist bump with each other and smiled, not noticing the quite very envious and dangerous glares from the other women. Anyways, now that she knew who he was, her job for now was done. And she should probably head back now. But¡­ Meh, why not talk with him more? It¡¯s not like anyone back at the goblin village was awake, and besides, she didn¡¯t feel that sleepy yet. So, after they finally realised the intense stares coming from behind them and calmed them all down, they introduced each other! ¡°Yosh! First, my name¡¯s Gaz. Or, that¡¯s what I want my name to be at least. How about you, you?¡± ¡°I¡¯m Diana! Nice to meet you!¡± Yup. Gaz definitely doesn¡¯t sound like a name a normal parent would give to their child in the modern era. Well, she didn¡¯t mind that. Well, introductions aside, they moved on to talk about casual stuff: Anime, favourite Waifu/Husbando, games, hentai, and for some reason ending with the two of them arguing over which of their waifus is best waifu. And then, they transitioned to talking about their past lives. Diana, not really wanting to tell much of it, just told a vague telling of how her life sucked and that she was a stuck-in NEET. She also didn¡¯t tell him that she was originally a guy. Gaz on the other hand, had it much¡­worse. First off, he was a guy in his late 20¡¯s, before a car-crash caused him to lose his legs. While he was recovering, his girlfriend dumped him for another guy, his parents didn¡¯t bother on him, and after he was sent out, unable to do anything, his debt quickly piled up. He didn¡¯t make it really clear, but the stress seemed to have caused him to break down, until he finally couldn¡¯t take it anymore, and took his own life. It was a tragic life. But, death didn¡¯t greet him. Instead, he suddenly woke up as a baby goblin, being carried away as his goblin tribe was getting killed. Later, the person who carried him(who he still didn¡¯t know who) hid him inside a forest and left him there. Hours changed to days. And days changed to months. In that time, he fought, trained, survived, and evolved. He grew, becoming a strong ogre. And now that he was strong enough he decided, ¡®Why not make a harem!?¡¯ After all, it¡¯ll be fun, and the setting was an isekai novel, so it¡¯ll be fine! Hearing his story, it made her realise just how much better her life had been than she initially though. Yeah, sure, she was a jackass, her mother was a drunkard, her father¡­well, anyways, her life was quite bad. But it paled in comparison to his, who literally lost everything. ¡­¡­Anyways, serious stuff aside though, it is kinda infuriating that he, for some reason, has a skill called [Attract]! Like, what!? As you can guess, this skill helps with attracting the opposite sex, hence why so many women are flocking to him. There is a catch though, where said women need to have some sort of interest in him for the skill to actually work. But, still-! That¡¯s just cheating!! It doesn¡¯t work on her though¡­well, slightly. She herself has never been in love, and never thought about getting someone to share it with, so it¡¯s a foreign feeling. But if this heat she keeps feeling and the weird longing to want to stay by his side was love, then¡­well, it¡¯s not bad. Thing is, it also seems to be affected by her [Mentality] stat. And since her stat on that was pretty high, it wasn¡¯t making her fall head over heels for him. But! According to one of her dogoos that she left back at the goblin village¡­the sun was already beginning to rise!? ¡°A-Ah! The sun¡¯s already rising!?¡± ¡°Do you need to go back?¡± ¡°Y-Yeah, sorry. But I¡¯ll visit again soon!¡± ¡°¡¯Right then! See ya!¡± ¡°You too!¡± And so, turning around and heading out the door, their first meeting had ended. *Cue dramatic lighting and ambient music in the background* [41] Digestive Problems After her pleasant meeting with Gaz, Diana¡¯s back at the goblin village, and right before everyone woke up too! Once morning truly came by, everyone got up. The goblins were preparing their breakfast, which was some kind of suspicious looking sliced fruit, Ilgua was out jogging in the forest, alone, and the rest of her friends were just waking up. And now! Everyone¡¯s patiently waiting for the goblins to finish up their breakfast! Except for Crystal that is, who was still sleeping inside apparently. She was sent into the hut to wake her up. Well, it didn¡¯t bother her much, since she used to be like that too. As a full-time gamer and anime addict, once she falls asleep, she¡­sleeps, for a long looong time. She could probably past an entire day just sleeping from her 700+ episodes of One Piece Marathon. Well, all that aside, she¡¯s glad no one figured out that she sneaked out last night, cause- ¡°Oh! Diana, you¡¯re back. So, where did you go last night?¡± ¡®W-What!? S-She knew!?¡¯ Or¡­not. Seems like Crystal somehow managed to find out. ¡°Of course. I woke up and then you weren¡¯t inside the hut. I couldn¡¯t even sense your mana. Where the hell did you go?¡± ¡®N-Nani!? She woke up early!?¡¯ ¡°I did! You must be proud!¡± ¡®How the hell did you read my mind!?!?¡¯ ¡­¡­A¡­Anyways, she¡¯s awake, and breakfast was ready now, so she pulled her up and went to the campfire in the centre of the village, where they would be having a small prayer before breakfast. She¡¯ll just tell about it later. The prayer was quite interesting actually, with the goblin elder reading what seemed to be a mantra of some sort before lighting the fire and offering several fruit slices into the fire. She¡¯ll ask the elder or Ilgua about it later. With the prayer done, breakfast comes! But¡­Well, everyone¡¯s eating the fruit slices just fine, but¡­how could she put it¡­there¡¯s just a feeling that¡¯s telling her to just ¡®f*ck no, throw it away¡¯ And looking more at it, the slice she picked up seemed to be cloaked in some sticky substance, like some sort of mucus or something. And the smell is¡­I won¡¯t explain it. It¡¯ll be good for your safety. Though¡­Anna¡¯s eating it just fine, so¡­it should be fine, right¡­? Well, here goes nothing! *Munch!* ¡­ ¡­¡­ ¡®B-B-BIIITTTTEERR!!!¡¯ Yes, it was horrendously bitter. Not only that, the sticky substance was sticking in her throat now, and¡­ugh, she almost felt like puking. ¡°A-Ah¡­¡± ¡°Oi, Diana? You okay?¡± Ah, and the world¡¯s spinning now. Her head was aching like hell, and it feels like there was a lump of flaming lava boiling in her throat. It wasn¡¯t very pleasant. ¡°A-Ah~¡­¡± ¡°O-Oi. Diana? You¡¯re¡­blushing.¡± No good, even her senses were getting mixed up now~¡­The pain¡¯s all gone, but in its place came an arousing aphrodisiac effect, and¡­It feels¡­really good~¡­ Her body unconsciously tipped and her head landed on Crystal¡¯s lap, who just happened to sit there beside her. Slowly, the world began to black out, until she finally fell unconscious. This seemed to cause much dismay and worry to Crystal and the rest, but deep inside, Crystal was secretly enjoying this. And, while she¡¯s unconscious now, deep in her mind, she made a vow. Before she eats something, ask what the hell it is. ¡­¡­¡­¡­¡­¡­¡­ 2 hours later, she finally woke up, To an intense headache that is. In her dazed and pained state, the goblin elder did his best to explain to her what the hell it was she just ate. Which proved to be quite difficult since she seemed like she would just drop dead if he wasn¡¯t watching her. The rest were also intently listening, just in case it was something serious, while Crystal¡¯s mind was in the clouds as she felt Diana¡¯s weak embrace. (Diana held onto her just for support) From what nearly seemed like gibberish to her, the fruit she ate was called the Obra Fruit, a mango-like shaped fruit that had dark purple skin and thorns growing around it. It¡¯s known for its ¡®exceptional¡¯ taste, which was a ¡®miracle¡¯ since a lot of the fruit grows in this forest, which the goblins could use as food. As for that mucus, it was only the ¡®juice¡¯ that would usually seep out from the fruit once cut. And as to why she collapsed¡­the goblin elder didn¡¯t know. He just shook his head and dismissed it as her tongue not being able to comprehend the ¡®amazing¡¯ taste or her nature as a slime queen. Anyways, after she managed to regain much more focus, she moved away from Crystal(earning her a soft whimper from said person) and began the serious talk. ¡­Or she would, but she almost felt like puking again, so she asked for some water. -Much H20 later- Alright, she¡¯s ready to inform the elder about what she found now. ¡°Umm¡­Elder?¡± ¡°Yes? What is it, Slime Queen?¡± ¡°Call me Diana damnit. Last night, I sent out a clone to guard the village we were sent by. At that time, a group of goblins did come into the village and take away several women.¡±Stolen story; please report. ¡°W-What!? But¡­none of us would dare to do such a thing¡­¡± And she guessed that¡¯s true as well, since, while it was dark, those goblins seemed to have a lighter shade of green for its skin colour, meaning that they weren¡¯t part of this forest¡¯s goblin tribes. ¡°T-T-Then, w-what about the women, M-Miss Diana?¡± ¡°Huh? Oh, they¡¯re fine.¡± Anna sighed in relief hearing that, probably guessing that she the one to save them or something. Diana also asked the goblin elder if he knew Gaz. He did not. But, with the talk done, and the pressing matters told, the goblin elder and several of his guard headed out into the forest to gather the other elders to talk over this problem, and maybe, hopefully, probably not, sniff out what group of goblins did this. And so, that left the MC and her friends with nothing to do. Or so she thought. For starters, Ilgua and Anna suddenly became good friends, and they were planning to go deeper into this forest to train further. Just in case they decide to pull a Zoro, she gave them a small slime dogoo to lead them back. Next, Rei was getting a bit hungry(as always), so she¡¯s out with other female goblins to search for more of that wonderfully ¡®tasty¡¯ fruit. She also gave her a small dogoo and warned her to NOT eat the fruit once taken. Not sure if she actually listened though. Which meant, ¡®I-I-I¡¯m alone with D-Diana!!¡¯ For some reason, Diana was suddenly getting chills, and a premonition for her to get the f*ck up and book it. Looking over to Crystal, who was fidgeting, looking overly eager to strike a conversation yet to embarrassed to do so was looking quite dangerous. She¡¯s a fan of tsunderes when done right, but this¡­this, borderlines on Yandereism!! Well, she¡¯s just pretty bad at socialising and expressing herself, but still¡­ Actually, an idea just popped up in her head. It sounds bad on paper, and is probably even worse in practice, but¡­meh, why the hell not, eh? You see, if you think about it, she hasn¡¯t actually gotten any ¡®true¡¯ sleep yet. Yes, she collapsed for two hours just moments ago, but that was her doing her best to avoid drowning in the Sanzu river, not sleeping. So- ¡°Crystal?¡± ¡°H-Huh!? Y-Yes?¡± ¡°Do you¡­mind if I sleep, on your lap?¡± At that moment, Crystal.exe stopped working. It was as she expected of course. After all, she wants to have more time to spend with her, while she needed some good time sleeping. Win-Win situation, am I right? ¡°N-No! Go ahead!¡± ¡°You¡¯re too eager. Okay, good night~¡­¡± And so, she took her chance! Meanwhile, inside Crystal¡¯s head: ¡®K-KyashessittingonmylapwhatamIsupposedtodoIwantedthisbutthisiswaytoofast!!¡¯ Wonder if anyone can even read that. Anyways, as you may very well see, her mind¡¯s an absolute jumbled mess right now. And, oh boy, does Diana love this! That, and she¡¯s comfortably asleep now. Crystal¡¯s lap was pleasantly soft to sleep on. ¡®Ah~, h-her hair¡¯s so soft¡­¡¯ She softly stroked her hair. Also, by the way, she was just fangirling on her. Nothing deeper is happening at this current moment. Nothing. And so, the morning peacefully passed by. ¡­¡­¡­¡­¡­¡­¡­ Meanwhile, somewhat far away from where Diana currently was, There stood a large and tall cliff, one that loomed above the grassy land below, the one that had the large and powerful kingdom of [Albion] standing atop it. [Albion] was a mercenary kingdom, meaning that it sides with someone as long as said side brings them enough payment to commit to their duties. Built out the remains of a fallen kingdom in the past, this kingdom¡¯s hierarchy was built in the same way as the wild. One who is strong looms over the weak, controls the weak, and gathers the strong. Such is the rule that [Albion]¡¯s king, Grazure the Third and his ancestors have enforced. But, such a rule shall become the kingdom¡¯s demise. Even now, as the pleasant sunlight washes down on the grass, a darkness, one that is bred from the darkness inside the hearts of man shall soon consume the land. Due to a curse once placed by him, once the kingdom is overrun by this ¡®darkness¡¯, ruin shall come to follow. Sadly, the king of the past was too prideful and arrogant to even take notice to his words as he left their kingdom behind. But, one man knew of this curse, and he will go to any lengths to destroy it. That was why he now had nearly a hundred virgin women, all tied and locked away in his cave. Such an offering should surely cleanse the kingdom of it¡¯s terrible curse. He had no proof of it, just an ancient scroll detailing a way to break curses, but he has put his trust into it, and by this point, there was no going back. Wherever this path leads him, he shall take it. So now, here he stood on this steep cliff, his figure hidden under his velvet coloured cloak, eyes staring at the kingdom below him. For he shall break this curse. No matter the cost. ¡­¡­¡­¡­¡­¡­¡­¡­ Lunch, ¡°*Gulp* Umm¡­What is¡­this?¡± Well, she came to expect that the things humans and goblins eat are severely different, but¡­still, what kind of an abomination of a hot pot stood before her¡­? It¡¯s terrifying! First, there seems to be some kind of meat in there, but it¡¯s grey, it¡¯s also glowing. Yes, GLOWING. The last time she ate something glowing she doubled in pain and almost died. Ha, how nostalgic. Next, there¡¯s something that looked familiar to this thing we call ¡®Broccoli¡¯, but, the hell? The stem is blue, and the flower cap is rainbow coloured. It looks like some kind of drug you¡¯d use to get hallucinations. And finally, there¡¯s¡­THAT. ¡°Huh? You don¡¯t know this, Miss Diana? It¡¯s a Gravon Heart.¡± Yeah. You heard that right. A HEART. You know, an ORGAN. Placed inside and boiling HOT POT. Like¡­what? First off, what¡¯s with that name? Does Gravon mean something? Where the hell did this come from. And why the hell was it put inside this hot pot? Questions, oh, so many questions, and no logical answer to greet her at the other side. And everyone¡¯s asking her to eat FIRST. Cause she¡¯s a Slime Queen and all. Gotta give priorities to the queen. ¡°W-Well¡­¡¯I-Itadakimasu¡¯. *Nom*¡± The one she picked out was the meat, cause the vegetables look deadly and that heart looks even deadlier. And¡­Well, it¡¯s a bit chewy, a bit hard to digest, but it¡¯s surprisingly goo- ¡°Mgh!?¡± Never mind, because once that thing hit her stomach, all painful hell broke loose in her digestive system. She dropped the wooden bowl she was carrying(which was luckily empty) and clutched her stomach. It¡¯s not as bad as breakfast, where she literally dropped unconscious in seconds, but the pain was intense!! She leaned in on Crystal for moral support, just in case she drops unconscious again. After she escaped the pain(somehow), she ran into one of the huts and silently cried, now knowing that the dream of going around and cooking fantasy foods like Toriko was as far as the stars. She also tried the other foods, and the same happened, although as he ate more the pain lessened and lessened. It still hurts like hell, but it¡¯s slowly diminishing in effect. Never mind her depression then! The dream still lives and shines like the sun! PRAISE THE SUN!! Anyways, she ended up getting interrogated by Ilgua though about the subject, since this was something he had never seen before. Heck, he even came up with several different theories that could possibly explain why this is. There were 3 she found most convincing though, First, it¡¯s probably because her body wasn¡¯t used to ingesting this kind of food. To begin with, she was a Slime Queen, and add in the fact that she was a person from another world, and the effect might have multiplied. Second, it¡¯s because many things in this world is infused with mana. Plants, dirt, caves, and food. They were all infused with mana. So, if that¡¯s the case, then maybe her body wasn¡¯t used to having mana being ingested inside her stomach. And third, a Slime Queen wasn¡¯t supposed to eat these kinds of things. Normally, a slime would digest something by corroding them and ingesting the nutrients, much like how she ki-¡­took out those bandits from before. She just hoped it wasn¡¯t the third theory, ¡®cause that¡¯d suck. Anyways, the problem still stands that she¡¯s hungry and she needs to fill her stomach somehow. After several more failed attempts at trying to eat the food, and she¡¯s definitely NOT touching that heart thingy, she just filled her stomach with some herbal tea the elder made her. And guess what? She even felt pain from that too! Not as bad as before mind you, but damn! It still hurts! Actually, now that she recalled, she didn¡¯t have any trouble eating her own cooking, or any of the food she ate at the kingdom, so why was she having trouble here? Wait¡­Ilgua did mention that most things had mana¡­ And¡­Diana¡¯s a slime. And a slime is weak to-! She got it! She told her newly formed theory to a rather excited looking Ilgua, and after some thought, he agreed! She, well, they had solved the mystery! See, as a slime, she was naturally weak to magic, or, at least high quantities of it being launched at her with the intent to kill her. That¡¯s why she¡¯s always so careful to not let herself get hit by magic in her slimy form. Here¡¯s how her theory goes: Maybe, just maybe, the mana in the food they were eating, the one that came from this forest that is, had a high mana quantity, which then led to her slimy nature being hurt! Haha! Diana¡¯s being smart again! ¡­Wait a sec, that still meant that- ¡°Ooh¡­sh*t.¡± She still couldn¡¯t eat anything in this forest anyways. ¡­¡­Well, f*ck. She¡¯s going to starve now. [42] It Begins Far North from where [Gazelle] stood, the proud kingdom of [Albion] raised its flag and planted its claim on the land. On the outside, one could claim that it was a prospering kingdom. The kingdom walls were well-maintained, the housings were plenty, many things could be bought from the local shops, many adventurers came in to sell their goods, and so on. But, of course, not everything is as it seems. You see, while the buildings looked like they were ripped straight from Skyrim and given a nice HD remake, as they say, the brighter the light, the darker the shadow. As such, many, many people had to live in the slums, at the far southern corner of the kingdom, living their lives teeth by teeth, their lives on stake as they battled to see the light of tomorrow. This was because of the principle that the very first kings had applied, and still to this day. ¡®The strong rule over the weak, and the weak grovel before the strong¡¯ Those were the exact words that had been passed down through, king by king, generation by generation. That also meant that many people in this kingdom were capable of fighting. Some more powerful than others, some more reckless than others. And so, in the centre of the kingdom, stood a large castle, and inside the throne room, sitting on his golden throne, the current king, Grazure the Third could be seen. A wide grin floated on his face as he chugged down another fine glass of wine. As the king, he was strong, the strongest of the kingdom in fact. And his body was sure to display such power. His figure towered over many, his height reaching near 2 and a half metres. His muscles were well toned, and his arms were massive. Everything about him just screamed strength. His hair was clean white, cut short as to not hinder his battles. His eyes were bright gold, his pupils were that of a dragon, sharp and piercing. Currently, his eyes were reading over the notes that his new assistant had compiled for him, still drinking from the glass of wine. They were about the funds of the kingdom, and the supplies that they were preparing for the upcoming war. Of course, [Albion] was not like any normal kingdoms. This kingdom stood proud as a mercenary kingdom, raising their flags of war only when another kingdom has sunk in enough money for them to make a move. Thankfully, everyone in this kingdom was a battle-maniac, him included. So this upcoming war only proved to excite the fighters even more. The only exception to this was his previous assistant and right hand man, who seemed eagerly negative about him and his kingdom going to war, babbling on about how something bad will surely happen or whatnot. He fired him straight after. ¡®Cowards and worrywarts like him need not to stand on this land.¡¯ He mused to himself as a maid was filling his glass with more wine for him to drink. But, on a side note, and also without anyone knowing this, he¡¯d taken quite an interest to something else as of late. Some time ago, at a relatively normal day, he felt it, a sudden wave of power, emanating from a distance away. It was unlike anything he had felt before. It felt wild, uncontrolled, yet soft and humble. After his scout returned from her observations, she relayed that an anomaly has suddenly appeared. He found it hard to believe her, but he knew that her sense of humour was as bland as an omelette with no seasonings. It was so dry, it¡¯ll probably put the Sahara desert to shame. Seen with her own eyes, she said that she saw a girl, an odd girl that is, who travelling with a spirit and a ghoul, somehow escape the withered forest, known to never allow anyone to escape from its borders. And what¡¯s even more interesting was that, the girl had slime powers. Now, normally he would just scoff at that and laugh, but she said that it had corrosive capabilities able to corrode human flesh away in seconds. Now THAT sure piqued his interest. His mind naturally went and thought, ¡®What if she became mine?¡¯ The effects would be amazing! She could cover the entire battlefield in her slime and corrode the enemy¡¯s soldiers away with a mere touch! It would turn his kingdom into the most powerful one on this continent! So, with the best of intentions, he sent his scout out with a slave collar, just in case she decided to battle her. But, now, it¡¯s been several days, and there has been no sign of her. No appearance, no sights, no letters, nothing. It was¡­slightly worrying, but he knew her to be patient, even if she didn¡¯t look so openly. And it wasn¡¯t like he could just storm out and find her, because that¡¯ll just incite panic and confusion in the public, so, want it or not, he¡¯s forced to stay in this kingdom. Little did he know that Paulena was currently naked, dirty, growling and wrestling a forest tiger on a puddle of mud. ¡­Anyways, he was beginning to feel slightly tipsy from all the wine he¡¯s been drinking, so he gave his empty glass back to the maid and sent her off into the kitchen. She bowed politely and went out the throne room. His back was also feeling a bit sore from all the sitting, and his eyes were definitely aching from reading the tiny words his assistant wrote on the notes. ¡®I¡¯ll consult it to him later.¡¯ He thought as rose from his throne and went out from the room. Looking at the setting sun, he guessed that it was about late afternoon by now, which meant that the guard training for the day was officially over. Which meant that he couldn¡¯t have fun watching and sparring with some fellow soldiers. He sighed as he leaned on the stone railings, looking down upon the expansive kingdom sitting below him. It¡¯s something he could pride himself with, seeing that he was now king of such a powerful kingdom. However, If perhaps he had looked more closely, he would¡¯ve noticed the dark clouds hanging overhead, the clouds thundering as lightning crackled within it. The omen of calamity. The time, if nigh. ¡­¡­¡­¡­¡­¡­¡­¡­ Meanwhile,You might be reading a stolen copy. Visit Royal Road for the authentic version. Back at the homely wooden cottage at the snowy peaks, Leo was meditating in the air, actually being serious for once. In fact, he wasn¡¯t just serious, he was tense. Afraid even. His fists were clutched and his shoulders were stiff from all the energy he¡¯s been putting into his clairvoyance. His eyes were currently closed, but if they were opened, then one would notice the golden shine in his eyes. It¡¯s been¡­not too sure, maybe, 200, 300 years? But, that matters not. Because he¡¯s finally back, and he¡¯s already making a mess. For one thing, he was a psychic, meaning that his instincts were top-notch quality. And when he woke up this afternoon, a feeling unlike any other surfaced in his mind. It was a foreign yet familiar feeling. Secondly, if someone would put a bit of effort and maybe squint their eyes, they¡¯d make out the dark clouds hanging in the sky. No, those were not thunder clouds. Well, technically, yes. They did have lighting bouncing around it like a ping pong ball, but that¡¯s no ordinary lightning cloud. It¡¯s vague, but he could sense traces of magic inside it. And finally, although many might not know this, but this mountain is special. It reacts to any occurrences, displayed with the harshness of the snowstorm outside. How¡¯s the snowstorm outside? None. There weren¡¯t any snowstorms. No avalanches. No blizzards. Nothing. It could probably be mistaken as a good thing, a blessing even for mountain climbers wanting to hike up a challenge. But this mountain was quiet. Too quiet. Now, the culprit was pretty damn obvious. It¡¯s not like he was trying to hide who he was in the first place. But finding his exact location was a tough ordeal. And add in the fact that he had the power to clone and split himself over multiple bodies, he¡¯s got one hell of an enemy to pick off. He would¡¯ve continued searching, but- *BOOOM!!* It seems like the enemy came to him. ¡°Hah¡­¡± Sighing softly, he got on his two feet and cancelled his clairvoyance, before he left through the door to see him standing there. He almost chuckled seeing him, nostalgic even. 2 or 3 centuries have gone by, and he¡¯s still the same guy. Short black hair, shining purple eyes, black shirt, black jeans, black trench coat. Hah¡­And it looks like his love for the colour black hasn¡¯t faded yet. ¡­Well, the slightly emo haircut was weird though. ¡°So~¡­Hello again¡­¡± ¡°I see you¡¯re still the same as always. Time has done you well.¡± ¡°Come on¡­Let¡¯s get this over with¡­¡± And so, the two clashed, the sounds of their battle shrouded in the cold misty wind. ¡­¡­¡­¡­¡­¡­¡­ Back at Tartarus, ¡°W-What is this feeling¡­?¡± Nestra was in the middle of another cleaning session, before a sudden sensation coursed through her. It was, terrifying, to put it lightly. It felt like her heart was being gripped and squeezed. She didn¡¯t know what the hell that was, where it came from, or what it meant. But she knew one thing for sure: Something bad was going to happen. Naturally, the first person her mind drifted to was her origin, Diana. From what she¡¯s felt, she just finished taking on the reaper and escaped, which was good. But, in comparison, the reaper felt like an infant facing up against a body-builder in his prime. There was hardly any competition. No, there was no way she¡¯s going to ignore this! Dropping everything she was doing, she turned around and ran for the operations room, leaving her fateful monster secretaries behind to fill in the work. After the 3 judges¡¯ deaths, she was elected as the new overseer of this dungeon, and so she did her best, throwing away the policies the judges had established and treated the monsters like actual living beings, instead of just tools. And as a new overseer, she had some pretty handy observation powers to help her see out into the future now, which was a nice bonus on top of being able to boss everyone around. Opening the stone doors, she ran up to the centre of the room, where a single pedestal stood, with a large white orb being held up on it. Which, if you¡¯d have guessed by now, was kinda like those orbs witches use to spy on people in cartoons. Placing her hands on the white surface, she closed her eyes and focused, as the orb shone a soft white hew. Magic surged from the ground, up into the orb, creeping through her body, and finally focusing on her eyes as she opened them. And there, she saw it. Dark clouds hanging overhead. Lightning crackling ominously. Shadows covering the lands, as darkness consumed the lands. The kingdom it had grown in was swallowed immediately, and the crawling void rose up into the air, as if returning somewhere. Just a mere look on it sent her shivers through her very being. She wanted to tell Diana and her friends about it, to warn them about this incoming danger. But, alas, she didn¡¯t have an iPhone to call her with, and neither did Diana have one. She cursed under her breath, knowing that she truly couldn¡¯t help her. And sadly, she couldn¡¯t even send a telepathic message to her. She¡¯d need Saiki¡¯s help for that. ¡­¡­¡­¡­¡­¡­¡­ Underground, hidden from the late afternoon sun, Gaz was sitting quietly at the corner of the room, watching as his ever expanding harem did their daily lives. Some were tending to the young or injured, some were going deeper into the caves in search for food, and some were chatting about. In the past, he had everything taken from him. And now, one could say that he¡¯s refilled that gap. But, none of that happiness was being shown on his face. No, not just that, he was also shaking, but lightly enough for no one to notice but himself. He didn¡¯t have [Danger Perception] like Diana did, but he could feel it, a presence quickly approaching, travelling here at insane speeds. And whatever was moving towards here, was strong, insanely so. Not saying he was weak, no, far from that. From the time he reincarnated as a baby goblin to now, he¡¯s grown immensely. But he¡¯d doubt his ¡®strength¡¯ would even faze the monster. More than anything however, he¡¯s worried about his harem of beautiful girls, and Diana too to some extent. While he hasn¡¯t met her for a while, heck, he¡¯s only seen her once, the fact that he was from Earth, and a frequent internet dweller at that, there was no way he¡¯s avoiding building a relationship with her. And also, from what he could see at least, his [Attract] skill didn¡¯t have a big impact on her, which was a nice change. You could say his main objective on her is to make her fall for him, but I digress. She¡¯s strong, he could tell as much, but would she stand against that thing? Whatever the answer may be, he couldn¡¯t leave this alone. If all humans and Diana perish before his might, it wouldn¡¯t be long until he finds them and kills them. And he¡¯s died once already, and death wasn¡¯t a pleasant experience. He flashed a small grin as he steeled his conviction. ¡­¡­¡­¡­¡­¡­ And finally, back at the goblin camp, Crystal and her fellow party members were intently listening to what the goblin elder had to say about the kidnappings. Turns out, yes, there had been times when the goblins would just disappear for a night or two, only to return back to where they were without any recollection of what happened. Which Diana said to be odd, since she didn¡¯t notice any pure-blooded goblins in the ¡®recent¡¯ kidnapping. She also further explained that the number of women being kidnapped had been reduced due to the effort of a black-skinned ogre called Gaz. After that confirmation, the goblin elder began talking about several of his theories together with Ilgua, along with issuing some commands to the nearby goblins to stay alert, just in case something like this happens to one of the fellow goblins in this tribe. Oddly though, half way through his talk, Diana fell silent, eerily so. She could¡¯ve mistaken her as an inanimate doll if not for her subtle breaths. She wanted to ask about it, but she was still listening to the goblin elder, and cutting it would just make the situation awkward, so she held herself back. After about 30 minutes, the discussion finally ends, and everyone separates to do their own thing. The goblins were readying dinner, Rei wanted to go back to sleep for a bit, and Anna and Ilgua went out into the forest to train again. But, Diana only stayed there, petrified. ¡°Oi. Diana? You okay?¡± No response. She didn¡¯t even bat an eye to her. Normally, she would¡¯ve been annoyed to be ignored like this, but¡­this was Diana she was dealing with here. And as they got more intimate with each other, it became harder and harder to truly be mad at her. Still¡­this silence wasn¡¯t like her. She wasn¡¯t even pale or anything, which meant that she wasn¡¯t sad about something. She just looked¡­worried. ¡°Dia-¡° And then, she felt it. A presence far stronger and bigger than anything she had ever felt. It was still quite far away, she could somehow tell, but even then, her hair was standing on their ends. Easy to say, it was terrifying. ¡®I-Is this what Diana¡¯s feeling¡­?¡¯ She managed to ask herself as she turned around to see Rei, who was also visibly terrified for once, quite unlike her. She seemed quite sleepy after the discussion, but none of that could be found any longer, especially not after this. Looking around, the other goblins seemed to not notice this, which could be both a good and bad thing. After all, as they say: Ignorance is Bliss¡­sometimes. A tense silence floated around the big trio, their thoughts still preoccupied with this incoming calamity. ¡°G-Guys¡­?¡± Until Diana became the first to break the ice that is, asking the two with a shaky soft voice. ¡°Y-Yeah?¡± ¡°I¡­D-Do you mind, f-following me a-after dinner¡­?¡± The two looked at each other, before they turned back to her and nodded with resolution. Diana managed a weak smile on her face before she turned back to the fire, watching as its last embers faded into the air. Soon, the beginning to calamity will come. [43] Confrontation ¡°Come on¡­Let¡¯s get this over with¡­¡± As the setting sun painted the sky in a gradient of colours, Leo¡¯s soft voice echoed out through the chilly mountain as his eyes glazed over the enemy standing before him. The two were floating in the air, both making simple eye contact to observe an opening to make use of. The silence floating around them was painful, crushing even. The only noise that was made was that of the blowing snowy wind, and even then, even the wind itself seemed to retreat in the presence of these two fighters. ¡°My, my. I didn¡¯t know you were so impatient, especially knowing what you are.¡± He didn¡¯t reply to that, and simply floated in the air, contemplating his moves as he kept a vigilant watch at his enemy. Or, he tried at least, because he disappeared straight after. ¡°[Impudent Surge]¡± Then, he suddenly reappeared besides him, his hand firmly pressing into his hips before a raging darkness blew out into Leo, engulfing him. Not that it mattered much, since Leo knew beforehand and teleported as quickly as he could, appearing metres away from him, their eyes still locked onto each other as his enemy simply shrugged his shoulders, regretting that his first hit bonus was a miss. And then, an avalanche came tumbling behind him and crushed him. The man simply punched his way out of the snow and jumped out, dusting off the small bits of snow sticking to his black clothing. ¡°Still good as ever I see.¡± ¡°¡­Whatever¡­¡± Well, while it might be slightly tough at first, this was only one of his clones, so it shouldn¡¯t pose much of a problem. He thought jokingly, because he knew that was likely not the case. He may be a psychic, but this guy was beyond even his perceptions. ¡°Careful now. Don¡¯t go daydreaming.¡± ¡°!?¡± He was too late to react, as his incoming fist collided with his stomach, sending him crashing into the snowy terrain. He countered back by sending waves of snow towards him using his telekinesis. He easily dodged. To be exact, he did dodge the snow, but a sudden comet from the sky hit him and sent him crashing down the mountain with a spectacular fiery explosion. Not letting up, seeing the man trapped in the snow, he hardened the snow around him to restrict movement and sent a volley of quick fire comets onto his unmoving body, causing explosions after explosions. ¡®The ice phoenix will be pissed~¡­¡¯ He continued attacking, firing boulders, shooting air bullets, applying crushing pressure onto him, sending in another package of exploding comets, using his powers to rip- ¡°[Phantom Blade]¡± ¡°Gah!?¡± A sudden incoming [Phantom Blade] stabbed through his chest. He was lucky to move slightly to avoid injuring his heart, but¡­it, it still hurts. His red blood spilling out violently as he did his best to heal and calm his wound. And to add salt to his injury, the man simply appeared there, without any wounds no less. ¡°Have these years made you dull, my old friend?¡± ¡°O-Old f-friend¡­a¡­aha¡­yeah, r-right¡­guhah¡­¡± He spat back as he finally pulled out the magical blade from his chest, his wound quickly healing back up. ¡°Oho? Do you perhaps think me as more of a friend?¡± ¡®Might as well¡­¡¯ He thought as he raised his left hand into the air and chanted, ¡°[Sacred Treasure: Aurora]¡± A surge of golden magical energy erupted from his body and surrounded his left arm, before it started to harden and crysta- ¡°As if I¡¯d let you finish.¡± He appeared besides him and punched him down into the mountain. ¡­Except, he didn¡¯t, as his left arm, now equipped with a powerful golden gauntlet, moved in to block his attack, and even repel some of the force back to him, sending him flying back instead! Well, no matter. Such an increase in power would never be enough to truly shake him. And besides, he had a trick of his own, but using it would be no fun, not until Leo truly goes out that is. ¡°[Dawn]¡± It was the first named spell that Leo used in this fight, and keeping true to its name, a bright light appeared, melting anything in a close proximity to it. Snow, rocks, trees, even some of the monsters in the area, all of them quickly began to melt. It was as if a second sun had arrived in the midst of the dark night. The man too felt this, just to an incredibly low extent. The only thing he felt was the nice warmth it gave out. The chilly atmosphere of this place sure has made him want a nice cozy place to stay in. And that¡¯s exactly what Leo wanted. ¡°Take this.¡± He quickly closed the gap between them and blew a hole straight through the man¡¯s chest. But, it wasn¡¯t enough. Something like shooting him through the heart won¡¯t be enough to kill him. After all, this man was a monster, and this being standing before him was only a mere fragment of his true power. The real one was somewhere else, watching. He could worry about the real one later though. For now, he should really focus, because now that he¡¯s done some visible damage, and seen that no blood or, anything really, came out from the gaping wound in his chest, Round two, will begin. ¡°I¡¯m¡­ra¡­ther sur¡­prised.¡± The man said, his voice now sounding broken and stilted. His eyes were moving around rapidly and his body was convulsing. ¡°PrEpaRIng FIrE. COnNectIOn LosT. InItiaTInG AutO-BaTtLe.¡± After all, this man was just a clone. Once his main core, I.E his ¡®heart¡¯, has been destroyed, the clone activated auto-pilot mode, which, much to his discontent, even worse to fight than the real deal. ¡°Kuh!?¡± The man¡¯s movement became erratic, which was why his sudden rush towards him with his fists ready surprised him. He quickly brought up his left arm to guard, but his leg came and hit him, sending him crashing into a thick pillow of snow, cushioning his impact. The man quickly rushed in to approach him again, just like a robot would. Sadly, it was just that, a robot. And once you know how it¡¯s AI works, it becomes easily destroyed. ¡°[Dawn]¡± Once again, a strong light shined from his hands, melting anything that comes even anywhere close to him. And since the man was the closest to his hands, the melting process on him was the strongest, melting him away in a puddle of magical energy.This narrative has been purloined without the author''s approval. Report any appearances on Amazon. Sighing softly, he lied his head back down into the snow. It was¡­although he hated to say it, a fun fight. It¡¯s been a while since he even put any effort to a battle. That was just how strong Leo is. And¡­Well, although that clone wasn¡¯t nearly enough to his peak, it was a good warm u- ¡°¡°¡°I see you¡¯re still the same as always. Time has done you well.¡±¡±¡± ¡°Oh god¡­¡± He almost despaired as he looked up to the sky, seeing 5 other clones of the man floating above him, repeating the same exact words as the first clone. ¡°Damnit¡­Oldruin.¡± It¡¯s been a while since he called the man by his name, and he could just picture the real Oldruin sitting on his throne, mildly blushing as he heard him call his name. He did have a crush on Leo after all. ¡­He¡¯s not gay by the way. ¡­¡­No, seriously, Oldruin ain¡¯t gay. Since Leo¡¯s both a guy and a girl, so it¡¯s fine in his book¡­or something like that. T-To be more exact, Leo can change his gender on will. He mostly sticks to being a guy though, since it¡¯s easier to talk that way. But, interests aside, standing up from the snowy bed, he clenched his fists and continued to fight! ¡­¡­¡­¡­¡­¡­¡­ Some time later, It was night now, and as such, the sun had dipped far beyond the horizon, painting the sky in a starry black canvas. The stars twinkled lightly as the moon slowly rose into the sky, far outshining any nearby stars. Back at the goblin camp, after everyone(except Diana) had dinner, they all went their separate ways. The goblin went out to do their own thing, Anna was exhausted from Ilgua¡¯s intensive training and was passed out inside a hut, and Ilgua was¡­somewhere. Diana, Rei, and Crystal on the other hand, were sneaking their way out of the forest, to watch if any goblin attacks would occur this night. After the feeling they¡¯ve felt, and the fact that even the usually stoic and emotionless Rei was vividly terrified, there was no way they could stay put. But¡­well, they did try to sneak out, but¡­ ¡°Where might you be going?¡± Just as they were about to leave the forest, there he was, casually leaning his back on one of the trees, seemingly knowing that they would come this way. ¡°W-Well-¡° ¡°The village I suppose? To watch the goblins again?¡± He asked with a stern voice, much unlike his usual meek demeanour. It was¡­odd, but no one seemed overly suspicious, so she shrugged the thought away. ¡°I¡¯ll take your silence as a yes.¡± ¡°Y-Yeah.¡± Was he going to ask them to go back no-, no, wait. For some reason she had a feeling of where this was going to go. If she¡¯s right, then- ¡°Take me with you.¡± ¡®Bingo!¡¯ She shouted inwardly. It¡¯s almost a clich¨¦ at this point, but she¡¯s not complaining! More hands, the better! With approval, she allowed Ilgua to join them and left to watch the village. Half-way through the journey, they met up with Gaz, who had readily stationed himself at his usual spot to take out any incoming goblins. She also asked if he wanted to join, and after hearing the plan, he obviously said yes. And Ilgua¡¯s not fanboying over Gaz, which felt¡­unsettling. Or maybe it¡¯s just her. Who knows. Anyways, with this new party assembled, the five went and watched the village from afar. Since it was night time, hardly any of the villagers were outside, and those that were looked to be drunkards or idiots. An hour went by, then two, then she almost dozed off, Crystal already fell asleep from boredom, until finally- It happened. A swarm of goblins, coming from all four directions, rushed into the village and attacked, kidnapping as many women as they could. Because it was night, hardly any of them anticipated having their doors kicked down and their women stolen so suddenly. They were unable to put up a fight. And those that did, got injured, some light, some heavy, and some even¡­died. She could feel herself paling already, as if all the ¡®blood¡¯ in her veins just suddenly left her body. Seeing murder before her eyes, even if she wasn¡¯t the culprit, will always be unpleasant it seems. With 4 more women kidnapped, the goblins began to retreat from the village, making use of the chaos to make their escape. Which puzzled Ilgua greatly, since goblins are known to be stubborn, especially went it comes to fighting. Following them from afar, the group tailed the goblins, making sure to not be spotted as the goblins made their moves. Until finally, they stopped. And the area they stopped at was¡­creepy, to say it lightly. They stopped at the edge of a steep cliff, and at the very edge of it, there was a large stone altar, somehow not falling over the edge, as if it was floating. And then, the next scene shocked them. The goblins stood atop the altar, held the women over the edge, and then dropped them. Their terrified screams echoed through the lands as they met their untimely deaths, their body crashing down against the hard dirt below. ¡­Or so it seemed, but there came no sound. No crash, no wind, nothing. Just, silence. It¡¯s still safe to assume that they were dead, but¡­what was this uneasy feeling in her heart? After their task was done, the goblin simply committed suicide and leapt off the cliff. But, back on track. As former residents of Earth, both Diana and Gaz were obviously angered and shocked by this, but they both managed to stop themselves. Luckily, she didn¡¯t exactly know if they died or not, but¡­well, that kinda makes it worse, doesn¡¯t it? ¡°Kuh, just 1 more¡­1 more¡­¡± Then, a cloaked figure emerged out from the darkness, seemingly out of nowhere. Guessing from the voice, it seems to be a he, and an old one at that. His voice was croaky and ratchet, as if he hasn¡¯t drunk any water for 3 years or something. If she had to take a guess, there was still a need of two more ¡®sacrifices¡¯ until whatever that bastard was doing will come to fruition. And, oh hell, was she going to stop that. Now, all she needed to do was wait for the right moment and- ¡°OI! YOU SICKILY BASTARD! THE F*CK DID YOU DO TO THOSE GIRLS!?¡± ¡­Never mind. Like a pot finally bursting open, Gaz¡¯s anger couldn¡¯t be contained any longer and he jumped out of cover, shouting at him while making a familiar pose to a certain quite terrible lawyer in a blue suit. ¡°¡­¡­Huh?¡± And the old dude turned around and was just, like, ¡®¡­whaaaat?¡¯ Even if his facial expression was covered by his cloak, she could just tell. ¡°I have to ask the same thing.¡± The next to come out was Ilgua, speaking in a calm and confident manner, his magical sword already in his hands. Next came Rei, who was power faced, then Crystal, and finally, Diana was the last. With this, the five stood before him, ready to attack. ¡®¡­But¡­¡¯ Well¡­ He looked, dangerous, and creepy as hell. He¡¯d probably make a really good stalker in a movie. But¡­he just doesn¡¯t seem all that¡­threatening, if that¡¯s even the correct word. And her [Danger Perception] wasn¡¯t ringing loudly either, which meant that there wasn¡¯t any bloodlust coming from him...Well, yet, anyways. Oh-, also, her [Danger Perception] levelled up, so she¡¯s certain of it! ¡°Now, speak, criminal.¡± Ilgua demanded, his eyes gleaming in the dark of night. It looked pretty damn cool, if Diana had to say. ¡°Please understand, young man, I¡¯m doing this for the better-¡° ¡°WHAT OF THIS IS GOOD, HUH!? YOU¡¯RE KILLING WOMEN!!¡± ¡®Ooh, shit¡­he¡¯s piiised¡­¡¯ She unconsciously took a step back. She¡¯s not an angry type, and she¡¯s terrible at dealing with angry people. Well, all that anger was justifiable though. He did just see innocent girls pretty much get dropped to their deaths. Gaz, not being able to see this crime for any longer, readied his fists and was about to strike, but then- ¡°W-Wait, Gaz, uh, l-let him speak first.¡± He felt Diana¡¯s hand grip his tightly. It wasn¡¯t the strength one would expect from a feminine hand like hers, which did came to shock him at first, but it was quickly overshadowed by the raging anger in his heart. ¡°Huh!? The f*ck!? He¡¯s the bad guy! He made those goblins kill them like it was nothing!¡± ¡°Y-Yeah, but¡­¡± -I don¡¯t want to kill him either. Was what she wanted to say to him, but the words got stuck in her throat. Killing was bad, yes, that¡¯s obviously true. But if they went in, their bloodlust gushing out to kill him, would that make them any better? ¡°Gaz, let her go.¡± Thankfully, as Gaz¡¯s grip started to tighten, Ilgua¡¯s hand came to free hers. ¡°Oi, don¡¯t tell me you¡¯re also-¡° ¡°She asked him to speak. So shut up.¡± Gaz froze over after that. With a bitter feeling, he withdrew his hand. He might be a reincarnator and a powerful ogre, but even he knew not to mess with someone with those eyes. Hell, just staring at it feels like his soul was being watched. ¡°Now, speak.¡± ¡°¡­Ahem, very well. As you have seen, I have trapped those women by-¡° ¡°Skip that.¡± ¡°¡­Alright. Years ago, when this country of [Albion] was first established, a man- ¡®[Albion!?]¡¯ At that exact moment, her willingness to hear the reason to save this country just took a nose dive. I mean, like, the king of [Albion], Grasure or something, sent someone to kidnap and make her a slave. As if she¡¯d let someone like that roam loose in this world! ¡°-that goes by the name Oldruin came to visit. He requested to have an audience with the current king, but arrogant as he was, he drove him away and spat at him. Seeing this behaviour, he cursed this kingdom, so that darkness of people¡¯s hearts shall slowly build until it consumed it all.¡± ¡°And where¡¯s this ¡®darkness¡¯ you speak of?¡± ¡°Take a look yourself.¡± The man simply pointed down the cliff, where there they could see a large kingdom. It was well-built, fortified, but if she squinted a bit, she could see something rising out, something black and¡­gooey. Yuck. ¡°To break this curse, in the past, there existed a ritual, where, by trapping and sacarficing 100 women, and gathering their residual souls, a spell could be invoked that will break the curse.¡± ¡°T-That means-!¡± If she was counting right, he needed 100 women, and earlier he said that he needed only 2 more, which meant that¡­he¡¯d already trapped¡­99 women. ¡°You bastard! They were innocent!¡± Gaz would have splattered his head all over the floor by this point, but Ilgua¡¯s constant watch was keeping him still. But even Ilgua looked disgusted by this man. And¡­she couldn¡¯t deny that she didn¡¯t feel the same, but¡­by killing 100 women, thousands upon thousands of innocent unknowing lives of the kingdom would be saved. But, if that gooey black energy was representative of the citizen¡¯s hearts, then they would need to be pretty damn corrupt and sinful to generate that much darkness. That means that those citizens weren¡¯t exactly innocent either. So, there goes the question: Kill this man to save 99 innocent lives, but let thousands die to that consuming darkness. Or let him sacrifice 1 more life to save sinful thousands? She had to choose, and time was running out. [44] Did She Just Die Again? ¡°¡°¡°I see you¡¯re still the same as always. Time has done you well.¡±¡±¡± ¡°Oh my god¡­¡± It¡¯s night now. The sun¡¯s sleeping, the stars were blinking, and the moon was on full-spotlight. The starry sky looked particularly beautiful with the aurora coursing through it, accompanied with the soft howls of the chilly winds. Atop the snowy mountain, where the sounds of explosions and crashing meteors were heard, Leo was sitting down on a pile of snow, his eyes looking up in despair as he saw ANOTHER batch of Oldruin clones coming to ruin his day. ¡­Well, it¡¯s her day now. You see, Leo¡¯s original form was female, so after she began to run out of mana, she had no choice but to revert back to this form, which felt¡­odd, since he hasn¡¯t used this female form in like¡­100, 200 years? Not sure, she lost count. As she could change her appearance however she wanted, the female form she¡¯s taken is that of a young girl, since moving was much easier and all. Her cute long white hair was neatly tied into a ponytail. Back on track, while she was cursing to the gods for the absolute torture she was being put through, she knew full well that Oldruin wouldn¡¯t go out of his way to kill her. He liked her after all. Just, now that her hands were tied, countless lives were in danger against the other clones he probably sent off, and she couldn¡¯t do sh*t to stop them. Honestly, the bed of snow she was sitting on felt very tempting to sleep on. And if she wasn¡¯t careful, she would probably fall asleep then and there. She¡¯s been fighting for hours now, so the fatigue was kinda a big deal, yeah? *BOOOOOOOOOOMMM!!!!!!!* She sighed as she watched the sky light up, as another volley of incoming meteors struck down onto the clones, decimating them completely, leaving behind a nice trail of dust and smoke, along with a very tired Leo. But then, things took a turn¡­for the better? ¡°Hello there Laila, or should I say, ¡®Leo¡¯.¡± ¡°¡­¡­Oldruin.¡± Suddenly, the space above her warped, and the real Oldruin emerged out of the darkness. Unlike the clones, the actual Oldruin didn¡¯t have a slightly emo hairstyle, which was a blessing, because it was kinda painful to look at. On one hand, she was relieved that the real Oldruin was here, so the massive kingdoms should be safe. But on the other hand, while his clones didn¡¯t even have 1% of his true power, they were still strong enough to flatten a fragile kingdom in a single flash. That, and she¡¯s somewhat scared, and excited, as to what he¡¯s planning to do. ¡°So¡­what do you want?¡± Her eyes shone a golden hue, but unlike the usual, it was a soft golden shine, not the sharp and piercing glare. Even if she hated it to some aspects, he was an old friend of hers, and there was some happiness to seeing him again. ¡°My? Is it such a crime to visit the one I love?¡± ¡°¡­¡­Not really.¡± Oldruin slowly made his way over, and sat besides her on the same pile of snow, looking up to enjoy the nice starry scenery. ¡°¡­Are you planning to ¡®clean up¡¯ humanity again?¡± ¡°That is my mission.¡± He said so with confidence, his will to accomplish it still unwavering over the many decades that had passed by. He smiled, watching the stars pass by, reminding him of some of the travels he and his friends used to do. And somehow¡­that simple adventure of theirs bloated in¡­this. The nostalgia was enough to make him cry. Not that he will of course. He promised he never will. ¡°Will you help me?¡± Oldruin abruptly asked, inciting a long silence from Leo, or Laila I should say. After all, one of the reasons he was doing this was for her. Laila looked down, somewhat seriously debating whether she should take the offer. Well, the obvious answer was, hell no. But¡­well, for one, the reason he¡¯s doing this was so true that it actually sounded like a good idea, and second, she¡¯ll be with¡­never mind. A light blush appeared on her soft cheeks before she looked up to him and answered with the obvious, ¡°No.¡± ¡°I see.¡± There was a look of disappointment in his face before he smiled and placed his hand on her head, just like he used to. Her faint blush continued to brighten. ¡­¡­¡­¡­¡­¡­¡­ Kill this man to save 99 innocent lives, but let thousands die to that consuming darkness. Or let him sacrifice 1 more life to save sinful thousands? She had to choose, and time was running out. ¡­Or, well, Diana had to choose, but¡­ ¡°Ngu¡­?¡± Last she recalled, she was standing atop that cliff together with her friends, getting ready to face off against that cloaked guy, and she-¡­she¡­huh? ¡°W-What!?¡± It was like a jolt of electricity, the sudden realisation dawning quickly. She bolted upwards, mostly not noticing the massive strikes of pain that was coming from her abdomen, where her ¡®blood¡¯ was fiercely flowing out. But more than that, looking around, there was no cliff, no kingdom, nothing. In fact, no sky, no moon, no stars, no grass. Just¡­pure white. She tried to remember, she tried her hardest, but no matter how much RAM she was forcing her brain to use, she couldn¡¯t remember anything past that moment.Support the creativity of authors by visiting the original site for this novel and more. This was worrying. What happened to her? Where was this place? Where were her friends? What happened to that cloaked guy? Questions after questions flooded into her mind, too many for her to answer rationally. ¡®W-Where¡¯s-?!...Where¡¯s¡­huh?¡¯ Okay~, this was¡­extremely worrying. Who¡­Who were her friends again? Did she even have friends? She couldn¡¯t remember. Or maybe they didn¡¯t exist at all? Or was she the one that didn¡¯t exist? It was all so confusing. It was also then she noticed something, right next to her feet. It was an orb, clear and pristine, with the colours of a rainbow shining inside it. Picking it up, it felt light and smooth, like glass, yet hard and durable, like steel. It¡¯s kinda like the Iris Gems from Zestiria. She tapped on it once, and then twice, and then thrice, and then however many times she tapped it until she realised it¡¯s not going to break from mere taps. ¡°Hmm¡­?¡± Thinking more about it, wouldn¡¯t it be a plausible idea for this orb thingy to be made of Crystal? That would explain the traits, but what about the colours inside? Ooh, so many questions and still no answers¡­ ¡­Wait. Crystal? ¡®Crystal!¡¯ Then, she remembered, the magic enthusiast with a slight ¡®sisterly¡¯ love on Diana, the one who loved to talk to her but just couldn¡¯t find the time and courage to do so! Yes, the beautiful girl with tsundere qualities! Crystal! It was like a door being opened, the memories of her flooded in like an unrestrained current. From the moment where she practically dragged her out of her house, to her spending her time sleeping on her lap. Ah~, just recalling such things were making her warm inside. But even then, no memories of what happened to her. ¡°¡­Huh?¡± And by the time she noticed, no longer was she standing in a world of pure whiteness. Instead, she now stood in a world of pure whiteness, WITH a gigantic tree standing in the centre of it all. Actually, this place felt oddly familiar to her. She wondered why, but she¡¯ll save that for later, because- *Oh! Diana! You¡¯re finally back!* ¡°Hiya!? A-A sign!?¡± When she noticed, a wooden sign was suddenly there before her, with those words written on it. As a rational person, she jumped back and shrieked in surprise, which was natural. But she felt kinda bad, for some reason. *¡­You don¡¯t remember me? Sig. Ring any bells?¡± ¡°Uuuhh¡­No? Why would I know a sign? W-Wait, how are you even responding to me?¡± It was almost like a dream. The words on the sign disappeared and rearranged themselves into another sentence. Scary, but intriguing. Sig took a moment to ¡®ponder?¡¯, before it turned to the right and displayed an arrow towards the large tree growing in the centre of this blankness. There wasn¡¯t a need to follow, but¡­Hell, why not? And so she walked, and walked¡­and walked¡­and, was the distance between her and the tree getting bigger? *Hmm¡­This is a problem¡­* ¡°Huah!? S-Say something when you¡¯re going to appear! And what¡¯s your deal anyways!?¡± *¡­¡­Hah¡­If only you still remember¡­* ¡°Uh? Like, I am trying to remember, but what¡¯s to remember anyways? What the hell are you anyways? Am I dreaming?¡± The sign didn¡¯t answer and merely pointed her in the direction of the tree. She pouted in annoyance before continuing her walk towards it, which, this time, the distance wasn¡¯t widening, so that¡¯s good! But, once he actually got close, things were¡­not as they seemed from afar. ¡°W-Wha¡­?¡± In a single look, any normal person would realise that the tree wasn¡¯t healthy, or even dying. The large roots were pale looking, the leaves were falling off, and most of the wood it had was crippling off. Even now, small chips of it was falling off the tree like a skin being shed. *You see that? Remember anything new?* ¡°No, no I don¡¯t¡­And, holy sh*t, you¡¯re floating!?¡± *¡­Hah¡­Just, imagine a chainsaw or something and cut open a path to the middle of the tree. Something inside should help you remember.* ¡°A¡­chain¡­saw? What¡¯s that? Sounds cool!¡± By this point, Sig ¡®recoiled?¡¯ back in ¡®shock?¡¯. It sure knew that Diana wasn¡¯t in the best condition right now, in fact, it¡¯s rather surprising she hasn¡¯t noticed that wound on her stomach, and her memories are all over the place, but seriously!? *It¡¯s a tool from your previous life. It looks like this, *Shows picture*. You pull that string to activate it* ¡°Woah¡­That sounds awesome! And previous life? What does it mean?¡± And just like that, once the image got into her head, bam! The chainsaw suddenly appeared in her hand. The slick design with an orange-coloured casing, easy to say, it looked like one hell of a tool. Could probably kill someone in seconds! ¡°And¡­cut!¡± *Vrroooomm!!!* In a single pull of the string, the chainsaw bursts into life! And just as instructed, she slowly carved a path, big enough for her to fit in, towards the centre of this ginormous tree. ¡°Hey, uh, so-, woah, you¡¯re floating in the air!-, I mean, what¡¯s inside this tree anyways?¡± *I¡¯m not too sure. But it should help to clear some things up¡­Or that¡¯s what I believe at least* ¡°You don¡¯t seem too sure.¡± -I¡¯m not. I¡¯m you after all. Was what Sig wanted to say, but there¡¯s a feeling that doing so might cause some problems, and Sig¡¯s ¡®gut?¡¯ feeling was usually spot on. ¡°Aaaaannndd¡­¡­Done! Alright! Ooh~? What¡¯s this? A secret entrance perhaps!?¡± Once Diana finished carving her way to the centre, her path opened up, and she saw a small room in the centre of the tree, with another one of those rainbow shining orbs floating in mid-air. *Hey. Diana. Tap the orb you have earlier onto that one.* ¡°Huh? Uh, sure?¡± Oddly, a feeling of tension could be felt from those words as she read over the sign. If Sig¡¯s right, then tapping the orb in her hand with that floating orb should bring back her memories, right? Could there have been something really bad that remembering them might be terrible? Well, what¡¯s stopping her at this point? She¡¯s been wanting to get her memories back, and whatever sh*t¡¯s gone down in her life it¡¯s her duty to take that into her responsibility! ¡­Woah, that sounded oddly wise. Anyways, with determination in her eyes, she brought the orb in her hand towards the floating orb, and tapped them together. Then- ¡°Urk!?¡± It all came flooding in. All her memories about her past life on Earth, the day she arrived, her ¡®reincarnation¡¯, and her stand against that hooded man. Everything. Even all the pain she sustained from day one ¡®til now. Everything. ¡°Ah¡­Agh¡­!?¡± And all of that, was compressed, into a mere span of 5 seconds. It was unbearable. The pain, the emotions, they all smacked into her skull like a fighter jet crashing into her head. It was very unpleasant, so much so she could¡¯ve probably fainted if it wasn¡¯t for her focus. But all that recalling also meant she finally managed to shed some light into the battle. And, oh boy¡­she, REALLY wasn¡¯t expecting to see what she did. Okay, basically, she was still deciding on which side to pick, but her friend Gaz there already picked his answer and rushed in, soon followed by a quite angered and serious Ilgua. With no choice, she followed them, with Rei and Crystal by her side. She didn¡¯t notice it at first, but all the while they were clashing, the man in the cloak was constantly smiling at her, Diana I mean. It was then, under the cover of the night, a stray magic bullet turned its course and went directly for her stomach. Her [Danger Perception] rang like crazy, but she was too late to react, and she received a good blow on her stomach. Her ¡®blood¡¯ splashed into the air, which seemed to have caused a moment of shock for the cloaked man, but he made haste and grabbed her. Crystal, Gaz, and Ilgua all screamed for her name, and Rei quickly rushed in to close the gap between him and the man. But alas, they were all too late. The cloaked man spoke a chant with astounding speed, before he used ¡®something¡¯ to paralyse Diana¡¯s movements and dropped her down the cliff. All beyond that point is a blur. ¡°¡­Wait, but, doesn¡¯t that mean that I-¡° *Yes. You died.* ¡°¡­¡­¡­Huh.¡± *¡­You sound rather calm about it.* ¡°Yeah. I guess I am. Wonder why?¡± Perhaps it was because she¡¯s died once already. It sounded like the most plausible answer, but she doubted that¡¯d be the case. Actually, thinking more about it, if she did actually die, it meant that thousands of lives, innocent or sinful, have been saved due to her being a sacrifice, yeah? Maybe that¡¯s why she felt so at peace, because her death actually meant something. ¡®Woah, that¡¯s deep.¡¯ She chuckled to herself, her body now feeling the pain from the wound on her stomach. Aside from the fleety feeling and the oddly warm feeling, guess death hasn¡¯t changed much from last time, huh? Stuck in a room of white(usually), with your old memories striking back to haunt you, over and over. Heh, history repeats itself. ¡­Although, it¡¯s odd. Her [Danger Perception] flared like crazy when she was about to get hit by that magic bullet, but when she was falling to her doom, it went silent. Isn¡¯t that oddly peculiar? And back when she died for the first time, didn¡¯t all her injuries from her squash get healed? Why did she still have her wounds this time? And the pain¡¯s even there. ¡°Hmm¡­¡± Well, whatever the case, she¡¯ll just say she¡¯s dead for now. And while she¡¯s here, might as well continue that save of that game from last time! Now that she¡¯s here, she¡¯s safe from all the worldly troubles, so time to play! ¡­Or maybe that¡¯s just a distraction from facing reality. Who knows? [45] To Save Diana!...Again. ¡°DIANA!!!¡± Gaz screamed as loudly as he could, but voice alone would not bring what has vanished. It all happened so fast. Too fast. Just as they were getting ready to defend from what they thought was a massive attack, a stray bullet suddenly changed course and struck Diana in the stomach, knocking her down. And then, with speed you wouldn¡¯t expect from a man like that, the cloaked man rushed in, grabbed Diana by the side, and threw her off the cliff, and into that ¡®prison¡¯ where he keeps his maidens. As a human and a former human, Ilgua and Gaz were angered, very, very, angered. They didn¡¯t know her for a while, but a comrade that genuine in this world was a rare find. It¡¯d strike anyone¡¯s heart strings to see someone like that die. Crystal and Rei felt like that too, to some extent. They were just¡­much quieter about it. But, something was bugging Crystal. Setting aside the fact that her best friend was pretty much killed before her eyes, all of that happened way too fast. From the moment that battle begun, the speed that he went at far surpassed any she¡¯s known. ¡®Unless¡­¡¯ ¡­¡­¡­¡­¡­ Just 15 seconds ago, ¡°HaaaaAAAAA!!! [Dragon¡¯s Howl]!!¡± Gaz was first to strike, rushing in and punching his fist straight towards him, sending a powerful shockwave at the cloaked man, truly worthy of the name [Dragon¡¯s Howl]. But then, the shockwaves suddenly ¡®curved?¡¯ and missed. That was the beginning of her suspicion. Ilgua made use of the wait time and charged in with his sword, already glowing from mana. He raised it and slashed it down upon him, but he simply vanished and reappeared several steps behind where he originally was. Casting his eyes over Diana, he grinned happily and sent out a volley of mana bullets towards them, some missing wildly, other heading straight for them. They were powerful, but everyone managed to dodge them easily. Then, the man suddenly raised his hand, took a step back, and black, gooey magic began to gather around the hand. An ominous magic circle floated over his palm, and he pointed it straight at Diana and co. ¡­Or so they thought. Because at that moment, a bullet curved and suddenly struck the off-guard Diana in her abdomen, and sent her flying down. In her pain and agony, the cloaked man suddenly vanished and appeared before Diana. He grabbed her by the side and appeared back atop the altar, and at that moment, everyone knew what he was planning with her. He already killed 99, he needed 100 to save the kingdom, and now he has Diana in his hands. ¡®This wasn¡¯t good-!¡¯ Crystal thought as she tried to move, but as she tried to rush in, her body felt heavy, as if she was fighting against a current to run towards them. Surely everyone there felt the same weight, but only Rei with her supreme physical abilities could move, but even she was too late, and Diana was dropped into oblivion before Rei¡¯s claws could sink into him. Her moans of pain soon vanished into nothingness. By that point, a magician like her would¡¯ve figured something was up, and knowing Rei, she probably figured out the same thing, even if she wasn¡¯t speaking up. Crystal¡­just knew, somehow. Maybe her social link with Rei has improved! Who knows? Jokes aside, they lost. Hell, this wasn¡¯t even a fight. They were lured in by the trap, and they got caught in it for good. ¡°[Eldritch Magic]¡­huh.¡± She whispered to nobody in particular. ¡°DAAAMNNN YOOOOUUU!!!!!¡± But, well, Gaz sure was angry. She¡¯s questioning whether he¡¯s angry because he¡¯s a friend, or because he killed a girl in general¡­Probably both. Still, everyone has the right to be angry here. Their precious friend just got upped and sent to the afterlife as a sacrifice. Although, zoning herself out from the battle for a minute, what was this feeling of hers¡­? Sure, she¡¯s angry, and sure, if this guy was able to use [Eldritch Magic] to slow down time or their perception of time, then they¡¯re as good as screwed, but¡­it feels like there¡¯s still something out there, something much more powerful. And it¡¯s getting closer. She¡¯d be lying if she wasn¡¯t scared, in fact, she¡¯s completely out of her game right now. Why? Because that threat boys and girls, is right above their heads. ¡°Why such anger? You friend was used to save the lives of thousands. There isn¡¯t any more-¡° ¡°Of course they¡¯re angry.¡± ¡°!?¡± It was a soft voice. One that anyone would probably miss if they weren¡¯t keeping attention. But the pure annoyance and hatred brewing inside that soft voice¡­there was no way in hell anyone was going to miss that. In that moment, everyone looked up, and there they saw a man. A man wearing a clothing full of black, complimenting with his black hair. The slight emo hairstyle was¡­new, but that didn¡¯t distract from the overall mysterious vibe this man gave. And more than that, he was floating in the air, with no magic or mana expended. None. ¡°Y-Y-You¡¯re-, you¡¯re-!?¡± The cloaked man looked up at him and trembled. He trembled so much his knees gave out from the trembling and he fell down, his cloak falling down, revealing the squeaky clean bald head of the man. ¡°You just sacrificed their friend, and those women without any consent, and for what? To save a bunch of sinful lives they don¡¯t know? What could be more selfish?¡± ¡°H-Ha! I-I-I¡¯ve sacrificed 100 pure maidens n-now! Y-Your curse is-!¡± The instant he said curse, a [Phantom Blade] came hauling over towards him, and pierced right through his cloaked chest. ¡®A-A [Phantom Blade]!?¡¯ It threw everyone in shock, with some shocked for other reasons. Crystal especially. She knew that her [Phantom Magic] wasn¡¯t exclusive to herself, but still¡­Support the creativity of authors by visiting the original site for this novel and more. ¡°Curse? You think stopping that is enough to stop me? You¡¯ve got some guts, I¡¯ll give you that.¡± He said so in a mocking tone, but there was no laughter or mockery in those eyes. Only contempt. That man, whoever and whatever he is, understands the pain of losing someone dear, and he could clearly sympathize and empathize with their loss. She felt no danger from him, but the aura and strength he exudes¡­it was almost suffocating. With a long and probably intentionally extended sigh, he slowly raised his hand into the air and closed his eyes, ¡°¡­[Macrophage]¡± Before those eyes opened with a gleam shining inside, and his hand brought down pointing towards the kingdom that rests below. A small surge of darkness cascaded out from his hand, into the air, and into the kingdom, before- ¡°N-No! N-Not my kingdom!!¡± A black gooey slime began to rise from the ground and swallow everything it consumes. Stone, dirt, trees, grass, people, soldiers, merchants, aristocrats, princes, kings, everything it touched, they all got sucked in and was consumed. In mere seconds, nothing of the kingdom was left, eaten like a true macrophage. ¡°You¡­YOOOUUU!!!!¡± The cloaked bald man vanished from the spot and appeared in the air, firing a volley of mana bullets towards him, his anger fully showing through his expression and rough voice. His kingdom did just get swallowed to oblivion, so its justifiable. Not that sacrificing 100 pure maidens was justifiable, but I digress. The man floating above was more than eager to end the bald man¡¯s life. Any man who wishes to save sinful men like the ones from that kingdom can go to hell. The problem is- *BOOOOOOOOMMM!!!!!* Just as he was about to erect a barrier to block off the incoming bullets, a ¡®stray¡¯ meteor came crashing into him and brought him down to the ground, along with a loud explosion and a powerful shockwave of flames and dust. That Oldruin clone was instantly demolished. ¡°¡­¡­Huh?¡± Witnessing that, there was no way in hell the bald man could stay composed. Nah, more like no one in the area could stay composed just suddenly seeing that. Gaz, who knew what that was, was shocked to know that something like that could even happened, while the rest could only see that as an act of the gods. Well, ¡®God¡¯ is close enough I guess. ¡°Bugwah!?¡± A sudden pressure was applied to him, forcing him to kiss the ground. Sounds of his bones and limbs cracking echoed out through the night, along with the sounds of the cliff edge cracking. Before the cliff finally gave way and fell apart, falling down with the bald man struggling on top. Easy to say he¡¯s dead by that point. And with that, the battle ends, with no victors to take stage. The kingdom¡¯s dead, the bald man¡¯s dead, Diana¡¯s gone, the Oldruin clone got struck by a meteor and died, and there¡¯s no way they¡¯re going to bring those 99 women back to life. Overall, a no one wins situation. ¡­Welp, the fourth party¡¯s the winner then. ¡°Master!¡± A rift suddenly ripped open in the air, and Leo(back in his male form), came out and descended down towards the surviving group. As always, he had a tired expression and was yawning, just that his fatigue was genuine this time. ¡°Huah~¡­What¡¯s with this tense air¡­?¡± ¡°M-Master! The girl you asked me to protect, she-!¡± ¡°I know¡­don¡¯t worry¡­she¡¯s fine¡­¡­I think¡­¡± As you might have guessed from last chapter, Diana¡¯s not dead¡­not yet at least. The spell that the bald man used was [Eldritch Magic], and its purpose was to break the curse Oldruin placed by tailing away 100 pure souls into the underworld. Easy to say, he would¡¯ve failed anyways, because: One, Diana has the title [Soul Conqueror], so anything that revolves around her soul being played with isn¡¯t going to work, and two¡­she¡¯s Diana. The problem lies in the fact that getting her BACK wasn¡¯t going to be an easy task. For someone like Leo, getting someone who just died recently back to life wasn¡¯t that hard of a deal, but the place Diana¡¯s body and soul has gone to is¡­complicated. If what Leo¡¯s thinking was right, then getting Diana back should be the main priority, since she¡¯s quite a special one, but with more time spent here, other Oldruin clones are going around and destroying corrupt and sinful humans, which is bad. This was a race against time itself. The place her soul and body¡¯s gone into, for some reason, was a place that physical beings, as in himself, his disciple, that black ogre guy, etc couldn¡¯t go to. ¡®A place of souls and gods¡¯ a friend of his once called it. But¡­As luck would have it, there happens to be one incorporeal being among her group of friends. If Crystal, a weapon spirit, was to go through, there should be no problems on her end. ¡°Hey you¡­¡± ¡°¡­Me?¡± ¡°Yeah¡­Here¡­go through this¡­find your friend¡­¡­oh, and take this to go out.¡± And to get out, he handed over a neat little artefact he happened to enchant with his magic, a small silver coin to a slightly angry and confused Crystal. She stared at it for a moment before she took it. With that done, and her precautions ready, he opened up a rift to whatever place Diana was in and left in a haste, leaving behind only a note with Ilgua reading: ¡°I¡¯m saving the world, go rest.¡± In a near unreadable handwriting. If Ilgua¡¯s master was here, then all the problems should be over with. After all, Leo was his master! ¡­¡­Just¡­There¡¯s one problem. ¡°¡­Oh sh*t.¡± The world on the other side was a maze-like rainbow road-style place, just with the rainbow road switched out with ancient runic flooring, and the fact that there was multiple floors to it, and the fact that Crystal was a huge Zoro. A perfect recipe to make someone lost! ¡­¡­¡­¡­¡­¡­¡­ Well, not like Diana¡¯s in a better place though! ¡°HaaahaaAA!! W-What the hell is t-that!?¡± She was currently on the run away from a monster that she could only describe as ¡®a monster suitable for the abyss, and probably is a brother to the Shambler from DD¡¯. Just, a gross crawly monster with 8 red eyes. Yuck. Unlike a mollusc though, it¡¯s fast, agile, has incredible reflex, its instinct are top-notch, and its tentacles easily slice though the stone brick walls that surround her. Oh, and talking about stone brick walls, Diana was in a similar place to Crystal, a place of twisty turns, surrounded by stone brick walls, and with multiple levels to boot. An Asian-levelled Rainbow road with less colours in a sense. Back on track. She¡¯s tried everything to get it off her track. Shooting her bubbles, a volley of [Slime Cannons] and [Slime Railguns], a wave of corrosive slime, but it was just too fast or smart! Booting back a bit, at around the time Crystal forced her way in to this world of ¡®gods¡¯, Diana was just having a casual game of Borderlands, the original one. She was just up against the vault, when suddenly, the computer she was playing shut down, and along with it, the world turned black. Then, when she came to, she was lying down on the cold stone brick flooring, and a loud noise could be heard from behind her, which she soon realised to be the gross tentacle-wielding monster. She shrieked and ran as fast as she could in the other direction. And then realised this was a maze and cursed to herself, before she ran again. Then, all of that comes back to the present day, with Diana avoiding a volley of abyssal bullets being fired at her at high velocity. The tentacle attack were fine, since physical damage means nothing to her, but those abyss bullets man¡­one hit, and she¡¯s outa the game. She¡¯s already ¡®dead¡¯! She didn¡¯t need to die again! Eventually, she came up with the bright idea of creating a clone of herself, and then(hopefully) making this gross monster follow the wrong one. Let¡¯s just hope for all its smarts, it still has the smarts of an AI. ¡­or¡­not. Because as soon as she threw away her clothes and formed a clone of herself, a volley of abyssal bullets came to town on both of them. Being the conscious one, Diana was able to dodge in time, but the clone¡­well, it¡¯s seen better days. With that, she¡¯s back to how it¡¯s been for the last 5 minutes, just with 30% less mana in the battery. Kinda sad really. Now, with further conviction to strike Diana down and feed on her soul, the gross crawly monster continuous its rampage through the maze, chasing this running girl down until she finally drops down from fatigue. Judging from the way she¡¯s been going, she¡¯ll soon be out in about¡­5 minutes or so. The monster ¡®laughed?¡¯ happily and sent a pair of tentacles to slice down the walls around it, to clear space and also spook the scared Diana a bit. A cloud of dust flew from the crashed debris, before it cleared to show a scared Diana, who was having a hard time getting to her feet from all the recent scares. She slowly crawled away from it, but a volley of abyssal bullets pierced through her unclothed chest as her eyes went blank, and her body went cold. ¡­And also broke down into a puddle of lifeless slime. *¡­!* It was then, it realised, it had gotten JoJoed! tricked! Although Diana was a Slime Queen now, through and through, killing her didn¡¯t mean that she would just break down into a puddle of green slime. If so¡­that meant that the Diana he had just shot was¡­*gasp* a clone! It ¡®roared?¡¯ in anger as it stomped around, its tentacles shooting around and slicing apart more of the stone brick walls. In its tantrum, it ¡®shrieked?¡¯ and rushed off further into the maze, angered by its failing to capture and eat such an easy prey. And so¡­the place went silent once more, with only the occasional sounds of falling pebbles filling the silent air. Then, there came life. A small string of slime slowly escaped out from under the debris, rose up into the air, and formed into the real Diana, safe and unharmed from getting swallowed by the Shambler¡¯s cousin. Ah~, what a nice day to be alive! ¡°Phew¡­take that, you gross monster thingy!¡± She triumphantly shouted as she rose her hand into the air, before she realised she probably made a sound loud enough to call back the monster and recoiled back. In fear, she turned back into slime and hid under the debris for a while, before coming out after determining that the monster was probably, hopefully, most likely, away from here. ¡°¡­Diana? I-Is¡­Is that you?¡± ¡°¡­¡­Huh? Crystal?¡± And as lady luck has it, just as she formed back into her human form and sighed, a familiar face shows itself. And of course, the first thought that came into her mind was: ¡®¡­Wait, did Crystal also die then!?¡¯ [46] ...Well, Fate Can Be Cruel At Times ¡°¡­Diana? I-Is¡­Is that you?¡± Previously, With Diana getting sacrificed to break Oldruin¡¯s curse on the kingdom of [Albion], not that it matters now since Oldruin¡¯s clone came and wrecked the place, Crystal and her friends were desperate to defeat the cloaked bald man. Before a comet proceeded to crash into Oldruin¡¯s clone and blow him up, and the bald man fell off the breaking cliff¡¯s edge due to Leo applying intense gravitational pressure onto him. All in all, both attackers died pretty damn quickly. After Leo¡¯s arrival, he was quick to help with the party¡¯s desire to try and bring Diana back. The problem was¡­Diana had somehow managed to get herself into the world of ¡®spirits and gods¡¯, a place no ordinary human, or any normal living being could travel in and out of. Which meant, Rei, Leo, Gaz, and Ilgua were out of the picture. But Crystal, being a spirit created as a last boss of a dungeon, was, well, a spirit. With Leo¡¯s magical silver coin to guide her back, Crystal ventured through the portal Leo created and found herself inside this maze-like world of stone brick walls. A very boring looking place if I must say. As soon as she entered however, a strong surge of power emanated from across this ¡®maze¡¯. Taking a gamble that Diana would be there, she hurried over to the location, and after getting lost several times and bumping her head on several dead ends¡­here she was, staring at the debris with Diana(bare naked) just standing there, frozen in shock and relief. ¡°¡­Huh? Crystal?¡± It wasn¡¯t much of a surprise to say that both sides were surprised. Crystal was surprised because: One, she did just find Diana in, like¡­5 minutes. Two, the incredibly strong monster she felt earlier was nowhere near. And third, Diana was naked¡­What? While Diana on the other hand, with the knowledge that dying brings someone here, immediately had her thoughts drift on to the possibility of Crystal dying in the battle as well. Now that was scary. But with the aftershock gone, all Crystal could feel was relief, happiness, joy, and other happy feelings I can¡¯t seem to remember. With no further ado, she rushed forward and pulled Diana in for a hug, much to Diana¡¯s silent surprise. No words were exchanged, for there was no need. From the soft trembles of her lips, to the building tears in her eyes, Diana could easily guess all the thoughts and emotions running through her head. Smiling, Diana returned the hug, snuggling close to feel the soft warmth of her body. She gently brought her hand up to Crystal¡¯s head and calmed her. Even if the Crystal here was simply an illusion, she didn¡¯t care anymore. So much of her memories had floated away, it¡¯s getting hard to tell what was real and what wasn¡¯t. And frankly, by the end of this journey, she¡¯d probably completely forget who she was and how she came to be. But none of that mattered. Because here, in this moment, she was with her best friend, and that¡¯s all that mattered. They shared this silent hug for a couple more minutes, before Crystal reluctantly broke off and wiped her eyes, just in case any tears decided to fall out. A-After all, she couldn¡¯t cry now! The danger of this unfamiliar plane still lingers above them! Literally! *Giiiiiiiiiisssshhhhhhhh* ¡°Oh¡­¡­God.¡± Crystal could only let despair-filled voice as she looked up, where she saw one hell of a demonic looking spider hanging above them, its 8 red eyes staring intensely at its new meal. Its body was covered in blue lava, bubbling and coating the most spider¡¯s body. A tough purple carapace was covering the spider¡¯s eight legs, which also served to probably increase its stabby power. Oh, and it¡¯s also huge. Like, huge. Both of them immediately stepped back, avoiding the incoming lava spider, its lava getting thrown everywhere, melting anything it touched. Dangerous. ¡°¡­Welp. Time to the Joestar¡¯s family specialty!¡± ¡°Huh?¡± The giant lava spider hissed at the two, its lava bubbling out in ferocity as it marched its way towards them! Time for another chase scene! ¡°Book iiiiittttt!!!¡± ¡°H-Hey! Wait for me!!¡± Turning the other way, the two girls immediately ran away, followed by the giant lava spider! Just in case, Crystal conjured a [Phantom Blade] and fired it at the lava spider, seeing it melt into the lava like it was nothing. With this, she proved that attacks were useless. Sh*t. The fact that this was a maze wasn¡¯t helping either! With the many twists and turns, the path to escape this crawling monstrosity following them seemed like a dream. Oddly though, Diana seems rather calm about this, as if she had a plan. But she might just be a ditz, so who knows. The giant lava spider began firing lava pellets at them as they got farther from it, making their escape even tougher than it already was! Not only that, those things were fired at the speed of a goddamn bullet, so even if it wasn¡¯t lava, they¡¯d still get pretty injured! Things were not looking up, until Diana suddenly stopped and grabbed her hand tightly. Squealing a little on the inside, she failed to notice that the monster from earlier, the gross crawly black monster with eight eyes standing before them. With the giant lava spider behind them, and the crawly monster before them, they were now trapped! Using this chance, the giant lava spider fired off several more lava bullets at them. As Crystal was still somewhat in a daze, Diana used her slime to push her onto one side of the wall, while she jumped back to the opposite side, both evading the incoming lava. And instead, the bullets went flying and hit the abyssal crawly monster. Which, added on with the rage from losing Diana earlier, only served to enrage it even more. Blinded by its rage, it turned around and roared towards the giant lava spider, charging in to battle it! The spider, realising that this gross crawly monstrosity was going up to challenge it, hissed in anger and annoyance as it too moved in to attack it, firing a volley of lava bullets. ¡°W-What¡¯s-, mmphh!?¡± While all this was happening, Diana controlled her slime to move over Crystal¡¯s mouth and silence her, while she turned into her slime form and slithered on the floor and over to Crystal, dragging her away as silently as she could from the fighting monsters.The story has been stolen; if detected on Amazon, report the violation. After they got far enough, she released the slime from Crystal¡¯s mouth and returned back to her human form, before the two continued to run away. Now that those two monsters were out and fighting each other, Crystal finally had enough focus to remember that silver coin Leo gave him to help her find her way back. In a haste, she quickly pulled out the silver coin from her pockets and stared at it. ¡­and¡­uh¡­nothing was happening. She tried everything. Throwing it at the wall, flipping it over and over, calling it out, dropping it on the floor, trying to bend it, but nothing worked. None of this ¡®help¡¯ she was promised appeared to guide her out. ¡°Hey, what¡¯s that?¡± ¡°This? It¡¯s a silver coin. That Ilgua guy¡¯s master gave it to me to help bring us back. Not sure if it even works though. Here, try it.¡± Seeing as her efforts were useless, she gave up the silver coin and gave it to Diana, who upon touching the coin, suddenly caused the coin to shine brilliantly, showing them a white line that guided them towards¡­whatever it is that will bring them back. ¡°Woah¡­That¡¯s cool¡­¡± ¡°Huh? What¡¯s cool? I don¡¯t see anything.¡± ¡°¡­Huh? Really?¡± Crystal nodded again, confirming that indeed, she could not see anything besides Diana in her naked form. That¡¯s enough though, seeing Diana naked was already pleasant enough for her! Oh god, she¡¯s becoming a pervert now too!? Well, no matter. If Crystal couldn¡¯t see it, then she just needed to guide her towards it! Holding the coin tightly in her hand, she led the way and the two left, this time with Diana following the white line that recently showed up. And that white lined trail led them to¡­an empty room. In fact, it was so empty, that not even the stone brick walls that barricaded them in from earlier was in sight. All they could see was¡­white. A whiteness stretching farther than the eye can see. Diana was back in the white world. Just, with a guest this time. ¡°What is this¡­?¡± As a mage herself, a world like this was of heavy interest to Crystal. Well, the lonely whiteness was boring, even an hour of excitement wouldn¡¯t fix that, but this place¡­there was absolutely no mana¡­none. It was as if, mana didn¡¯t even exist in this world. A whole other dimension from the one she knew. Now that was an exciting thought! But, more of her fangirling later, Sig was back! ¡°Sig!¡± *Seems like you made it back safely. Nice one!^_^* ¡°¡­Sig?¡± It was a first for her, hearing the name ¡®Sig¡¯. In fact, she couldn¡¯t even see Sig, who was just sitting before Diana, with a face of ¡®relief?¡¯ as it saw her faze back into this world. Sig wasn¡¯t exactly sure what just happened, but the chances of Diana dying from that was extremely high. If Sig could, Sig would have broken down and cried tears of joy, but hell, Sig couldn¡¯t even give a single sign of that. Sorry not sorry But, that all aside, the world of complete whiteness hasn¡¯t changed all that much. It was still white, Diana and Sig was still there, with the addition of Crystal now, and that damn huge tree was still in the centre, just idling around. Although its situation was¡­much more severe now. Previously, it was only wilting with only a part of its bark turning black. Now? The bark was near dead, with the leaves striving to keep attached to the falling branches. The air generated around it was dark, as if the oxygen it created was polluted, no longer pure. And soon, even if she didn¡¯t want it, she was shown the truth. All those 99 women sacrificed to that ritual(that didn¡¯t even f*cking matter), all of their pure souls surged into that tree, along with the thousands of lives from the destroyed kingdom of [Albion]. Their hearts filled with regret, anger, and despair, they stormed the tree, and poisoned it from the inside. And the sinful citizens of [Albion] weren¡¯t helping much either, with their lingering regrets poisoning the tree even more. And with the countless other kingdoms the Oldruin clones have devoured, it¡¯s no wonder that the tree was reaching its final breath. Like the gates of hell being opened, like the souls of the Sanzu River overflowing, the malevolence of man that had seeped into the tree grew outwards, straining the tree that had tried to keep them alive. ¡­And I mean that literally. ¡°W-What the¡­?¡± As Diana died before she knew any of what I just explained, she knew not of why the tree was acting as such. All she could see was the darkness, taken form as elongated hands, reaching out of the tree and towards the whiteness, tainting the pure cloth white with its darkness. That alone was already scary enough, but to make it even worse, those arms were- ¡°Hyaha!?¡± Reaching towards her and her friends now! The black arms shot out towards them, trying to drag them inside as well. Just barely, Diana managed to dodge the first strike, but with more incoming arms, staying here was¡­probably not the best of ideas. And-, oh right, Sig¡¯s fine. Sig¡¯s a part of this world, so it can just faze in and out whenever it wanted. F*ckin¡¯ Reimu No.2 ¡°C-Crystal! How the f*ck do we get out of here!?!?¡± ¡°S-Shut up! I-I don¡¯t know either!!¡± This was bad. Really bad! Leo said that the silver coin will help them get out of here, but damn is this thing bugged as hell! It wasn¡¯t working a single bit! No matter how hard Diana punched it, hit it, bit onto it, it just wouldn¡¯t do anything! Another arm rushed out, and managed to catch Diana in its clutches! In panic, Crystal turned back and shot a set of [Phantom Blades] at the arm, severing it from Diana and freeing her. A shiny object fell and hit the white floor. Crystal noticed it, but as more arms were reaching towards them, she had no chances to see what it was and continued running. And now, it¡¯s time for the deus ex machina! ¡°D-Diana! Over there!¡± As they ran away from the expanding darkness, there they saw it. A rift in time and space, one that looked alike to the one Crystal used to get in here. In other words, it¡¯s a goddamn portal! With their eyes set on the goal, the two rushed towards the portal, evading any incoming arms as they strove towards the portal. The whiteness rolled across as they ran by, their legs tired but strengthened by the will to survive. Crystal was the first to get there, her body easily fazing through the portal and out of this world. The coin¡¯s effect had finally activated. Seeing her friend leave before her, Diana finally found salvation, as her hand was first to touch the portal- Before she was sent flying back. ¡°¡­eh?¡± The moment her physical hand touched the portal, it rejected her. Diana tried again and again, but no matter how many times she charged in, she would only get knocked away. Leo failed to elaborate. While it was true that only ethereal beings like spirits or gods could enter into this surreal world, the same goes the other way around. Only ethereal beings are able to move out of this world, as they are the true inhabitants of this world. A physical being like Diana, a [Slime Queen], can never pass through. ¡°W-Wait, come on¡­this isn¡¯t funny. L-let me through, p-please-¡° Her cries, went unanswered, as in her fit on despair, an arm shot out and caught her, dragging her back, closer towards the withering tree. ¡°NOO!! P-PLEASE!! CRYSTAL!!¡± Like a Magikarp caught at the end of a fishing rod, the arm dragged her back, reeling her pass the darkness and towards the centre of the withering tree, where all of the malevolence had gathered, fit into a single space. ¡°Let go, let go, let go!!! You piece of sh*t, LET, ME, GO!!!!¡± Those, were the last words she spoke, before she was swallowed into the withering tree. ¡­¡­¡­¡­¡­¡­¡­ ¡°Hah¡­hah¡­hah¡­¡± Meanwhile, on the outside, ¡°Crystal¡­Diana, where?¡± Rei asked, her head tilted as she looked on, seeing as Crystal had returned, but Diana had not. Crystal was completely exhausted, her breathing ragged as she struggled every breath into her lungs. ¡°H-Huh? What do you mean?¡± She turned around, eyeing the portal that was still there, floating slightly above the ground as the space around it warped in confusion. Seconds passed, then a minute, then 5 minutes, when the portal finally collapsed on itself and closed. Only then, did she realise. Diana did not come back. ¡°Oi Oi, w-where¡¯s Diana? You saved her, right?¡± Gaz voiced his concerns, smiling as best as he could despite seeing with his own two eyes that Diana was nowhere to be seen. Ilgua was similar, just staying silent and not moving, his eyes tracking for any signs of Diana. There were none. Leo was not here to explain. The portal was not here for her to check. Oldruin was not here to elaborate. The darkness from before was not here to show any prove. And Diana was not here to smile brilliantly to her comrades. She recalled what Leo said, as it was a world of spirits and gods, only those who belonged there, could enter and leave, were the spirits and gods themselves. The coin he handed to her, was an artefact enchanted with the blood of a god he had long befriended. With that, surely Diana would have been able to exploit the world¡¯s characteristics and escaped. But Crystal made a mistake of giving it to Diana early. As Crystal freed Diana from the arm that managed to catch her, she noticed a shiny object fall and hit the white floor. She noticed it, she really did, but¡­she didn¡¯t have any time to realise what it truly was- No, she did have time. Her [Phantom Blades] were able to cleave through the arms of darkness, yet she didn¡¯t think about it and ran. If only she had taken more effort, if only she was more brave, this wouldn¡¯t have happened. She could not go and ask for another one, for Leo was no longer here, now in pursuit to destroy the other Oldruin clones. And now, the portal was closed, Diana was surely swallowed up by now, and no powers she had could rewind time. The spilt milk could never return to its glass. [47] Its...Finally Over ¡°¡­Huh! This isn¡¯t too bad!¡± Previously, on Diana¡¯s misadventures! Just as Diana was reaching the portal, the portal rejected her, sending her flying back, which led to her getting caught and dragged into the pool of raging darkness, the withering tree in the centre of that world of darkness. It was due to her carelessness, causing the silver coin Crystal handed to her to fall out of her hand, the only key that allowed her to escape. As she was dragged, she cried for mercy, but the hand that caught her had none, as it pulled her without thought. And inside, she saw hell. A bursting cauldron of vengeful spirits, all hauling from the devastated kingdoms that the Oldruin clones had slaughtered. Their formless bodies clung onto her, pushing their memories and feelings into her mind. She was horrified. She witnessed the lives of man. They who killed, robbed, raped, and stole thoughtlessly, without any regards on what their victims felt. It was something that Diana could not handle, not on her own. With no one by her side, with no familiar faces there with her, with no shoulders she could lean and cry on, she could only suffer, as lives after lives were displayed and played inside her mind. She screamed, her voice ragged and broken from the tears she swallowed. Her legs stood atop an unseen plane, a floor of invisible glass that seemed like it would break if she stepped on it with even a bit of effort. All around her was a space of nothingness, a galaxy bearing no stars. Her physical body was still there. She could even see it herself. But she didn¡¯t have any time or energy to do so, as her focus jumped from one memory to another, suffering as their sins weighed on her pure and na?ve psyche. ¨CYou see? Humans are absolute sh*t, aren¡¯t they~? Then, she heard someone speak to her from the vast nothingness. The sound of her voice spooked and terrified her, because it felt familiar, yet she did not know why that was. ¨CKilling is just a normal thing, see~? No need to worry so much about it~! Why was this girl speaking to her? Why was she saying such immoral things? She wanted to ask, but another memory from another man pierced into her mind, forcing her to witness more and more of humanity¡¯s murky sins. Her screams coursed through the empty universe around her. ¨CThe strong survives, the weak dies. That¡¯s just how it works in the wild, you know~ It was then, that she finally realised whose voice it belonged to, and why it sent shivers and made her uncomfortable the longer she heard her. This was¡­her own voice. Or to be exact, the her that resides inside her. The piece of herself that formed after she merged together with Slimey to be reborn as the [Slime Queen]. She was the one who had no qualms about killing and stealing, living in this world like a wild animal. ¨COh, come on~, it isn¡¯t that hard! Just forget all morals and survive! You¡¯ve seen first hand what your na?ve nature and overly kind attitude caused you, right~? Killing others is just a matter of surviving. Everyone understands that. Only you are different. She knew what she said was true, that it was just her being na?ve and spoiled to the core. Being born in a peaceful world like Earth, she had morals to live by, even if her contact with other humans was limited to chatting on skype. ¨CYou want a world where everyone can have fun, didn¡¯t you~? That¡¯s why you hated cheaters and backstabbers in the first place! Now~, look at each of them. They¡¯re all evil, right? The exact kind of people you wish would just disappear, riiight~? Her voice was that of a snake, tempting one to fall and embrace what they have shown. Killing every evil human being was an easy way to make a place where everyone could smile and have fun. But, now she asked back. ¡°T-Then¡­w-what is e-evil¡­?¡± In a dictionary, evil would be considered as breaking the law, doing something immoral, disregarding humanity for your own sake, that kinda deal. She, however, didn¡¯t answer. Because by this point, anything she said will be pointless. This disembodied voice, one that imitated her, one formed from her and Slimey¡¯s fusion, one that had the same ideals and dreams, but had a plan that completely contrasted to her own. She finally saw it. Diana was breaking, not anytime soon. Her words won¡¯t reach her no more. Lives after lives flash by, their memories and tales forever ingrained into the depths of her mind. The lives of man was sinful and tainted, they didn¡¯t have a single f*cking care about what happened, as long as they themselves gained benefits. She was right, Diana absolutely hated that. It disgusted her. Killing all sources of sins even sounded a bit like a good idea. But, from time to time, in this world where time and space seems to have taken a vacation to the Alola region, she saw a different story. They were simple, short maybe, but simple and pure. Like the lives of an innocent farmer, tending to his crops as he helped out his sickly family, before he died of the same sickness. But he held no ill-will. He simply smiled at his death beds, caressing the cheeks of the children of his village, the ones he had so kindly treated and shared food and stories with. Then there was a young female scholar. All her life, she was hated by her family. Disowned and thrown into the streets, a sympathetic young man brought her in and adopted her after her agreement. Under him, she learnt magic and scholarship, training and learning to surpass him. She simply wanted to be loved, and when she finally met her lover, she found someone who loved her, and one who loved her back. There were more tales of their simplistic lives. Like the tale of a young child, the happiness of an elderly couple, the bravery and satisfying defeat of a brave warrior in battle, and much, much more. Just like the rest, they killed people, but not for their own sake. A knight kills his own squad to save a girl they had planned to rape. A magician drowns an entire fleet of ships into the sea to protect her husband. A hero summoned to fight, battled and killed many to save the world he had grown to love. If evil was something immoral, then were they evil too? Doesn¡¯t that simply mean that every being in this world was evil? Doesn¡¯t that just make the word ¡®evil¡¯ pointless? If that was true, wouldn¡¯t she have to kill humanity itself to create her ideal world. No, that was not what she wanted. Despite the many murky clouds of sinful men, she saw small gaps, with the light of those she could never kill. The bodiless voice saw it, the eyes that were once darkened from all the suffering she endured from all the memories pouring into her, was now clear. Not completely, but clearer and brighter than before. She could witness a small spark inside, bursting out into a flame that she once, and always had. The Diana that loved a fair and fun world, wasn¡¯t going to break so easily from all those words! The voice could only fade away, as the doubts Diana had vanished. But, perhaps, if she had a body, she would be looking at her, smiling as she saw her resolve built and renewed.If you stumble upon this narrative on Amazon, be aware that it has been stolen from Royal Road. Please report it. Because after all, seeing her master stand her ground was the best. With that, the piece of her that antagonised her, disappeared, along with the last remnants of Slimey¡¯s soul, before surging and joining back with Diana¡¯s true self. And all that, brings us back to the present ¡®time?¡¯, where Diana is casually strolling around, now somewhat enjoying viewing all the tales and stories of different people, no matter how wicked or ¡®evil¡¯. As this thing called ¡®time¡¯ was taking a journey to the west, she witnessed countless lives of others. It felt like an eternity, of her just patiently watching as their lives unfolded with a soft smile on her face. The darkness that had once tried to grasp her and pull her down with them could no longer reach her. In fact, it¡¯s been so ¡®long?¡¯ that Diana herself forgot that that even happened. Actually, she forgot entirely why she was in this empty void in the first place, now only busy with watching the lives of people that had died, only watching on as an observer, their tales passed onto her. But, even as ¡®time?¡¯ went by, she did not forget the things that she held close. Her true first friends, her ideals, her dreams, and her pet and wonderful companion Slimey, these were the things that she could never forget, no matter how long passes. Though as more and more time ¡®passing?¡¯ by, the lives she watched never stopped being boring. Even if the different was miniscule, every tale told, every story written, every adventure recorded was different. Slowly, as the numbers of souls that died up to her being swallowed up diminished, so too does her consciousness. Slowly, her body deteriorated away, bit by bit, cell by cell, atom by atom. Her body slowly tore into tiny pieces, dispersing across the empty cosmos. Until finally, the last tale comes to a close, and enough of their tales had been heard. With the satisfaction of having listened in and watched every single of their lives, and learnt all their secrets(even the naughty ones), she disappeared. All after that comes in a blur. She went to the ¡®afterlife¡¯, a place she knew existed, yet could not remember. There, she saw the other people killed by the clones, even the other 99 female sacrifices that was used to try and save [Albion] from its sad demise. There, they chatted, not bothered by age, sex, likes, dislikes, or any other differences. As she was the one to witness all their tales, she knew everything they¡¯ve been through. It became her oath to never forget. It was then, after a countless ¡®Millenniums?¡¯, she heard a crying voice. Soft, almost unheard, but she could hear it. No one else could hear it, not even the girls she was talking to could, but it was there, crying for her. She recognised that voice. That seemingly stoic, but also somewhat child-like and excitable as her, the voice of a certain girl that became her first true friend. There were more voices, they too directing their feelings towards her. There were the silent sighs of defeat, all coming from a silent girl Diana convinced and brought out of that rotting and withered forest. A girl was an unflinching appetite, and one with the surprising knowledge of cooking. There were the screams of a certain black ogre. He was someone she hadn¡¯t met for a long time, but them hailing from the same place bloomed a friendship faster than they could imagine. He had an insane passionate love for women of all ages, which does question if he was screaming due to the loss of a friend, or a girl he became intimate with. And finally, there were the soft woes of a young boy, the disciple to an incredible psychic. He, on with no true talent and magic, fought his hardest to climb the chilly mountain and reach his master¡¯s cottage. The determination in his eyes never blew out, no matter where or why. She recognised them. She recognised them all. The people who befriended her, a holed-up NEET turned [Slime Queen] due to her being carried off into another world of fantasy and magic. She wanted to go back, to experience more adventures and journeys with them. It was short, but they were her friends! She¡­She may be dead now, but¡­Heck, she¡¯s died and gotten revived before, doing it a second time shouldn¡¯t be that hard! Before her wish to return to her friends and comrades, before her wish to continue exploring, before her wish to create a place where everyone could have fun and smile, nothing shall stand in her way. [Are you ready to sacrifice everything for your goals?] ¨CAnything¡­to return to them, I will do! [Your pleas has been heard by the Gods. They have invited you to their domain, and through that, you may return to those you love. Are you ready?] Needless to say, I¡¯m pretty sure everyone reading this knows what she said. ¨CAbsolutely! ¡­¡­¡­¡­¡­¡­¡­¡­ It was a moment of silence. Though countless years had gone by for Diana in the afterlife, only several hours had gone by, everyone there still frozen in shock and sadness as they saw that their dear friend Diana did not come back from the other side. It was a new day now, but there was no light. The sky was still tainted in darkness, and droplets of water rained down from the clouded skies. Only the soft echoes of the water hitting the soil filled the silent atmosphere. They could not see past the clouds. They could not look towards the unseen light. But the battle was not over. ¡°Ah¡­Aaaahhh¡­Why¡­WHY¡­¡± Slowly, like a vengeful soul rising out from hell itself, the cloaked bald man from before, the one who just sacrificed Diana to that eldritch magic, rose from below the cliffside and stared at them, his pupils shrunk and his body shaking violently. In the time Crystal took to try and rescue Diana, the bald man stayed there, unmoving, reserving his mana until he could move once again. His plan had failed, his kingdom that he strove to rule and protect was swallowed, and now he had no way of reverting time. He was angry. But they all too were angry. Crystal, Rei, Ilgua, Gaz, they were all soo~ angry. So angry in fact, that I¡¯m starting to speak like this for some reason~. Their eyes gleamed with killing intent as their eyes hovered towards him. Crystal summoned her special staff of destruction, Rei readied her claws, Ilgua held his sword in hand, and Gaz prepared his fists. They may not have had a chance when he was at full HP, but~, hehe~, look at him now, all hurt and ragged. A perfect chance to kill him, yeah~? And all hell broke loose. Crystal starts with a volley of quick-fire [Phantom Blades], with the floating bald man countering with a shield of unknown magic. Rei comes in with a claw strike, barely missing as the bald man deactivated his flight and dropped down. Gaz and Ilgua double-teamed the man and attacked at once, their swords and fists attacking together like that one time Jotaro and Polnareff joined attacks Alessi. The man frantically applied his shield and hovered backwards, firing a string of mana bullets towards them. Rei blocks the bullets by throwing a large boulder she got from¡­somewhere, hitting away all the bullets off course, and just in case, Ilgua stood guard if any of the bullets decided to change course and head for them again, which they did. He struck down any that came close, his enchanted blade cleanly slicing the bullets apart. Using her staff as an enhancement, she formed a sphere of [Phantom Blades] around the injured man in a near instant, and let them all fly at once, striking at a single point. The man cried out in pain, managing to block most of the blades, but some broke through and hit. His fresh blood splashed into the air. The floating bald man did a triple axel in the air, firing bullets after bullets as he spun around to dodge the incoming mana strikes from Ilgua¡¯s magical sword. Gaz came in to tank the bullets, using one of his skills to heavily reinforce his body to an insane level. In conjunction with Ilgua¡¯s air strikes, Crystal created countless [Phantom Needles] and fired them like a gatling gun, the needles cutting through the air as they chased the flying bald man, whose name we still do not know. ¡°AAH¡­IT¡¯S ALL¡­IT¡¯S ALL HIS FAULT¡­¡± The man summoned several gross eldritch tentacles, firing out to grasp the four fighters and suck their mana to supply for his own quickly depleting mana pool. Sadly, all four fighters were quite agile, with the exception of Crystal, easily dodging the incoming tentacles. For Crystal¡­Well, she just conjured a really big shield made out of her magic and encased herself in between four of them, creating a transparent unbreakable shield. Its name would be¡­[Phantom Shield] should do I suppose. Using this chance, Rei ran up and jumped off the cliff. Crystal, knowing what her plan was by instinct, moved the shield that was protecting her back and sent it to catch Rei, and later bring her up to fly towards the man. There was no need for words, for their hearts only have one goal. Kill this f*cker, and kill him dead. The focus from controlling the flying shield stole her from using any other magic, only allowing her to maintain the three remaining shields protecting her. To close the gap in her defences, Ilgua and Gaz stood guard and blocked any incoming bullets that the floating man fired off. Rei, standing on Crystal¡¯s [Phantom Shield], flew towards the floating man, her claws readily grown out to strike a blow. In his attacking haze, he realised the incoming Rei a second too late, and ended up getting a full claw slash on his chest. More of his blood lost into the atmosphere. ¡°YOU¡­YOOOUUU¡­¡± He was a broken man. As a mage and the previous helper of the king, he was strong, incredibly so. If it wasn¡¯t for his injuries, he would¡¯ve won this battle by a long shot. But that man. He came and messed everything up. Even after he managed to finally break the curse that has been haunting his kingdom for decades, that thing came in and swallowed it all up. Not a single resistance could match up to his unflinching might. He was angered, severely angered. The reason he wanted to protect the kingdom was not from kindness or duty, but from his greed to be looked upon as he hero on his return, and later overthrow the current king and seat himself on the throne. But now that the kingdom was gone, what throne could he seat himself onto? Overtaken by his rage, his [Eldritch Magic] went odd. As [Eldritch Magic] by nature was dangerous, the user needed to have enough willpower and control over his/her mind to use it without going insane. But in this state full of anger, even he could not resist. Now, his body was only that of a mere shell, only striving to survive from the four attackers on its pursuit, using the best of his arsenal to tear down his four foes. It was sad really. Because of that, Rei got another claw strike in, cutting open his chest with another strike, before getting impaled by a streak of countless [Phantom Blades] created and fired out by Crystal, enhanced by her staff of destruction. Finally, finally, as Rei made it back safely onto the cliff, the [Phantom Shield] disappeared, and along with that, the last remnants of his haywire magic, causing the lifeless body of the man to drop from the sky and down the cliff. With that, the battle was over. This goddamn incident, was finally f*cking over. [48] Shes Back, and Str-, Weaker Than...Usual? It was an early waking stupor for Anna. Last evening, Ilgua trained her so hard she immediately fell asleep when she got inside the hut. Her body was still aching all over, the pain from getting her *ss handed to her over and over again(despite being an archer) was something she would never forget. Unless you¡¯re Archer Emiya, then you¡¯re all set Even in her state of ¡®almost about to sleep again sorry~¡¯, she could hear the peaceful goblins outside working out their morning daily lives. From the nice smell seeping into her hut, they were probably making breakfast. ¡°Oi~! Wake up!¡± ¡°Muuu¡­¡± But even if her stomach was dying to get some nutrition inside, her sleepy self didn¡¯t desire to get up. Even if she was only sleeping on a bed of straw, the cushion it had against the hard ground was nice enough to invite her back to the land of dreams. ¡°Ooiii!!!¡± The girl calling to her began moving her, rocking her back and forth in an effort to try and wake her up. Alas, even she could not enter her sleep with this much disturbance being thrown at her! ¡°I¡¯m awake already! Stop shaking me already!¡± That fleeting moment of anger quickly froze over when she saw who it was who woke her up. That silky long black hair, those beautiful blue eyes, that cheery and confident smile, it was the exact same girl who had saved her. ¡°Awawawa! M-Miss D-Diana! I-I-I¡¯m so s-sorry!¡± ¡°Ehe! It¡¯s fine, chill~. Now, come on, get up. Breakfast¡¯s ready~¡± Already feeling guilty at shouting at her in the morning, she silently obliged and left the hut. Outside, as she guessed, the goblins were already finishing up the breakfast for the day. As always, it looked otherworldly to a normal Earthling, but hey! That¡¯s what makes it fun, yeah? Looking up, it was unclear what time it was. There were still heavy clouds covering up the sky, with the distant occasional strikes of thunder being heard from afar. That aside, the two sat down around the camp fire they lit. ¡°Here you go Slime Queen.¡± ¡°Thank you~!¡± Accepting the soup of¡­whatever it was from the elder, she happily dipped her spoon in and began eating it up- ¡­Wait. But wasn¡¯t Miss Diana weak to goblin foods? Now she¡¯s just¡­eating fine. Well, it¡¯s a good thing then! No need to worry or think about it too much! As usual, the food she was presented with was not of human standards, but once you take a single bite/sip, the taste will surely blow you away. Same goes with this odd soup, while it looked horridly terrifying on the surface, the taste was light and superb! Thinking about it though, where was the rest? Crystal, Rei, and Ilgua weren¡¯t here to share the breakfast at all. She also tried to ask to Diana and the goblin elder, but Diana simple showed a confused look while the goblin elder replied with a quick ¡®I¡¯m not sure¡¯ as he took another sip of the soup. Well, those three were super strong anyways, so no problems there! But then, things got¡­slightly weird. ¡°Alright~! I¡¯m done! Anna, sir elder, I¡¯ll be leaving for a bit. I¡¯ll be back by lunch, so prepare some for me too, okay?¡± ¡°Very well. Good luck, Slime Queen.¡± ¡°¡­As I said, stop calling me ¡®Slime Queen¡¯. It feels weird.¡± With that last fleeting comment, Diana returned the empty bowl to one of the female goblins and left with a cheery smile, humming and skipping as she left into the forest. It was¡­unusual, but it was Diana she was talking about here, and normal common sense doesn¡¯t seem to have any space inside that cranium of hers. But, common sense isn¡¯t something she relies on a lot anyways, so that doesn¡¯t matter. Anyways, moving away from Anna and jumping to Diana now, Previously, While Crystal and her group finally defeat the injured bald man, the sun rising as the battle came to an end, Diana spent countless eternities in the afterlife, before her pleas to return to her beloved friends was heard by the gods. While she could, she took her chance, and soon enough, she found herself waking up inside on of the goblin huts, alive and uninjured but severely weakened and tired. Here¡¯s why. Name: Diana Race: Slime God Lv 0 Age: 17(maybe) HP: 75/75 MP: 42/42 SP: 40/40 [Strength]: 5 [Tenacity]: 8 [Agility]: 7 [Intelligence]: 7 [Dexterity]: 5 [Mentality]: 8 [Endurance]: 4 [Wisdom]: 4 [Longevity]: *** [Skill Points]: 0 {Skills}: [Absolute Slime Transformation: Lv 1/50], [Cooking Lv 2/10] {Magic}: [Slimy Compendium] {Titles}: [Slime God] As you can see, if you compare this to her latest status page(which was like¡­10 chapters ago?), her stats have dropped considerably. In fact, a lot of her skills and titles went missing. Hell, even her class system was gone now! But in its stead, she saw some absolutely weird sh*t. First, what¡¯s up with that [Slime God] title and race man? She knew she took some deal to become the ambassador of slimes, but she didn¡¯t exactly imagine herself becoming a slime god! What¡¯s with this development!? Second, what¡¯s with that age of 17(maybe), huh? HUH? Look, she did spend a sh*t load of time in afterlife, but her normal self was still 17 yeah? YEAH? This damned system wasn¡¯t calling her old now, was it!? As a god, its kinda expected that her [Longevity] stat would be out of the roof, but, still. ¡®***¡¯, really? Lastly, where did all her skills and titles go? They¡¯re her life supplies, you can¡¯t just take them away now! That¡¯s utter insanity! Although its nice to see that [Cooking] was still there. At least her promise with Rei hasn¡¯t been broken just yet! Now, onto the developments! Yeah~! [Absolute Slime Transformation] Lv 1/50 Allows you to morph into a slime. As a slime, all your stats are boosted by 100% There are no longer any MP and SP penalties for staying as a slime, or when getting hit. Density, transparency, and elasticity are all changeable factors. You are now able to turn only some parts of yourself into a slime, but stats bonus does not apply. As a slime, any physical damage you receive will be nullified. You still receive 250% more damage against magical attacks. ¡°You are the embodiment of all this world¡¯s slimy hope and dreams! Yay~!¡± First off, *Inhales deeply* ¡­It¡¯s still kinda the same as [Slime Valley] and [Slimic Sublimation], just with slight differences that bring this skill up even further than before. The subtext there on the bottom changed too, which was a nice touch! Moving on! [Slimy Compendium] A magical tome of knowledge, lent to you by the gods. With this, you are able to use the skill points you earn to purchase different [Slime] based skills. It¡¯s pretty much a replacement for her annual ¡®Special skills¡¯ list for every time she jumps to a new class. It¡¯s a better system in her opinion, but enough of that. Last! [Slime God]Unauthorized usage: this narrative is on Amazon without the author''s consent. Report any sightings. ¡°You have been granted a seat in the throne of gods. May your journey be well.¡± Discards every skill you own, except for [Absolute Slime Transformation] and minor utility skills, and does not allow you to gain any not [Slime] based skills. In return, you gain [Slime] based skills by practice faster and you level up said skills 100% faster. There is also the chance to gain ¡®[Slime] Infused¡¯ skills. Every time you die, you shall be born anew And this here, is the sole reason why she¡¯s lost all her other skills. Right here, this damn title. It¡¯s nice and all, but-, ¡®does not allow you to gain not [Slime] based skills¡¯. Really!? Oh man, that kinda sucks. The bonus is also great and all, but what was most frightening, was the last flavour text at the bottom. ¡®Every time you die, you shall be born anew¡¯. In hindsight, it doesn¡¯t really mean much. But seeing as she was having a hard time remembering much of her past, this might be troubling. Her knowledge of games remains unbroken for some reason, but she couldn¡¯t seem to remember how she got into this world, what made her into a slime in the first place, the dryad, that kinda stuff. Most of her early days in this fantastical world was a complete blur, with Diana only being able to recall up to when she first met Crystal. Pretty much, every time she sees the game over screen, her memories get stolen from her. (Spoiler) Huh, that¡¯s just like Log Horizon. ¡®Ah! Also~, for you readers out there, I¡¯m a [Slime God], but I¡¯m not actually a ¡®true¡¯ god, or that¡¯s what the gods said to me anyways. I¡¯m more of a deity, representing a certain race before the gods. If I was an actual god now, I won¡¯t even be here anymore. And besides~! A god wouldn¡¯t allow a shoujo like me to join their ranks yet!¡¯ ¡­The f*ck? ¡­Ahem, now that that¡¯s all out of the way¡­what to do now¡­? Obviously, she needed to level herself back up as quickly as she could. With only 5 Strength and 7 Intelligence, she¡¯d get squashed instantly. There¡¯s also the problem that her catalyst, as in this body that she was inhabiting, was unstable and getting pretty close to disappearing. Due to the extreme situations her body has been put through, getting her soul thrown into that world of whiteness but surviving, and then getting herself slowly eroded by the voices and memories of the fallen, anything major could cause this body to go *Poof!*. There¡¯s also her ¡®God¡¯s sense¡¯. It wasn¡¯t a skill, more like an intuition she had now that she was a god. And when she thought about instantly meeting back with Crystal and Rei, the bells went ringin¡¯. It¡¯s kinda funny actually. She¡¯s a god now, but she¡¯s so damn weak. She did just come back from the afterlife, so a loss in power was acceptable, but¡­really? It¡¯s been a while since she last felt this weak. Anyways, enough thinking. Shaking her head and slapping both her cheeks, she opened her eyes with determination and continued deeper into the forest. Her objective was to kill monsters(somehow) and gather Exp. Easier said than done though. The first thing she encountered was a monkey, or an ape, not too sure. Its body was almost as big as an adult human, with hands as big as a soccer ball and eyes as wide as an elephant¡¯s. Its tail was also spiky on the end. Though she was weak in comparison, due to her new godly heritage, the monkey noticed her arrival and made several inaudible noises at her, before charging at her full speed with its hands spread open. ¡­Of course, she¡¯s a slime. And being a slime negates all physical damage. So¡­ ¡°Guru!?¡± The monkey¡¯s big hands fazed through her partially slime body and popped out through the other side. The monkey up close, the monkey¡¯s ragged and agitated breaths was felt on her skin, and with that, came a wonderful idea and revelation. This thing was a living being. An ACTUAL living being. And you know what that means~! ¡°Hya~!¡± Turning her entire left arm into slime, she pinned the confused monkey down and forced down some(a lot) of slime into its throat, nose, ears, and any other holes she could find on its body¡­including the anus. ¡°Mmph! Mmphh!!¡± The monkey struggled, as the slime reached its ¡®heart thingy?¡¯ and grasped it tightly, preventing it from beating. With enough time and effort, the heart stopped beating, blood stopped pumping, oxygen was no longer being distributed, and its brain shut down. Walla, Un travail bien fait~! Since she¡¯s fought with a lot of¡­uh¡­¡¯living yet not really¡¯ monsters, she kinda forgot that the heart and brain were the two essentials to the life of a normal living being. Which meant that suffocating them to death was definitely an option she could take! [Enemy has been slain. Gained 195 experience. Gained 7 Skill Points] It¡¯s a good sum of Exp, but¡­how much did she need to get to level 1 anyways? The [Slime God] thingy didn¡¯t exactly have an Exp bar next to it, so how the hell was she supposed to- ¡­Huh? She was reading it wrong? What do you¡­oh¡­OH¡­Wait, what!? G-G-Gained 2 skill points!? In return from getting her Exp counter stolen from her, every kill grants her skill points to use!? Ah~, what an amazing revelation!...Or, that¡¯s what it seems like at least. Alright then. [Slimy Compendium], hit her up! [Slimy Compendium] *[Randomised Slime Skill Synthesis]* *[Specified Slime Skill Synthesis]* *[Random Lore]* *[Ascension]* Hoo~ boy! Look at all those weird stuff! Now, being serious for a moment, [Ascension] and [Random Lore] wasn¡¯t all that important¡­yet. From a quick glance, the [Specified] skill thing was too expensive to use. Which only left [Random Slime Skill Synthesis]. To put it simply, its like a gacha system where out of a huge set of slime skills, a random one will be selected and given to her. To ¡®use¡¯ this gacha, she needed to spend 5 skill points to do so, which is a reasonable price, yeah? It¡¯s exciting, but also potentially disappointing as well. She could guess one hell of an overpowered skill, but also an absolute trash skill with the same chance. But! Lucky or not, 5 skill points has been used, and time to see what she gets~! [¡­¡­] [Skill Synthesis has been completed. {Slimy Bubble Magic} has been unlocked] ¡°¡­¡­Wow.¡± How¡­much coincidence, huh. She just lost her bubble magic, and now it¡¯s back with an additional slime tag on it as well. Description time! {Slimy Bubble Magic} Lv 1/10 -Synthesized skill. Progression and evolution unknown- Allows you to create cute little slime bubbles. Air density, elasticity, speed, shape, size, and effect can be changed by internal and external efforts As a slime skill, it is extremely weak to magic attacks, so use with caution Pretty much the same old skill, with a slight downside being that its unable to counter magic attacks anymore, which sucks. Actually, how was she going to deal with magic attacks now? Since most(if all) of her skills were now slime based, wouldn¡¯t it make battles against an experienced mage one hell of a mind f*ck!? That¡¯ll be terrible! Well, there might be some sort of magic resistance skill thingy later on, who knows. Anyways, with this new skill of hers under her belt, she went off deeper into the forest, where more enemies lie to be defeated by the new born slime god that is Diana! Or¡­not. ¡°Woahoaah!! T-That was close!!¡± Some might have forgotten this, but back in the very old days, I mentioned something about ¡®wraiths¡¯. These types of monsters were ethereal beings, like Crystal. But unlike Crystal, they didn¡¯t have any physical form and can only be damaged by magical means. As spiritual beings, wraiths are closely related to the world of the afterlife, or the opposite of that, the place we all call ¡®hell¡¯. In there, magic is harnessed, and with that, they use their magic to go around and devour any weak and unsuspecting prey. Which meant that it was the worst enemy Diana could ever have! *Boom! Boom!* The current wraith she was fighting was a spherical floating black orb with a red eye staring out from it. Its one and only attack was its laser beam, which shot out of its red eye and burnt away anything in its path. It moved pretty damn slow, but its long range laser fire covered for that. And since she only had her {Slimy Bubble Magic} as an attack, and since the laser was a thousand times faster than her bubbles¡­well, you get the gist of it. That is, if this was the previous old Diana, but nope~! Diana has been reborn, and with that, she has gained a surge of wisdom and knowledge! Even if it isn¡¯t much. At all Using Crystal¡¯s attacks as an inspiration, she stooped down to avoid another incoming laser and smashed her palm against the dirt, forming a wall of slimy bubbles that wrapped around the wraith. She quickly increased its air density, the bubbles slowly stretching and expanding, looking like its skin was about to pop. The wraith, seeing this, shot out its laser on a wider range, destroying the bubbles standing in front of it. Focus on the words ¡®in front of it¡¯. See, in essence, that thing was only an eye attached to a ball, and while it could turn around to destroy the other bubbles, wraiths were slow. And so, in a fashion similar to Crystal¡¯s [Phantom Iron Maiden], she made all the bubbles rush in and explode at the same time, destroying the spherical wraith in a near instant. *Boom!* it went as its magic diverged and went away. [Enemy has been slain. Gained 270 Experience. Gained 8 Skill Points] With that, the second enemy goes down, and her skill points jump up to a perfect 10! Oh! Also, its an untold nifty quirk of the gacha system, but the more she uses it, the more expensive it gets, the damn thing. Currently, it was sitting at a cost of 10 Skill Points, and she was unsure whether it¡¯ll become 15 or 20 for the next try. Hopefully the former because, my gosh would that be hella expensive. Anyways, enough of that, time for the second roll! [¡­¡­] [Skill Synthesis has been completed. {[Slime Modelling]} has been unlocked] ¡°¡­Uh¡­What?¡± {[Slime Modelling]} Lv 1/10 -Synthesized skill. Progression and evolution unknown- Your slime now holds powers of modification, allowing you to change any living being according to your own childish whims. The cost of this skill depends on how big the changes are, but hey, cheer up, the more skilled you are with this, the less the cost. This skill¡¯s pretty amazing you know~? You could even change stuff down to its basic properties, or DNA for the uninitiated, aka you. Oh right, a DNA is Deox- Was¡­Was this skill description¡­m¡­making fun of her? Okay~, lookie look here¡­She may be a NEET with no sense of knowledge crammed into that little cranium of hers, but~ ¡°Hah¡­¡± No good. Getting angry at a skill description was the last thing she wanted to happen. If anything, the gods would be watching from above, laughing their asses off like this was some sort of comedy or something!! Well, this is a comedy so- ¡°Shut up.¡± Y-Yes ma¡¯am. A-Anyways- ¡°Anyways, I have two new skills now. It¡¯s not enough for me to feel really confident, but hell, why not? Besides, I didn¡¯t just go out into the forest to kill monsters and learn some skills. Nope! I¡¯m here because of what happened to that ¡®tree of life¡¯ as those gods called it. But, man¡­That clone of that some guy sure caused a lot of trouble, huh. If it wasn¡¯t for him, I wouldn¡¯t have to gotten dragged into the abyss at all! Then again, I did meet all those amazing memories and return as a deity, so¡­I guess the debts paid back already~¡± S-She¡­stole my lines¡­ ¡°Anyways, time to go~! My true objective awaits! Umm...This is...uh...A notice? Umm...Well, you see. I...I wanna say something. I messed up. Well, maybe not? Not sure myself, but, oh my god, what have I been writing recently. But, hoo boy~, things are getting reeeaal weird up in here!A case of content theft: this narrative is not rightfully on Amazon; if you spot it, report the violation. So, sorry if any of you get confused. Just comment something in the comments if you want to ask something, and I''ll do my best to answer you! If you have any advice or want to make a review after this next chapter, then go ahead, I won''t mind! I''m still a fledgeling after all! Now, that''s all I want to say...I think. Alright, schedule for next chapter will stay the same as always. See ya~! [49] To Escape Fate ¡°Continuing from last time, I¡¯ve just left the goblin village to go on a simple trip to hunt monsters and see what new things have changed. Turns out, a lot! Being a Slime God-, well, not really a god, but a deity in a sense sure was different than being mortal! For one, I¡¯ve gotten like 500 Exp now, but I haven¡¯t levelled up yet! There¡¯s also the [Slimy Compendium], which¡­Ooh~, man, that¡¯s great!¡± P-Please¡­Let me- ¡°Anyways! After I¡¯ve taken out two stray monsters, it¡¯s time to head for my true objective-!¡± Shut up. Please. The fourth wall has a giant hole on it. Just, stop. ¡°¡­Ugh, fine.¡± Geez. Thank you. *Ahem* Sorry about that. Diana¡¯s still angry over the description from last chapter. As she said, she was currently heading for her true objective. Deep inside, probably around the centre of this forest, Diana with her new Godly Senses, she could feel something menacing sprouting out from there. If she had to describe it¡­it¡¯ll probably feel quite familiar to the inside of that giant withered tree. Actually, take that back. It¡¯s EXACTLY the same thing from that giant withered tree. When she reached the meeting point, she saw a geyser of pure blackness, shooting out deadly vengeful spirits and miasma, or as the gods called it, Malevolence. The miasma went to work on the nature around it, tainting it and killing any that touched it, while the vengeful spirits sought out a new form to take for their own. And, hey! There happens to be a good medium right-¡­right where? Just as the vengeful spirits thought they had sensed something from behind the covers of the trees, when they checked, there was nothing there. That¡¯s because Diana just ran the other way as fast as she could. Being honest~, if she tried to take them on, she¡¯ll just get corrupted and turn into an evil entity! And no one wants that, ey? Well, unless it comes with cool evil lightning powers. Currently, having been reborn to this world, she was too weak to fight those things. In fact, in terms of raw power, Anna could probably wrestle her to the ground no problem, if she wasn¡¯t using her slime powers of course. But, that geyser wasn¡¯t the only one currently sprouting out bad stuff. All around the world, places where Oldruin destroyed kingdoms and countries filled with dread and malice, all of it was coming to strike back. Oldruin? He¡¯s just having a casual chat with Laila, with the latter trying to prove that his actions were terrible, while the former was nonchalantly sipping some nice hot tea, a warm contrast to the unending snowstorm outside. The only reason he didn¡¯t see this as a bad thing, was because monsters and ¡®Monster Races¡¯ would be fine from this outbreak of vengeful human souls. The only thing capable of being taken over are humans and ethereal beings like Crystal and Diana. He, who is not a human(obviously) will not be affected by this. Nor will Laila be. But everyone else, Diana, Crystal, Rei, Anna, and Ilgua will all be victims to this. Gaz is safe, cause he¡¯s an ogre and all. ¡­¡­¡­¡­¡­¡­ ¡°Holy sh*t¡­W-What¡­the f*ck¡¯s that!?¡± Meanwhile, several kilometres away from the forest, things were¡­getting worse. After they¡¯ve killed the f*cker that sacrificed Diana to that magic of his, they stifled their tears and headed back, their heads hung low and their spirits crushed. But what made it even worse, was that, as they were walking, Ilgua noticed something, something¡­huge. The skies were unruly, the winds were fighting, and the earth itself seems to be screaming. This was not any natural cause, this was¡­something else. Then, they saw it, a pillar of darkness that rose from the ground metres away from them. It rose so tall that it broke through the clouds. It was so dark that not even the shadows could match it. It was so powerful, that the Earth itself seems to be at its command. Gaz couldn¡¯t help but let several curse words fly out of his mouth. Forget that bald man, forget Ilgua¡¯s master, forget Oldruin, that ¡®thing¡¯, that was the strongest thing to have ever existed. Oldruin sought to destroy all the bugs of humanity. But humans were strong. Physically they might not, but the fact that they had consciousness and capabilities to grow beyond their limits were enough to make even the gods consider their actions. Due to the mass of overflowing miasma from all the malevolence, the tree that withheld all life in this world was breaking down. Many have claimed that the ¡®end of the world¡¯ was coming soon, Ilgua never believed in those words a single bit. But now¡­holy hell was the world coming to an end. The Extinction, has begun ¡­¡­¡­¡­¡­¡­¡­. Wooh~! Okay! That got dark reeeal fast, ey? But, that was serious, nothing could be done now, the world will be cleansed clean from all the destruction. Whether or not the world could be rebuild, that¡¯s a question no man or god could answer on their own. Hell was about to descend on Earth. Monsters of all kinds were ready to run rampant. The storm of nature was ready to be unleased on a moment¡¯s notice. Humans? Yeah, they¡¯re doomed. But! On the bright side¡­well¡­there¡¯s not really one. Well, maybe the fact that humans will be eradicated from this planet would be a good thing for many. They¡¯re the main targets of this destruction after all. Normally, Diana would be having nightmares and heart attacks from that thought, but¡­She felt nothing. Perhaps, some way through her endeavour of reading and living though all those human lives back in that void, a part of her broke. There¡¯s also the fact that she¡¯s a deity now. Humans were no longer of her concerns. The only thing she should care about now was for her own well-being, and the safety of her friends and followers. Well, the gods said so at least. To this new form of Diana, humans were just another form of monsters. They lived, they had hopes and dreams, and they faced death, reaching their dreams or not. Now that she wasn¡¯t biased from being human herself, humans are just¡­humans. Not more, not less. Right now, Diana was just having a calm fruity snack she pulled out from the tree tops. All this running was making her hungry. While she¡¯s at it, she was also trying to gain her [Slime Magic] back, since it¡¯s an insanely crucial part of her battle prowess. All she was doing was turning her unused left arm into her slime form and pulling out a piece of herself, controlling it and flying it around the place. It worked the last time she did this, so it should work now! (Hopefully) ¡°*Nom* Uh¡­That fruit was poisonous¡­¡± As she said, that fruit she ate was poisonous-, well most of this forest¡¯s life form was poisonous in the first place. She¡¯s a god now though! So something as petty as poison was not going to stop her from having her fun! Hopping up, she hummed softly as she took a glance at her character sheet, pouting as she noticed that her [Slime Magic] was not yet regained. But! She had a loooot of time anyways, so it¡¯ll be fine- ¡°Ah!¡± Just as she thought that, another thought came to flash. Since all humans were going to die now¡­How about Ilgua and Anna!? Will they be killed too!? When that thought came into her head, she grimaced. There was no way in hell she was letting her friends die like that!...But¡­How was she supposed to stop something so inevitable?You might be reading a pirated copy. Look for the official release to support the author. She pondered that question for a while, still playing around with a piece of her slimy self as she made the ball shift its shape multiple times. If she was supposed to help a human avoid something that would destroy all humans, what could she do? She couldn¡¯t come up with a clear answer. There were several possibilities of trying to avoid this fate, but in the end, she didn¡¯t even know how to do them, let alone what the chances of these methods actually working as intended. ¡°Agh!! If only she could just switch races already!!¡± It was frustrating for her, knowing that it was her that-¡­wait¡­change, races? Change¡­Change¡­Change¡­Change! ¡°Aha~! I have an idea!!¡± *Grrrrrr* ¡°Ah. Hello there wolfie~, now, [Slime Cannon]!¡± With the nearby wolf shot down quite easily, Diana returned back to the topic of discussion. Now, some might not remember them, but recall those two monsters back in the world of gods? You know, the giant lava spider and the creepy tentacle monster thingy? Yeah, those that Diana and Crystal had to run away from. If she¡¯s not wrong¡­they were¡­the sentinels of the god of death and the god of¡­magma? Honestly, she kinda forgot, but those monsters were sentinels, i.e. the familiars of the gods! Perhaps! Perhaps. If Anna was made into her sentinel, she could maybe avoid this human consuming devestation! But¡­No, she couldn¡¯t have any second thoughts. The time was quickly coming, and she needed to do this fast! So, after finally disposing of that very dazed wolf she shot out earlier, she happily took some more Exp and Skill Points before running back towards the goblin village. Past the dormant trees and flowers, past the nearby monsters, past the occasional vengeful spirits, and past all the insanity that was going on around her, she ran. Faster and faster, more determined than ever. Finally, after an amazing sprint(which wasn¡¯t really all that fast due to her reduced speed stat), she burst out from the enclosed forest and into the open, where all the goblins joined by Anna stared at her with complete confusion. ¡°Elder!¡± ¡°Yes, Slime Que-¡° ¡°Set up a strong magicb barrier around the village! Bad stuff¡¯s coming!¡± The elder questioned what the slime girl meant by ¡®bad stuff¡¯, but he trusted her nonetheless. And besides, this storm hasn¡¯t been ending, and it doesn¡¯t seem like it¡¯ll be ending any time soon. As he was the only mage in this village, he immediately got to work, helped by his fellow students to place several totems carved out of wood around the village¡¯s vicinity. ¡°M-Miss Diana? What¡¯s wrong?¡± Everything was going just a tad bit too fast for the passive village girl. She had just woken up this morning shouting to her saviour, and now Diana¡¯s back with a worried and somewhat excited look on her face. ¡°Invoke the barrier!¡± ¡°¡°¡°Yes elder!¡±¡±¡± The elder went to work on the gears, and the totem shined with a bright purple light. The six placed totems shot out purple beams of light into the clouds, and formed a hexagonal shaped barrier around the village, protecting it from all things¡­except maybe up. They were now safe, but this wouldn¡¯t last for long. She needed to do it now! But, first. ¡°Anna.¡± ¡°Y-Yes¡­?¡± Anna noticed it, a change in tone for the usually bubbly and happy Diana. Her eyes shone with the wisdom gained from countless years of watching other people¡¯s lives. ¡°Answer me this. Do you hate humans?¡± ¡°H-Huh? I-I¡­¡± Hate. It was a strong word, perhaps appropriate, but a strong word nevertheless. To say she hated humans, the beings that killed her parents and burned her village down, would it be too much? If she hated humans, she¡¯d also be hating herself wouldn¡¯t she? Did that even mattered however? In her most honest opinion, races don¡¯t really have much as to anything. Right now, her friends consisted of a very strong slime girl, a phantom weapon, a ghoul, and many goblins. She also had many friends that were human as well. And while they may have died due to the fire, they still lived on in her heart. So, with her answer found, she answered. ¡°I¡­I don¡¯t. But I don¡¯t like them either.¡± Her voice was resolute, her eyes staring back at her with no less determination than hers. A big goody smile was plastered all over her face, now having complete faith that this would work, one way or another! Alright, time to apply some of that wisdom she got! Gotta look all divine and stuff! ¡°Anna.¡± ¡°Y-Yes¡­?¡± The sudden change in tone and volume spooked her a bit, since she swore she even heard some echoes from her words, but she shook off that initial feeling and returned her eyes towards her saviour, determined, but also afraid of what was truly going on. ¡°The floodgates of hell have been broken, and the vengeful spirits of the past has come to destroy all of humanity. To escape-¡° ¡°Destroy all humanity!?¡± ¡°¡­Ahem. To escape this fate, I offer you, as the Slime God Diana, become my familiar, and I shall free you from this eminent destruction.¡± Casting aside that sudden interruption from Anna there, it seems her words had gotten across, if slightly jumbled up from Anna¡¯s sudden spike of shock and fear. After all, ¡®floodgates of hell¡¯? ¡®Destroy all of humanity¡¯? ¡®Slime God Diana¡¯!? What was with all this sudden drop of information!? Anna¡¯s morning brain couldn¡¯t handle this information overload! ¡°A-Anna?¡± ¡°Muuuuuuuu¡­¡± U-Umm¡­I-Is this¡­No, maybe it¡¯s just her weaboo side that¡¯s coming into play. But¡­Is¡­Is smoke coming out of her ears? ¡­That aside, she¡¯ll¡­give time for Anna to fix herself. Right now, she looks like a lost kitten that just saw its owner throw her out of the window. Well, the ¡®floodgates of hell¡¯ and the ¡®destroy all humanity¡¯ part made some sense if she pitted them together, but ¡®Slime God Diana¡¯!? When did Diana become a god!? Was she lying then when she said she was a slime queen? ¡°Anna¡­?¡± ¡°Hyua!? I-I¡¯m still thinking, m-miss Diana! P-Please waaiit!!¡± Somehow she could just imagine Anna with cat ears and a tail, and just whimpering softly as she tried to sort out everything she just learnt. Somehow she just had the desire to pet her on the head. Actually¡­Yeah, maybe that¡¯ll work! ¡®What¡¯ll work? You¡¯ll have to wait to find out~¡¯ Oi. My lines. Anyways, after some time, and after seeing that there were many eager vengeful spirits trying to break through the barrier to eat her alive, Anna was forced to come up with a quick conclusion to her dilemma, and this was her answer. ¡°I-I¡­I¡¯ll do it!¡± She said it was less conviction than she wanted, but her message has gotten across. Seeing her resolution, Diana smiled happily and created a large jelly of slime, enough to hold an entire human being inside! ¡°Step inside, and I¡¯ll do the rest! Oh, and don¡¯t worry! I¡¯ll be keeping you alive too~!¡± With a gulp, she wiped off some sweat from her forehead and walked into the gooey substance, feeling it absorb her inside as she was dragged into the slime, keeping her inside like a mosquito inside an amber. Slowly, she felt sleepy, and the rest of the world faded around her. On that day, every human on the planet died. There were no survivors. ¡­¡­¡­¡­¡­¡­¡­ What? You thought there would be something else here? Who do you think you are, deciding everything on your own? I¡¯m the narrator here, the master. I control everything. Now now, don¡¯t go to the comments already and start typing every single thing you have on your mind juuuust yet, kay~? I have¡­some interesting information. I ask you this, do you think you¡¯re actually alive, or are you just in a simulation? It¡¯s a hard question isn¡¯t it, won¡¯t be as easy to answer like in the matrix eh? Think about it, think real hard about it. Now, I want to tell you a story, a story about a girl named Diana. Well, she was previously a guy, called Davin. He¡¯s a NEET, a jackass, but ultimately a kind person and hates cheaters and backstabbers. His favourite types of games were FPS games and RPGs. He also happened to like anything Japan related. Anime, manga, light novels, all of that media he consumes on a daily basis. But then, one day, as he was lamenting over his drunkard mother downstairs, he was given a chance to go to another world, and being the stuck up NEET he is, he immediately took the offer, despite having to sacrifice everything, including his gender. She lived her life in this new world, got herself crowned as a Slime Queen, got herself a temporary friend, before she received her first true friend, Crystal. Then, things rolled even faster. She met up with Rei, a ghoul with a like of cooking and eating. They went into Tartarus, got their asses kicked several times, Diana died, revived, and so on. They escaped Tartarus, managed to make their way away from a death god, yatta yatta. They met with Anna, and then Ilgua, and then she met up on her own with a fellow Earthling Gaz, and then sh*t went to the fan. Diana is sacrificed and was sent to the world of spirits and gods. Crystal, being the only one capable to save her, went in. But, alas, in the end, without the silver coin she was given, Diana was unable to pass through into the other side. And then, she was dragged into the abyss. Years after years, eternities after eternities, she spent watching and living the lives of the other people who had been killed and placed into this dark abyss. Slowly, as the stories came to a close one by one, her body broke down, piece by piece, cell by cell. Until finally, she was no more. There in heaven, she realised her love for her friends, and pleaded to return. The gods heard her call, and they gave her a chance. That¡¯s what I¡¯ve been telling you these last 2 chapters, wasn¡¯t it? Sorry to say, it won¡¯t be that easy. ¡°Huah!?¡± It was then, that Diana finally woke up from that simulation. Her body arched back in pain as she felt her system break down once more. The forest she was in, the village she was staying in, the goblins surrounding her, the slime that had Anna inside, they were all gone. Slowly, she slowed down her breathing, trying to calm herself from the numbing pain. Her naked body touched against the clean white floor, one that stretched out into the nothingness. There were no walls, no ceiling, no floor, just, white. Sighing, she looked down upon herself, seeing the many purple cracks spreading all across her body. She poked them, and she winced as more pain coursed through her body. Honestly, while that sudden fourth wall break was weird enough, the fact that she was granted a chance to return back to the world was absolutely crazy! I mean, she didn¡¯t have Slimey to revive her again after all. Of course, it wouldn¡¯t be that easy. Unlike what I explained at the end of the last chapter, getting to be a god without any work is just pure plot armour. It¡¯s dumb. However, the price to pay was high. Remove her empathy and sympathy for humans and all living beings, and she could have a slither of a chance to become a god. But¡­Was that what she truly wanted? ¡°Hah¡­¡± Another sigh leaked out from her lips, wincing slightly as even moving her lips caused her immense pain. Luckily, she had an entire eternity to spend, so healing herself up before another go shouldn¡¯t be too hard. Whether or not this was the correct thing or not, she¡¯ll become a god, and then come back to her friends. She¡¯ll do it! After all, her promise with Rei to cook up some nice food still existed, yeah? If she returns, there was no doubt she would not be Diana anymore. She would just be¡­a god. She may be Diana in name, but not Diana in soul. And that was what truly terrified her. If she wasn¡¯t herself when she came back, would her efforts even matter then? ¡­She didn¡¯t know. But, for now, she¡¯ll just continue what she¡¯s been doing for an entire eternity. Maybe, she¡¯d find the answer in the midst of it, who knows? ¡®Alright! Time to go in!¡¯ With that, she closed her eyes, and began the process once more. [50] Another New World!! ¡°W-Will I be okay, s-senpai?¡± ¡°¡­I¡¯ll protect you. Believe me, ¡®kay?¡± While reluctant, Anna couldn¡¯t help but believe in those beautiful blue eyes. They were clouded and all over the place, but through all that, she could still tell that Diana cared for her. Finally, mustering all her courage and using up all of her NP gauge, she slowly stepped into the block of slime, and let herself be dragged in, feeling Diana¡¯s magic caressing her to sleep. With one final glance to a determined Diana, Anna closed her eyes. ¡­¡­¡­¡­¡­¡­ ¡°Guah!! T-That hurts~¡­¡± Trial number¡­something was a failure. She¡¯s been through this so many times, that she¡¯s forgotten what attempt it was now. Not that it mattered though, since she had an endless eternity to spend here before she finally reunites with her fellow friends and comrades. She slouched down and placed her hands on the floor, breathing roughly as she felt the pain from her failure course through her body violently. Giving a glance at the empty whiteness she found herself in, she couldn¡¯t help but feel saddened by the lonely emptiness this whole place had. The gods gave her one mission: To shed her humanity and embrace godhood, which meant throwing away her emotions and sympathy. But that brought another question. Would she still be Diana by then? And if so, wouldn¡¯t doing so be pointless then? Some eternity before, she finally found her answer and said, ¡°You know, that¡¯s stupid! Basic lessons 101 is to never throw away my humanity to gain power!¡±, which garnered her a nice lightning bolt to the ass from a very annoyed god watching from above. And-, oh, just to clarify, after thousands of trials, she decided that it¡¯d be more fun to make Anna call her as ¡®Senpai¡¯. S-She wasn¡¯t implying anything here! Pinky swears! But, getting someone to call her Senpai wasn¡¯t going to fix anything. W-While it does feel nice to be called that(especially from someone so innocent like Anna), that was just the trials, just a simulation. It wasn¡¯t real. Well, actually, it wasn¡¯t exactly a simulation, because what the gods are actually doing was¡­uh¡­if she heard it right, ¡®creating multiple copies of the same universe to allow her to experience the future, but not directly cause it in the real universe¡¯. Yeah, it¡¯s kinda confusing. Being honest though? This was getting tiring. She¡¯s seen the world die, Anna encased, her other friends drowning in the void, and getting her ass flicked and burnt by the annoyed gods for¡­well, forever. Anyone was bound to get tired! Thankfully, she hasn¡¯t developed any masochistic feelings from getting hit by lightning, so that¡¯s a good thing¡­W-Well, maybe a little. By this point, getting hit on the ass by a lighting strike felt more like getting spanked than anything. It was not something she was proud of. But! Back to the main topic, trying to go back to her friends without shedding her humanity. It¡¯s¡­well, impossible. Not by godly means anyways. This was a perpetual loop of universes that the gods have created for her. A repeating playground formed by copy pasting stuff. However, on the occasions that she did divert from immediately saving Anna, to going to try and meet Crystal and friends, she would always witness this¡­grand appearance of hell. Out from the ground, like some sort of Bifrost knockoff, a tower of black light would emerge from the ground and rise towards the cloudy skies. And then, a surge, no, a flood of vengeful spirits would leak out to drag every human in the world back into hell. By some point, she decided, ¡®Hey, let¡¯s go and explore down there!¡¯ With a cute childish voice, before getting herself another lightning bolt to the ass. It was clear that the gods were warning her NOT to go there, but here¡¯s the important question. Why? She¡¯s been there several times already, but all there is was just a prison cell, with her slowly getting tortured to death. After all, this was just another of the copied universes, right? Why would the gods decide to warn her away from that place? Couldn¡¯t they just, like, uh, wipe that thing off the database or something? But they didn¡¯t, or maybe¡­just maybe, they couldn¡¯t. Now that¡¯s an exciting thought! Going in, fighting against the wills of the gods, and going to the place where all the deceased souls of humanity has gathered up to one day surge out like a bombastic volcano explosion. Just the thought of that was getting her blood pumping! *Bam!* ¡°Atatata!! W-What was that for!?¡± Another lightning bolt when flying from, well, under her, and hit her straight on the ass, causing her to jump and jerk a bit, before landing back down. D-Did the gods manage to break through the fourth wall and- ¡­Huh? Wait, then why¡­ah¡­ I just heard a call from my higher ups. Nope! The fourth wall¡¯s clean and clear! No damage has been spotted nor will be spotted! Or, that¡¯s what they¡¯ve said at least. It seems the gods were just annoyed at Diana¡¯s stupidly big grin. Kinda lame, don¡¯t ¡®cha think? Anyways~, her body¡¯s pretty much ready to go once more. So, with one deep breath, she lied down flat on the whiteness below her, closed her eyes, and began the process once again. ¡­¡­¡­¡­¡­¡­¡­¡­ ¡°Hmm¡­Is the Slime Queen still asleep?¡± This was weird. The goblin elder couldn¡¯t help but think so as he stood in front of Diana¡¯s hut. Usually, she would be the first to rise from her beauty sleep, and that was why he liked her so very much. Her open nature and her willingness to start a conversation was a nice change to the normally silent mornings he had waking up early. But more than that, something felt¡­different than usual. The air that surrounded this seemingly peaceful rainy morning was not normal. Something was- *WOOOOOSHH!!!* ¡­Alright, that settles it. Something was definitely wrong here! Just then, when his mind was beginning to slip, Diana suddenly burst out of her hut and sped off into the forest. If he wasn¡¯t stabbing his wooden stick into the ground, he could¡¯ve fallen over just then!Ensure your favorite authors get the support they deserve. Read this novel on Royal Road. He would¡¯ve gone after her, but¡­His back¡¯s been giving out recently, and his old age certainly hasn¡¯t helped. If anything, it¡¯s a shock that a goblin his age was still up and about, even using magic and all. ¡°Better leave it to ¡®em youngsters, they say, but not for me! I¡¯ll do it myself!¡± He shouted, accidentally waking up several nearby goblins and getting him some weird looks from his people. Enough of the elder¡¯s personal life, Diana¡¯s in a rush here! Judging from the odd stirring in the air, it seems like the gates of hell hasn¡¯t opened just yet, but the signs were already here. At this time, Crystal should be¡­uh¡­walking back all depressed and stuff, right? And then, bam! The gate appears, vengeful souls spills out everywhere, and all hell breaks loose. Extinction of humans happens, Diana goes to protect either Ilgua or Anna, and then fails the trial and gets shot with a dosage of pain. But this time! This time, she¡¯ll drop in, find herself in a slightly better situation, and then finally- ¡°Guhah!?¡± Just as she was getting hyped, she trips on a stray tree root, face-plants herself into a poisonous plant, and attracts the attention of two monster monkeys waiting above her. The monkeys exchanged sad glances at the girl, before they jumped down to strike- A puddle of slime. *¡­Gugu?* The monkeys shared a confused glance at each other, before they proceeded to jump into the puddle of slime and turn it into their own personal slime bath. Oh, and also, just so it¡¯s easier for her, she already stripped herself naked back in the hut. Keeping pace, she quickly made it out of the forest, her eyes shining with determination as she saw the black tower of light ascend into the clouds, causing the muddy clouds above to circle around the piercing tower of ominous light. The gates of hell have opened. ¡°No time to waste then!¡± Knowing that she¡¯d be receiving another stream of lightning strikes to her ass if she fails this, her determination was strengthened even further as she made a run towards the tower of black light. Her lips curled into a wide grin as she ran closer and closer. She soon managed to catch a glimpse of Crystal and her group, looking utterly terrified by that sudden appearance of the gate. She shot a quick [Slime Cannon] at them to say hello as she continued running. Then, souls, hundreds and thousands of souls began spilling out of the light, an overflowing cauldron of souls spilling its contents. The second stage has begun. And in a minute or so, the third stage will begin. And by that point, trying to enter the gate herself would be too hard. The gods, finally seeing that she¡¯d have a high chance of succeeding this time around, sent down a volley-, no, a legion of lightning bolts down onto Diana. One hit from that thing will kill her, there¡¯s no escaping that fact! Then, a stroke of intelligence shined in that brain of hers, and she immediately went to work. In the span of a few seconds, she turned into her slime form, compressed a small part of her slimy self into a tiny ball, added in her own consciousness into the ball, and fired it out! *Wooosh!* It went, as Diana, in teeny tiny [Slime Cannon] form, went flying through the air at intense speeds, dodging the previous strikes of lightning, and sending her flying straight into the tower of black light. The gods hissed as they sent more lightning strikes down upon the Earth, but they could do nothing now. The plan was, a success! ¡­¡­¡­¡­¡­¡­¡­¡­ ¡­But, y-you know? This was definitely NOT what she was expecting to see when she first jumped in here. As of this current moment, she was chained up to the back of a wall, with only a single floating flame lighting the room from above. The stones were purple in colour, and the air was thick and felt more like jello than actual air. As for how she got here, well¡­¡­ ¡°Ohoho~, another beautiful specimen!¡± ¡°Muu¡­?¡± After she disappeared into the blinding black light, she found herself being carried, or that¡¯s what it felt like at least. Her vision was still blurry then, but she could see herself being moved, watching sets of purple stone bricks pass her by. Then, a metallic clunk was heard, and after several more metallic clunks, she found herself in this position, arms and legs spread wide, and chained up back against the wall. ¡°Now now~, my cute little toy, be a good girl and stay here okay~? I¡¯ll prepare my toys first~¡± ¡°¡­T-Toys¡­?¡± And now, we¡¯re back here! She didn¡¯t manage to see who carried her here and chained her up, but by the voice, it seems like her kidnapper was a woman. ¡­Oh, and also, those¡­¡¯toys¡¯. She had a bad feeling about this. But! She had a secret weapon! It¡¯s time, to change into her slime form! Bam! ¡°¡­Uh, bam!¡± Silence. A single drop of sweat formed on her cheeks, then countless more followed. She tried turning herself into slime, and it didn¡¯t work! Not even a single part of her body changed into a slime! She tried over and over, but no matter what she did, her body didn¡¯t respond. The obvious answer would be these chains binding her back. Before she could try and break away however- *Bam!* ¡°I¡¯m back~¡± Slamming the door open with a perhaps too happy face, the woman who carried her in earlier came smashing back into the room, this time with a paper bag of¡­stuff in her hands. Now that her head¡¯s clear from all the dizziness caused by the black light, if she could describe her in one word, it¡¯d be ¡®gorgeous¡¯. Cause, seriously, she looked beautiful! Long purple hair, striking red eyes, a slender build, an aura that asserted dominance, and a rack that easily outshined Crystal by miles. If she wasn¡¯t wearing that too happy lewd face, than she would¡¯ve called her the most beautiful woman in the multiverse. She had a REALLY bad feeling about this. Slowly, she took out a certain phallic shaped object, and- *Much lewd noises and moans later* ¡°Hah~¡­Hah~¡­Ngh~!!...Hah~¡­¡± ¡°My my~, you¡¯re so cute~¡± H-Honestly, this woman was¡­well, despite what she believed, she was very good with her hands, let¡¯s just say that. Seeing that Diana was very exhausted from the ¡®torture¡¯ session, the woman giggled and withdrew herself, packing the slimy object she pulled out earlier back into her paper bag. She closed the door behind her and left with a very happy face. But, since that woman wanted to get a little feisty, she decided to let go of her restraints to get a better vintage point to assault her from. As you might have guessed, this was the perfect chance for Diana to escape! ¡­Well, she was still a bit tired and numb from the experience, so she decided to rest a bit. After some of her initial fatigue lessened, she forced herself to turn into her slime form and squeezed herself out using the little gaps under the door. She was a bit too tired to change herself back, so she decided to stick with her slime form and begin her escape. Thankfully, it was a one-way hallway, so all she needed to do was walk forward. Then again, there was the chance of her accidentally bumping into that woman again and getting herself captured yet again. But, to hell with it. She felt so incredibly hot right now that her mind wasn¡¯t working as well as it should be. Not that it usually works normally anyways. For once however, no! It didn¡¯t instantly lead her to getting assaulted again! Instead, all there is was a simple magically enchanted iron door, specifically created to block most physical attacks. Sadly, Diana¡¯s a slime, so all she had to do was squeeze herself out from the little gap on the bottom, and she¡¯s out! And¡­man, while she knew this was a place somewhat like hell, she didn¡¯t expect it to look this¡­awesome. All around her stretched a plain of purple grass, decorated with several acacia-like trees with black wood and purple leaves. The sun was¡­well, there¡¯s no sun, but the lighting was still bright enough to allow her to see. When she turned around, the iron door she just squeezed out of, was no longer there-, well, placing her hand where the door was, she felt the metallic feeling against her skin, so the door¡¯s there, just hidden. It¡¯s probably some magic again. Thankfully, this place was neither hot or cold, so even in her naked exposed state, she didn¡¯t feel all that uncomfortable, with the exception of maybe the ache in between her legs. ¡­She didn¡¯t need to explain further, okay? But, to reflect a bit, Yep! She did it! While she did end up in a cell(again), she managed to free herself this time. Being kept inside a cell might be a universal constant, but her not escaping sure wasn¡¯t! Now, where to go? With some excitement, she looked around at the purple grasslands, trying to spot any points of interest. Some time later, she got herself to slither up one of the few trees in the area and looked around from a higher vintage point. And far far faaaar~ away in the distance, she could just barely see it, the little tip of what seems to be some sort of¡­skyscraper? It¡¯s built completely out of stone bricks for sure, but the shape it had reminded her of the few skyscrapers she could recall from her life back on¡­on¡­ On where exactly? ¡­It¡­seems like, some of her memories were missing now. That¡¯s¡­somewhat concerning, but now that she¡¯s thought about it over countless eons, was losing memory of her old home planet really all that devastating? The close friendships she¡¯s built were all on this new world she found herself in, so why should her past be dragged into this as well? That¡¯s what Diana genuinely felt like. What¡¯s gone is gone, but what¡¯s to come was much a blur. Like the quantum uncertainty principle, the truth of the future remains clouded in questions and mysteries, until she finally sets her eyes upon it and sees what it truly is. Besi-, oh, and for those shocked that Diana understood what the Quantum Uncertainty Principle is, she learnt it from a scholar that reincarnated into this world and then died. Why she took notice though is a question even I can¡¯t answer. That all aside however, it was now high time for her to start walking! Slithering her slimy self down from the tree, she finally remembered to change herself back into her human form and begin walking. Being a slime was nice and all, but the slimy feeling of¡­everything really just didn¡¯t feel ¡®right¡¯. Little did she know that this trip will ultimately end up causing all humans to die-, no, she knew this was going to happen. She simply realised the futility of doing so and moved forward, ready for the consequences. Determination burning in her serene blue eyes, she began walking towards the object of interest. [51] A New Status? The void world. It is the name of the place where none was supposed to exist, yet life appeared despite that. It was the realm without the gods blessing and protection, yet there life and culture blossomed. A plain of purple grass that stretched farther than the eye can see. A murky sky filled with black clouds. A lack of movement in the wind. A soft hue of light despite the absolute desolation from sunlight. A world that was far bigger than anyone could ever imagine. Haunted with mysteries and legends. It is said to be a world of intersections, where many paths come and go through these lands. Without the god¡¯s constant surveillance, many problems frequently arise from seemingly nowhere, but that was simply how every day is. As such, this was a place filled with many disturbing, yet also fun and interesting things. If you think about it, it ain¡¯t so different from the world above, was it? That was what Fyorei believed at least. Mustering energy into his sleepy body, he jolted up from his bed and raised his arms into the air, the bed sheets he was sleeping under flying off to land on a nearby chair. Blinking several times, he hopped down from the bed and dusted his clothes off. Rushing over to the mirror, he quickly got a look on himself. Pale blue hair, bright red eyes, a good physique despite his relatively ¡®young¡¯ age. He did several different smiles to pump himself up, before he put on his red mantle and left his small cottage. ¡°Haa~, another good day!¡± He shouted to no one in particular as he waved his arms around. As a denizen of the void world, he¡¯s gotten used to the immense darkness this world brought. It¡­is quite brighter than usual however. He wondered wh- ¡°Hmm?¡± Then, he spotted someone. A girl, long black hair, blue eyes, cute face, pretty good bust, and most importantly of all, completely naked. ¡°He~, she¡¯s not half-bad!¡± To say he¡¯s excited would be an understatement! In this world, being naked wasn¡¯t that significant, since this world seems to not understand this thing called ¡®shame¡¯, and a lot of people just like to show off their bodies to the public. But, as a blossoming young man, he¡¯s got this thing for naked young woman. Call him a pervert or anything, he¡¯ll still puff his chest out in pride! By that point, the girl suddenly shivered, and promptly turned her head towards him, her eyes staring right into his. There was a quick sense of fear in her eyes, before it changed to a simple look of slight disgust and intrigue. ¡°Hey~! Pretty girl, wanna have some fun~?¡± ¡°Huh? U-Uh, no thanks! Bye!¡± It took her a moment to realise that he was trying to ask her to ¡®play¡¯ with him for a bit, but, nope! While getting f*cked does feel pleasant, she knew from the several(many) experiences she saw in that place, let¡¯s not indulge in that just yet, yeah? She tried to turn back towards her path and walk away, but before she knew it, Fyorei was already in front of her, his hands stretched apart to block her path, his smile still as wide as ever. ¡°Oh, come on~, it¡¯ll feel nice!¡± ¡°I know that! But not now!¡± ¡°Hmm? Do you have to go somewhere?¡± When those words reached her ears, she stopped and considered for a moment. Why was she so fixated on going there? Was it just to fulfil her curiosity? No, it¡­she felt like something was calling her, all the way from over there. Well, she did come here to try and return to actually ¡®being alive¡¯ and all without throwing away what makes her human, but¡­something of fair importance was giving her the flare of attention. ¡°Well, kinda. I mean, it feels like that, I guess?¡± ¡°¡­Woah, so you¡¯re not up for se-¡° ¡°No. Not now.¡± Was this guy so stuck up with having s*x with her or something? She just had to ask herself as she sighed. This was just wasting her time. And besides! She just got ¡®played¡¯ on earlier by that woman, so no! But then, instead of looking discouraged, his eyes simply flared on with even more fire inside it, as if her denial had just spurred an even greater conviction inside his heart. ¡°Say? If you¡¯re done with whatever you¡¯re doing, wanna have some fun then?¡± ¡°Huh? Oh, uh¡­¡­Well¡­Sure, why not.¡± The two exchanged smiles as they introduced themselves. Once Fyorei heard her name, he asked whether she wasn¡¯t from around here, to which she simply answered, ¡®Yep! I¡¯m from this place called ¡®Earth¡¯. You won¡¯t find it around here, trust me.¡¯ On their way there, they encountered some random monsters. Bug-types, floating rocks, a human mannequin for some reason, and a floating black glove that always went for their ass. In these battles, she learnt two important things. One, Fyorie, as much of a sexually frustrated guy he is, was no push-over. He uses his fists to shoot out balls of condensed air to explode in the enemies¡¯ faces, and when they were fighting that mannequin, which was oddly fast for something so rigid, he conjured this cool looking red whip and struck the thing down with ease. And secondly, she learnt how absolutely underpowered she was. In all these encounters, except for the glove one, she¡¯d always get quickly overpowered, even with her slime powers backing her up. Seeing that she was having a hard time, she was about to check on her status, but- -[ERROR ERROR ERROR ERROR]- ¡°H-Hue!?¡± What came back however, was a loud beeping sound accompanied by a line of ¡®ERROR¡¯s that ran across her eyes. She tried over and over, but all she was getting was the same failure signs and an increasing headache. ¡°Woah. What¡¯s wrong girl?¡± ¡°Huh? Oh, uh, not-¡­I¡­see.¡± ¡°¡­?¡± The sudden stop earned her a strange look from Fyorei, but it matters not! That was because, This was a world without the gods¡¯ aid and blessing. And because of that, this system that came to be known as the ¡®status¡¯ couldn¡¯t be accessed in a place like this. It also explained why she didn¡¯t seem to be getting any stronger from killing these monsters she¡¯s run into. What it didn¡¯t explain however, was why her Slime Form still worked despite the lack of her status. Was it because she¡¯s ¡®technically¡¯ a slime god now? Whatever the case may be, at least she had something to help her survive here¡­Because holy f*ck was this place hard! F*cking Dark Souls-, no, ASIAN Level. If Fyorei wasn¡¯t here, she¡¯d be dead a thousand times over!Unauthorized usage: this narrative is on Amazon without the author''s consent. Report any sightings. ¡°Ne, Fyorei, can you use your status?¡± She asked it casually, but for the first time since they¡¯ve meant, which hasn¡¯t been all that long, he turned to face her with a ¡®somewhat¡¯ serious face. He was still smiling all around, but his eyes were not joking around. ¡°Diana. You¡¯re not from here, are you?¡± ¡®You asked that 30 minutes ago.¡¯ And to that very important question, she happily answered, ¡°Yep yep! Did you not notice?¡± ¡°You¡¯re not scared of being turned into a s*x slave?¡± ¡°Nope~! ¡®Sides, I can just kill myself, and all¡¯ll be good!¡± She laughed wholeheartedly as she placed her hands on her hips, basking in the enjoyment of seeing his grin break down into a look of awe and confusion. It¡¯s a bit of a habit, but once you¡¯ve seen enough, seeing things break becomes quite fun, you know? It wasn¡¯t long before Fyorei joined in on her laugh. ¡°Haa~, you¡¯re quite a daring girl, aren¡¯t ¡®cha?¡± ¡°I¡¯ve taken countless lightning bolts to the ass for going against the gods!¡± It almost felt like she was just making it up, but seeing as there indeed is a godly aura swirling around her, albeit a very small and transparent one, it seems her claims of being associated with gods wasn¡¯t a fluke. Which only served to make him want her more, not just in bed, but also to see what it was that she¡¯s been so adamant about. He grinned widely, already imagining just what chaos this one very lively individual will bring to the table. Perhaps she would be the one to spur something interesting in his seemingly stagnant life. ¡°Anyways, can you use your status?¡± ¡°Oh right, you asked. Well, yes and no. The status you¡¯re familiar with¡¯s probably the one with all the levels and stuff, right?¡± This spurred the growth of a question mark in her mind, since, well, this status thing was a creation of THE GODS, so by the way that he¡¯s saying it, was there some new system they had? ¡°The one here¡¯s slightly different. Since we¡¯re denizens of the void, we don¡¯t have the blessings of the common gods, which then means we don¡¯t have ¡®statuses¡¯. But one genius guy went on to create a system to instead turn the system into a physical object and distance it from the connections of the gods. It¡¯s somewhat like¡­this.¡± As he finished explaining, he reached into his back pocket and pulled out a thin slate of black steel, with white words carved into it. Upon further inspection however, she could see numbers and stats, just like the status! Name: Fyorei Class: Whip Master Lv 175 Subclass: Aero Master Lv 108 HP: 10890/10980 MP: 9800/9800 SP: 9000/9000 [Strength]: 2097 [Tenacity]: 2245 [Agility]: 2108 [Control]: 1976 [Dexterity]: 2247 [Mentality]: 2001 {Skills}: [Whip Mastery Lv Max], [Air Control Lv 70/100], [Sexual Drive Lv Max], [Void Whip Lv Max], [Void Walk Lv Max] Obviously, the first thing she noticed was the absurdly high numbers. Well, incredibly strong beings had even crazier numbers, from what she¡¯s seen at least, but, damn~, seeing it from her own eyes for the first time is just¡­amazing. The next thing, and more importantly, she noticed that several things had changed. Most notably, several of the original stats, like [Wisdom] and [Longevity] were missing. For the latter, it¡¯s probably because Void People were immortal in a sense. But for the rest? Who knows. After that, the {Magic} and {Titles} sections were missing as well! Oh, and she just barely noticed it before she looked away, but [Intelligence] had been switched out for a new one called [Control]. ¡°Can¡­Can I get one?¡± ¡°At one of the capitals, which there happens to be one just 50 miles from here.¡± ¡®5-50!?¡¯ Now that she knew how long 1 mile actual was, she wondered if she¡¯ll be able to get there without fainting or losing the nerves in her legs. ¡­¡­¡­¡­¡­¡­¡­ Idiot. It¡¯s a word that Fyorei has been critically associated with, especially by all of the people he¡¯s worked with in the past. It was not just a mere word for Fyorei, but an emblem and a trophy he proudly holds up to his chest. And oh boy was he ever so excited to hear that someone else shares that! ¡°S-Seriously¡­? You died, went to the afterlife, became a god-in-training, then decided that you wanted to go back, got you ass spanked several times with lightning, and then threw yourself, a GOD, voluntarily into the gates? I-¡­I might have to up my game¡­¡± ¡°Ahaha~, dumb, isn¡¯t it!?¡± ¡®Sure is¡­¡¯ He thought silently as his eyes hovered over her body-, her naked body. While it was obvious that she wasn¡¯t a void denizen by a long shot, especially with shoddy powers like that, but he wasn¡¯t expecting her to be a god! And a ¡®Slime God¡¯!? What kind of eroge would that even make!? Backtracking a bit, after around 5 miles of walking, Diana shouted out that she was bored and decided to tell her story. They had some monster attacks here and there, and since Fyorei was a bit too interested in listening, they did get hit from time to time, but it¡¯s mostly fine. By the end, Fyorei was laughing with no regard of attracting even more monsters from the environment. They got along pretty well if Diana had to say so herself. His carefree nature, which lead to him becoming the s*x person he is now, and his oddly charismatic persona made them quite a convenient pair. Soon enough, the remainder of the peaceful idle chat they had after the story ended, and with it, so did their walk through the empty plains of purple grass. And¡­well, she¡¯s¡­surprised? She wasn¡¯t expecting to get hit by a wave of nostalgia, especially with that nostalgia coming from her time on Earth, not in that fantastical world. Rising out from the ground were hundreds of black skyscrapers, built at the side of an oddly modern earth-like street, with several street lights placed at the side at every metre or so. If she had to give an example¡­it looked a lot like modern Tokyo. ¡­Oh, she never went to Tokyo by the way. She just knew from the countless pictures she saw on Google as she cried her tears out from not being able to go there. Ah~, the pain stings so much in her kokoro that she was actually crying some tears out. Now now! From what Fyorei¡¯s spoiled from his little tid bits, he said that she could get a status card of her own by going to the biggest building in the city. And since there¡¯s that enormous obelisk that was built just to stand out, pretty sure she knew where she¡¯s going. But, still though. She did say that the place looked oddly familiar to Tokyo, but after seeing a random ramen and curry restaurant, along with some cute looking figurines, she¡¯s starting to question that. On the other hand, this was great! This was an otaku¡¯s dream of a dreamland! Well, she didn¡¯t have any currency right now, but she¡¯s bound to get some later, right! She was also beginning to wonder if there¡¯s the equivalent to Akihabara here too¡­ Anyways, with that out of the way, it¡¯s time to head inside the city! And, you know what? Fyorei¡¯s absolutely right. Everywhere she looked, she would see many men and women, girls and boys, with absolutely no regard for their under parts being exposed to the whole void world. Which, made it quite odd that Fyorei¡¯s one of the few actually wearing clothes. She asked about it, but all she got was a warm finger to the lips, and a rather awkward smile that didn¡¯t fit in with his out-going personality. Didn¡¯t last very long, as he soon reverted back to his usual big grin. ¡®Odd¡­¡¯ She thought as the two stopped before the conspicuously large skyscraper to dwarf all skyscrapers. The aesthetic was quite similar to a movie called Tron, if anyone remembers. Heck, when they got close, the doors even slid open! Modern style! Meanwhile, the inside was¡­fascinating. When they went in, the walls around them seem to disappear, and what surrounds them was a patch of blackness, decorated with stars and galaxies. She should¡¯ve been startled by the fact that she¡¯s walking on an empty vacuum, but the fact that this place even knew what a ¡®galaxy¡¯ is was amazing. From the knowledge she gathered from all the people she had the courtesy of witnessing, the knowledge in Astronomy was still very lacking. And¡­well, there was some more things she wanted to talk about, but let¡¯s focus on getting her status card first, okay? Now, the process was¡­slightly¡­uh, frustratingly pleasurable. To simplify, it went something like this: When they went up to the counter and spoke to the lady sitting behind it and casually polishing her nails(who was also naked), they were brought to a ¡®special room¡¯ and the woman asked Diana to place her hand atop a small stone obelisk. Seemed normal enough, right? That was, until a transparent blue slime started to surge out of the obelisk and engulfed her, before it began to¡­¡¯play¡¯ with her. Many moans, pants, and buckets of love later, she was finally dropped out of the slimy substance, left to pant heavily as she tried to recover. Having received all the information it needed, the slime went back into the obelisk and began the creation. Like something straight out of a sci-fi movie, the thin slab of black material was created via a blue light that shined out of the top of the small obelisk. And after that, words began to carve itself upon the empty slab, and walla! Done and dusted! ¡°Wahaa~!¡± With shining eyes, she grabbed her new status plate and stared at it happily. Name: Diana Class: Slime God Lv 1 Subclass: HP: 60/60 MP: 45/45 SP: 45/45 [Strength]: 21 [Tenacity]: 23 [Agility]: 22 [Control]: 20 [Dexterity]: 22 [Mentality]: 23 [S*ki%# Po&!ts]: 0 {Skills}: [Absolute Slime Transformation Lv 1] {Slimy Compendium} The one thing you might¡¯ve noticed, is that there was some glitchy text there, which was her [Skill Points]. Since that¡¯s a concept that doesn¡¯t exist here but Diana needs it, and she¡¯s also a newby god, it happened to be there, albeit distorted. There¡¯s also the {Slimy Compendium}, which was an addition only she could have. And lastly, she was so weak compared to Fyorei that it wasn¡¯t even funny. Now, ¡°Wanna have s*x now?¡± ¡°No.¡± Is not the time for that. She needed to find whatever it was that was calling her, and it was getting bigger, louder, and more obnoxious. Her godly sense was tingling, a phantom ringing of a bell was pounding her head, and this was obviously for the next chapter. Time to go! [52] Levelling Up, All Over Again! All she recalled was seeing a bright black light erupt from the centre of the village, engulfing everything as it¡­it¡­ Huh? What village was it again? Her mind felt¡­blurry. She did her best to recall what happened, but no matter what she did, she would simply see emptiness, a black empty void. No, not yet. She tried to remember once more. She thought long and hard, about how she first saw herself being saved from the bandits by Diana and¡­ Who¡¯s Diana? She felt like she was someone important, and¡­and¡­a¡­nd¡­ What was she thinking about again? Could she even think? What¡¯s her name again? The girl couldn¡¯t remember anything, or perhaps she didn¡¯t have any to lose in the first place. She simply opened her eyes to see herself kept inside a small bedroom, with several other girls, their eyes looking just as lifeless as hers. It was a simple room, with a desk, several small beds, and a light bulb to light the area. The other girls watched her as she awoke from her sleep, looking at her curiously. None of them were wearing clothes. Somehow, she felt like she should be feeling something because of that, but all she felt was nothing. They all had varying hair colours, hairstyles, body figures, skin tones, and many other minute differences. But they all had one aspect. Their eyes were empty grey, a mere empty shell. Why did that matter anyways? Then, the door opened, and in came a beautiful woman. Her hair was a luscious black, her eyes were red, and her body had all the curves in the right places. Her lack of clothing only served to emphasize her natural beauty, giving her a sense of awe, even for the shortest of moments. ¡°Lost 0189, follow me.¡± She spoke, her voice echoing with magic. The girl felt obliged-, no, her body simply stood up from the bed and followed her out of the room, the door closing behind them as they left the other girls behind. Stepping out, she was greeted into an underground area, with countless lewd photos and brochures. The walls were a clean metallic black, and neon lighting lit the inside quite well. It was¡­she didn¡¯t have any thoughts on it actually. More like she didn¡¯t have many thoughts at all. But that aside, standing across from them were a pair, a male and a female. The man had a smug look on his face, his hand rubbing his chin as he evaluated with his wise eyes the worth of her beauty and how good she might be in s*x. The girl however, had an ecstatic look on her face, and her lips were curled up into a wide smile. Like the woman, she was also naked. Her eyes were a clear blue however, unlike the man¡¯s red eyes or the girls(and hers) blank grey. Then, she called. ¡°Anna~!¡± Diana had expected a full happy reaction from her, but all she had in return was silence, and a strange look from the woman as she was waiting for her decision to ¡®buy¡¯ her or not. She couldn¡¯t help but feel saddened about it. She simply held a pained smile on her face as she looked upon what was once Anna, a friend she had saved from a band of bandits. It was to be expected however. Any human, or anyone with a soul actually, who were dragged in by the other vengeful souls and were put into the gates would be stripped of their minds and spirits, leaving them an empty husk to wander in this deadly world. They are known as ¡®The Lost¡¯ and can be found everywhere, especially after that recent fiasco from Oldruin that caused all of this. Of course, since the world was so hostile outside of these cities, they would be easily killed if no one were to come and bring them in. Here in this world, where no one really gives a damn or two about anything, the lost are treated as ¡®slaves¡¯, but in a kinder and more acceptable way, like maids of sorts. Of course, anyone could just ask them to do whatever, but not for physical labour and stuff. They can teleport. Denizens could ¡®buy¡¯ these lost ones for a ¡®price¡¯. What these ¡®prices¡¯ could be¡­well, it depends from person to person really. Now¡­ ¡°Are you going to take her? Seriously, this is wasting my time.¡± She softly nodded at her words, and the woman smiled, her bright red eyes glinting with excitement. With no words said, she simply made a pair of scissors using her fingers and crossed them over one another. That was the price Diana needed to pay to get Anna back. And¡­well, seeing what she meant, she blushed. S-Seriously, what was with everyone here? She wondered as she followed the woman to another room, leaving Fyorei behind to stare awkwardly at the lost soul. ¡­¡­¡­¡­¡­¡­ ¡°Ah~, I have to say, she¡¯s pretty good with her hands.¡± ¡°Ho~?¡± While Diana was resting her soul back in the other room, the woman and Fyorei was having a nice ¡®casual¡¯ chat as the silent and emotionless ¡®Anna¡¯ stared on. With this, the first payment has been confirmed, and next came the trial run, where Diana had a total of 2 weeks to ¡®test¡¯ out her bought goods before the woman charges her the full price. But, going back a bit. After Diana had gotten her status plate, she and Fyorei moved on towards a building that stored and kept new ¡®lost ones¡¯ and sold them out to the public. When she stepped inside, the feeling only became louder, and her body felt compelled to move towards the basement. After an exchange between her and the woman and a promise to ¡®play¡¯ a bit, the three headed into the basement, and that came to be the point of highest interest. She waited with anticipation and tension building to a crescendo, before she finally got to see Anna, or, at least the body of Anna, stepping out of the door with empty eyes. This was what happened to all the humans. All of them. She was sad. That¡¯s a given. But through her many experiences in the void, she¡¯s seen the world as her friends did, and truly, the worth of a single life here was tiny. Death happened everywhere, and there was no law or government to try and protect everyone.Reading on this site? This novel is published elsewhere. Support the author by seeking out the original. It¡¯s kill or be killed. That was why she could accept it, seeing her friend now lifelessly standing before her. She dearly wanted to try and bring her old self back, but without her soul, she knew something like that was impossible. On that note however¡­She wondered how the world was handling up there¡­ Alright! Back on track! After Diana managed to recover herself, she exchanged a quick conversation with the woman before she left, now with Anna to protect her as well. Fyorei¡¯s staying behind for a bit, since he¡¯s planning to have some fun with some eager girls he met back on the streets. The pervert¡­ Anyways! Now that she¡¯s out of the city, she went out to fight some monsters, But¡­ ¡°C-Clooosee!!¡± *Wush!* A swift kick went over her as she bent down and jumped away. As soon as she landed however, the mannequin she was now fighting immediately closed the gap and kicked her in the abdomen, instantly sending her flying back! Or so it thought. The body that was sent flying immediately broke apart into a small puddle of slime, and the real Diana assimilated a distance away, her slimy form glistening with slimy sweat. You see, if she compared their strengths, this one oddly agile and flexible wooden mannequin had the power and speed of one of the transformed ¡®sisters¡¯ back in that one section of Tartarus! She was level one damn it! Anna, since she was a new ¡®lost one¡¯, she was a level one as well, albeit with stronger physical strength due to her being a ¡®lost one¡¯. She literally just got her like, 5 minutes ago, she¡¯s not letting her die just yet! Her mind flared on as she wracked her brain for tactics to use, as her eyes watched the mannequin tear off its left arm and swing it at her. The magical wooden piece flew at her at the speed of aya¡¯s danmaku, even burning a bit from the air friction. She easily morphed to evade the incoming danmaku shot, before she tore off a bit of herself and fired it, maximising speed over attack. The high-velocity slime bullet made impact, but hardly a scratch was made on its enchanted wooden body. Time to go all JoJo! The mannequin jumped in and sent a flurry of attacks, using its one arm and two legs as it spared time to wait for the arm to boomerang back to it. Seeing the incoming flaming arm however, Diana had a neat idea to try out. She jumped back a few metres and shot a small [Slime Cannon] at the incoming arm, sending it just slightly out of path and causing it to crash into the mannequin¡¯s hip. *Boom!* A resounding explosion as the two pieces of wood collided. Diana shrieked as she shielded herself with her arms, while Anna simply watched, with no regards as pieces of debris hit her all over. Out from the dust cloud, the mannequin came, its hip burnt and broken, but still mostly intact. Its arm was reattached as well. But Diana was not afraid. Using her quick wits, she ducked under an arm swing and stuck some slime onto the mannequin¡¯s legs. Jumping back, she turned her left arm into a long slimy whip and swung it, spinning around the mannequin¡¯s burnt hip as the tip of the whip flung back and merged together with her. Sensing danger, the mannequin broke out of the slime on its feet and lunged at her! But as she dodged to avoid it, she quickly began spinning the attached slimy rope, causing it to grind against the damage on its whip. Sparks began to fly out as an incredible amount of friction accumulated in one section, quickly catching the wooden hip on fire. The mannequin moved erratically, lunging at her with its two arms ready to tear her slimy self apart. But this was her victory! As the slimy rope burnt through the hip and broke the mannequin into half, separating the hip from its torso. Fire caught onto the magical wood as the remains of the mannequin turned to ash, and with that, [Enemy has been slain. 97 Skill Points gained] [Congratulations! You are now Level 37! Stats have increased] Her victory was assured! ¡­You know what. That was actually a pretty standard and regular fight for once! That aside, she jumped by¡­by¡­uh¡­36, levels? Pretty sure. Now it¡¯s time to see just how her stats have improved! Name: Diana Class: Slime God Lv 37 Subclass: HP: 340/340 MP: 335/335 SP: 320/320 [Strength]: 108 [Tenacity]: 116 [Agility]: 112 [Control]: 107 [Dexterity]: 112 [Mentality]: 116 [S*ki%# Po&!ts]: 97 {Skills}: [Absolute Slime Transformation Lv 1] {Slimy Compendium} Wohoo~! Boy, oh boy ! Now that¡¯s a stat jump! Now, since she won¡¯t be getting to many places with just her slimy form, it¡¯s time for a skill rush! [Use Skill Synthesis 4 times? 90 Skills Points will be used] The scaling for the cost of each skill increases as she uses it more, but she¡¯s still capable of using it 4 times, so that¡¯s already good enough! She was quite excited though, since she¡¯s deviated so much from her original path, there¡¯s no telling what skills the gacha system will give her. The first two are usually the bubble slime one and the transformation one, but who knows? Maybe she¡¯ll get something different! [¡­¡­] [Skill Synthesis has been completed. {Slimy Bubble Magic}, {[Slime Modelling]}, {[Slime: Enhancement!]}, and {[Slime: Holy Flame!]} has been unlocked] Oookay~, so¡­the first two¡¯s the same then. That¡¯s something she knew well at least, but enhancement and holy flame, dayum! Now those are two elements she¡¯s never even heard of! That¡¯s amazing! {[Slime: Enhancement!]} Lv 1/10 -Synthesized skill. Progression and evolution unknown- Your slime now holds powers of Enhancement, allowing you to boost your little buddies with the power of friendship and love!...Well, literally, as the enhancement boosts all stats, and is tied to your [Control] stat and your relationship with the target. {[Slime: Holy Flame!]} Lv 1/10 -Synthesized skill. Progression and evolution unknown- Your slime now holds the powers of the holy flame. Upon activation, your slime will gain the effect of inducing a searing heat from the heavens. Similar to [Slime: Heat!], it induces the effect of heat into your enemy, but the flames of heavens have gifted this ability with an increased heat effect and an increase effectivity against the undead and the unholy. Oooooookay. Now, THAT¡¯s the deal! Enhancement and holy flames!? She¡¯s become a hybrid between Mercy and Laphicet! She practically a powerhouse now. Well, against the other denizens of the void? Not so much. She¡¯s still get her ass handed to her several hundred times at this stage. But this was a good improvement to have! Especially with wooden mannequins running amok. But, enough of that for now. Fazing her status plate back into the void(yeah, that¡¯s a thing), she sighed and turned her gaze over to Anna, her lifeless eyes staring back into hers. She wondered if she felt bored, just sitting there watching her fight it out against that mannequin. She probably wasn¡¯t, since she didn¡¯t even have a soul and all, but she imagined she felt quite bored inside that husk of hers. Maybe the next fight she¡¯ll leave to her. Hmm¡­ Actually, that might be a good chance to test out her {[Slime: Enhancement!]} skill, just to see how much of an improvement it¡¯ll give to Anna on the get go. With a soft smile, she ordered Anna to follow her as they went off into the purple grassy wilderness, searching out for more monsters to fight and hunt down. ¡­¡­¡­¡­¡­¡­ The variety of monsters in this world was¡­surprisingly small. It¡¯s still pretty big, mind you, there¡¯s a lot of species that could kill her and all, but for an ENTIRE world, this amount was quite small. Or, at least, that¡¯s what the wiki on her status plate said anyways. Really though, she¡¯s beginning to wonder if this status plate was secretly a phone or something, because damn is this thing high-tech for a slab of thin stone! Anyways, as expected, the two girls met quite a sum of monsters as they went out on this training killing session. As promised, she let Anna take some of the fun, letting her battle on with her only support being Diana¡¯s additional enhancing slime stickily stuck to her exposed back. And¡­man, has this route shocked her! To give you a heads up, Anna¡¯s lifeless body is physically stronger than normal for¡­some reason. Maybe the process of getting her soul ripped out and falling into this void world enhanced her somehow. At her best, she could shatter a rock with a single punch of her fist. And remember that she was still LEVEL 1 on that. Now at level¡­something, she couldn¡¯t really check with her lack of status, but it as definitely much higher than level 1 now, she could beat those magically enchanted mannequins down with a good fist fight. And with her enhancing slime added onto her, she could smash a 3-storey sized iron golem with a good punch or two. It¡¯s terrific! But while Anna was off to have a good battle with a giant tree trunk that¡¯s alive for no particular reason, one that¡¯s taking over a mountain, Anna with having a silent time alone, sitting on the grassy hills as she looked up towards the black cloudy sky. How was everyone up there? One question and one only. She went through all this just so she could reunite with them without breaking her humanity. And, well, she¡¯s alive now, but how was she supposed to get back? Go through that gate thingy again? And if she goes back, won¡¯t the gods just notice and rewind her existence back to that white area? Wouldn¡¯t it all be for nothing then? She needed to have something, something that could shield her from the reign of the gods. A skill, a shield, a sword, whatever, just, something that had enough power to oppose the rule of the gods. But how would she even find something like that? She couldn¡¯t find any answer to that, as she absentmindedly watched Anna get flung down into the ground, crashing and stopping in the dirt right in front of her before she jumped out and rushed back to fight. She quickly shot a [Slime Cannon] loaded with her enhancement effect onto Anna¡¯s back, increasing her overall prowess as she knocked away a gigantic 20 foot root out of the sky. What could she do? Was it even possible? What should she do first? She couldn¡¯t find any answers to those three, even as she watched the clouds tear open and another gate appear, flushing in countless souls and ¡®lost ones¡¯, along with- Is that a cell phone? And then, an idea struck her mind. [53] Back Home Fyorei was XXX years old, so he was bound to see some weird sh*t occur in his life. For instant, there was that one time he was resting under a tree, when suddenly he found himself waking up inside the house of the nature goddess from several dimensions away. After a long debate of trying to get home, he busted out his red whip and lashed his way outta there. Or that other time when he became cursed with ¡®attraction of no bounds¡¯, causing everyone, men and women, to develop a crush on him that had the potential of turning into love. For girls and women it was awesome! For men¡­not so much. He also ended that by whipping the hell outta the guy who cursed him. All in all, he figured out the solution to all weird things by using his red whip. Works every time. But, well¡­not¡­this time? When he finished his business with the girls that were eager for him, he went out of the city to search for his newly found friend, which he easily found since he saw an enormous root sprawling out of a mountain and attacking a naked girl. Well, more like the girl was beating the root down to the mountain. He later recognised this girl as that one Diana asked to buy, which meant that Diana was probably chillaxing somewhere in the area. He¡­found her soon enough¡­Fighting a giant bull that had 5 heads that is. Now, as a bit of a history lesson, that bull was a curse god called ¡®al¡¯ard aljafa¡¯. It¡¯s a weird name. It¡¯s pretty much a curse god that sucked out mana from any living being it touched, may it be the denizens of the void or even gods themselves. And here this naked girl was, her body fully turned into a slime, and hurting that monstrous being without much of a sweat! Seriously! He might have some trouble with that thing, but she¡¯s just going it full-power! It¡¯s impressive, to say the least. She¡¯s much stronger now, not as strong as he though, but still commendable. *BAAM!!* A loud explosion rang out as Diana¡¯s girl was smashed down into the dirt, before she leapt back up and rushed back to fight, Diana quickly firing a load of slime onto her back, vastly increasing her power. He would¡¯ve offered to help¡­but seeing Diana go destroy that bastard bull was more fun that he expected, so he stood back on the side-lines and spectated the two matches happening at the same time. Several more blows, Anna crashing to the ground, Diana dodging, and Diana using her slime to damage the curse god later, Diana was the first to come out victorious, panting softly as she watched the curse god go limp and crash down. ¡°Phew~, that was tiring!¡± She said ecstatically as she looked at the rude bastard. To back up a bit, Diana was having a nice peaceful time watching Anna duke it out with that enormous root over there, before this 5 headed b*tch came and rammed into her, stealing a bunch of her mana and sending her flying back into the dirt. Pissed at that, she first, like an experienced fighter(not really), she kept her cool and watched its movements, dodging its attack as she analysed its attack pattern. After she figure that, yes, it liked to howl and ram things, she decided her plan of attack. First thing first, since this thing was obviously not a god, conventionally anyways, her {[Slime: Holy Flame!]} should do wonders on this thing. And, oh boy~, it sure did! Her damage output ramped up by an insane amount, and she couldn¡¯t help but feel a bit of pity as she watched the bull squiggle around on the dirt as it tried to rid itself of the holy slime. And when it did, she¡¯d just add some more slime and repeat the watching process. Over time, the bull realised that it¡¯d die if it didn¡¯t do anything, it began going on the offensive, even as its damage continued to stack over and over. Diana, being the kind person she was, dodged and evaded like a prick and fired more and more holy slime onto the bull. Before finally, it dropped dead. Horay~! [Enemy has been slain. 90000 Skill Points gained] [Congratulations! You are now Level 89! Stats have increased] Name: Diana Class: Slime God Lv 89 (+62) Subclass: HP: 520/940 MP: 195/935 SP: 562/920 [Strength]: 329 [Tenacity]: 341 [Agility]: 338 [Control]: 345 [Dexterity]: 329 [Mentality]: 347 [S*ki%# Po&!ts]: 92746 {Skills}: [Absolute Slime Transformation Lv 12], {Slimy Bubble Magic Lv 18}, {[Slime Modelling Lv 2]}, {[Slime: Enhancement! Lv 13]}, {[Slime: Holy Flame! Lv 17]} {Slimy Compendium} It¡¯s almost crazy just how big of an improvement she made from, like, 2 hours. Well, the monsters here were crazy and it¡¯ll probably take her a single hit for her to reach the game over screen, but still! This was awesome! As for her accumulated skill points¡­well¡­she wanted to save that for later. Since there was the specialised skill synthesize thingy, she wanted to save a lot to see if she had several skills she wanted to pick out for later. And for her skills¡­well, she¡¯s improved a lot. The only exception to that being her modelling skill, but that¡¯s mostly because there¡¯s no combat-focused purpose she could find for the thing. All she tried was shift her body figure to try and make her a bit sexier, but she reverted back to her old self, since it looked a bit weird, in her opinion at least. But! Enough of that. ¡°Oh, hey there Fyorei! Done with your business?¡± ¡°You bet.¡± Diana smiled a bit as she looked up towards the fully opened gate swirling above her, distorting the clouds above and forming a vortex in the clouds as she speaks. If she was guessing right¡­that thing led to Earth, her home planet. She didn¡¯t really have any reason to go there, Until now that is. Id you recall, she was trying to find a way to get back to the surface without getting spotted, or at least without getting taken back, by the gods and getting her existence reset and all. There were several ways she thought up that could possibly allow that. Maybe she could find some sort of skill or item that could allow her to do that, but it was definitely something she could find here. Emphasis on here. You see, there¡¯s a certain other place filled with mythology and tales where gods and such were able to be subdued and even killed. It¡¯s a place that stars with ¡®E¡¯ and ends with ¡®H¡¯ and has a lot of water- Okay, we get it. It¡¯s Earth. Yep, that¡¯s right! Earth was a place filled with this kind of stuff. And while people would just shrug them off and say they¡¯re just ¡®legends¡¯, with enough things spoken about them, even legends could manifest as truth. It¡¯s a complicated process, involving the gathering of mana or something, but that¡¯s basically it. And you see, Earth¡¯s filled with mana. Like, filled completely. It¡¯s everywhere! The problem lies with the humans, who have no powers or abilities to harness or even notice the mana floating around them. Some can, but the majority can¡¯t.This story originates from a different website. Ensure the author gets the support they deserve by reading it there. She had several ideas as to what could- ¡°Oi, Diana. You okay?¡± ¡°Hua? Ah, uh, no, I¡¯m fine!¡± Well, seems like she got too deep into thought without speaking to him. Actually, this was a good Segway for her to ask something to him. ¡°Hey, Fyorei. How long do portals like that last?¡± She asked cheerfully as she pointed her index finger up into the sky, straight into that giant vortex spiralling above them. He gave it some thought, his hand placed on his chin as he mumbled, before he shrugged his shoulders and answered with a simple, ¡°I don¡¯t know. Probably months. Years even. Depends on a whim really.¡± That was¡­a terrible answer, but she at least figured out that they lasted several months, if not years. That was way more than enough for her! ¡°Hey, wanna come with me?¡± ¡°To where?¡± To which she simply answered by pointing her fingers upwards again, which garnered her a soft ¡®Oh¡­¡¯ from Fyorei as he realised what she wanted to do, both ignoring the loud resounding punches coming from Anna¡¯s heart-pumping battle in the background. ¡°You¡¯re one crazy chick, you know that?¡± ¡°That¡¯s just who I am!¡± The two chuckled loudly as Anna and the giant tree trunk clashed for the last time, before Anna¡¯s strength came out victorious and smashed the tree trunk apart, the many large pieces of wood landing down onto the purple grass like meteors. Out from the clouds of dust, Anna jumped out and landed gracefully behind Diana, her naked body wounded and scratched all over, but still intact nonetheless. ¡°Hold on tight, girls! This is going to be a hell of a ride!¡± The two girls hugged onto him tightly, and Fyorei smirked as he placed his arms around their shoulders, cradling them like they were his lovers. The two did not pick up on that. In seconds, Fyorei¡¯s teleportation skill activated, and before they know it, they were high up in the sky, incredibly close to the vortex, and quickly getting sucked in. It¡¯s time to look for some god-sealing items! ¡­¡­¡­¡­¡­¡­¡­ And, you know? She wasn¡¯t expecting her first landing spot to be at Japan¡¯s famous ¡®Suicide Forest¡¯, also known as Aokigahara, a place famous for those who wished to end their lives, at night. Thinking about it, it made some sense why this would be the place of landing. Since countless dead souls lingered on after their suicides, the cascading mana must have caused a vortex to appear. And since this one was relatively new, she had several months to explore this Earth. ¡°How¡­beautiful.¡± Those words leaked out of Fyorei¡¯s mouth, and Anna too showed a look of wonder as the two looked upon the tall trees and soft eerie silence. This was a world so unlike the void world, so their wonder upon their first arrival was understandable. ¡°¡­Let¡¯s, get out of here.¡± But Diana wasn¡¯t feeling too good. This was a place of suicides, and as a newly born god, she could sense and see spirits and ghastly figures. And right now, this place was swarming with spirits. It¡¯s making her sick. All their wishes, dreams, hopes, regrets, failures, all of that were lingering around the forest without any intentions of finally giving up and ascending to that nice place above. Can¡¯t they just give up and go already? Sensing the disgust in her master¡¯s voice, Anna immediately ignored her wonder and began searching for the most effective route out. Fyorei, still admiring the view, was slowly dragged away as Diana and Anna slowly made their way out of the forest. Diana also later realised that they were naked, but as they were alone, she decided not to bother. While they were walking, it¡¯s time to assess their situation! Now that they were back at Earth, Diana¡¯s goal still remains unchanged, to go back to the world above without shedding her humanity. This requires her to find some way to avoid or fight back against the god¡¯s reign in that world. This led her to going to Earth, which was a place teeming with legends and myths of people and objects that could seal and even defeat or kill a god. As Earth was a planet just brimming with untainted mana, with enough word of mouth and will, even myths and legends could take form due to the mana following those wishes and gathering in one location. She didn¡¯t really have a specific thing to look for, but she had a clue or two. So¡­There¡¯s this thing called ¡®adamantine¡¯. It¡¯s usually just a thing used to call ¡®really hard stuff¡¯, but she¡¯s sure by this point that an actual piece of adamantine had formed somewhere on this blue planet. This stuff was so durable and strong that it was said that it could hurt gods and even chain the titan Prometheus, along with slaying beasts that would even give the gods a run for their money. In mythology anyways. There¡¯s also Tartarus, the prison so great it could seal gods, but¡­well¡­she¡¯s not sure what that looks like or how she even plans to bring something like that back through the void and into the fantasy world Crystal and Rei was in. Anyways~, enough of that. Because she was literally standing out there, in Japan, with an idiot and her naked servant, and alone at night with the cold wind stabbing into her pristine skin. There was only one priority that tops all in her mind: We need some clothes. Raising her left arm into the air, she turned her arm into slime and shot it up into the air, letting it expand over the entire area, just to get a good view of where they were. And let¡¯s say¡­it wasn¡¯t good. There¡¯s¡­nothing, around them. Forest, mountains, plains. That¡¯s it. There¡¯s an odd souvenir store several kilometres away from them, but even then, it¡¯s a pretty long way from here. Not that it mattered! It¡¯s night! They can go sneaking around anytime they want! If they¡¯re willing, they could go even father and get to the Kofu city, where they¡¯ll be able to look for a good clothing set or two. But, in her honest opinion, the souvenir store seems to be their best bet for now. With that, the three went on their mission and ran as fast as they could through the plains of Japan-, well, I say ¡®mission¡¯, but it¡¯s more of a playful trip for the three, even including Diana. It¡¯s Japan for damn sake, JAPAN! She had wanted to go here for so long, and now she¡¯s here! Not in a place she really wanted to be, yes, but it¡¯s JAPAN! The three had their share of adventures as they went out in the night, enjoying the amazing scenery of Mount Fuji there along with several cool little spots along the way. It was a pleasant night. Oh, and Diana finally managed to ¡®steal¡¯ some clothing from two girls she found exiting the souvenir store. And by ¡®steal¡¯ I mean use her [Slime Modelling] to shape the two girls as she pleases, made their preference change to women, made the two incredibly horny and made the two not afraid to make out in the open. While they were having their fun, she sneaked up and took their clothing for themselves. Luckily, the sizes weren¡¯t too far off, so she only needed to readjust both her and Anna¡¯s height a bit to fit the clothing, which was a nice set of a brown skirt and white shirt. Anna had the same outfit, only with a black shirt instead of a white one. While they were having fun, she forcefully covered Fyorei¡¯s eyes and dragged him out of the area. She did have to admit that all the steps before the final one was completely unnecessary, but, hey! This was her fantasy story, and she could do whatever she wanted! And besides! She could feel some sort of tension between the two girls, she might as well help out! ¡­She wasn¡¯t using that as an excuse, really! Anyways, she wasn¡¯t all that versed in Japanese mythology, so she wasn¡¯t quite sure if there was any god-sealing/killing items to take for herself. Does Yato count by any chance? Anyways, first up, they needed to find some shelter. Sleeping in the wild was good and all, but she¡¯s home on Earth! Time to act like a normal human being for¡­I don¡¯t know, maybe 3 days before going back to her normal self? It¡¯s time to have a bit of fun! She happily thought of the many plans she could have as she dashed through the fields of grass, with Fyorei and Anna tailing her closely behind. In the end, Diana realised she had no money to spend and decided to sleep out in the wild anyways. ¡­¡­¡­¡­¡­¡­¡­ It was now dawn, both a dawn of a new day and a new adventure for the rag tag group of crazy maniacs. The rising sun bathed the Earth in its warm light, casting away the darkness of the night. The sky shone a tint of red and orange, the black night sky pushed away from sight. The soft howls of the wind passed by, the grass and flowers blowing in rhythm. I¡¯m back, huh. And sitting alone atop a small rock was Diana, a soft smile on her face as she looked at her home planet. The beauty that came, even in something as ordinary as a sunrise, was breath-taking. If she knew about this, would she had been able to avoid becoming a NEET? No. She pushed those thoughts away. One way or another, her becoming a NEET was a universal constant. And besides, it wasn¡¯t really her being disappointed in life that led her to becoming a NEET, but¡­ She shook her head again, in an attempt to clear her head of these thoughts. Still though, staring at the rising sun, sitting alone as the chilling wind ran across her skin, it was a perfect time for reflection. And honestly? Holy sh*t has she come a long way. She started the story as a simple male NEET holed up inside his room, before he sacrificed everything(including his gender) and travelled to a fantastical world filled with monsters and RPG elements, a world a NEET like her definitely wanted. Escaping the woods, realising that she couldn¡¯t understand a single word from that one village she tried to enter, finding the dryad, getting the dryad killed, finding Crystal, forcing Crystal out of her home, Arriving at the desolate withered forest, a meeting with a certain food-loving ghoul, a training montage to the catacombs gone horribly wrong, meeting with Nestra, dying from a stupid mistake she made, getting revived by Slimey, Defeating the giant she created, escaping Tartarus, a meeting with a death god and escaping the withered forest, finding Anna, going to a kingdom, meeting Ilgua ,taking on her first quest(which also went horribly wrong), Meeting the goblin elder, meeting Gaz as his harem of women, getting thrown into that white world, getting her memories back, a meet up with Crystal, but a failure at trying to escape, Getting dragged down into the void, forced to witness the lives of those who died, her body disintegrating bit by bit, going up to the afterlife, getting promoted to a god, getting sent back down to force her to shed her humanity, Realising that ¡®f*ck no she wasn¡¯t going to do that¡¯ and tried as many ways she could to get back without shedding her humanity, finally getting into the gates and arriving in the void world, meeting a certain pervert, Getting her status plate, finding Anna as a ¡®lost one¡¯, and finally here, sitting alone atop this small rock, silently watching the sun rise from the horizon. It¡¯s been a heck of a long journey. When will it end, who knows? But no matter what, She¡¯ll definitely enjoy this to the very end. Quick Update Sadly, due to some family matters, I will not be able to write anything for this week or so, so do please be patient for the next chapter, which will probably be uploaded next week or so. ...The narrative has been taken without permission. Report any sightings. ...... ........ Damnit, I need more words to write...Uh...Let''s see. Oh, also, does anyone here play Persona 3 Portable? It''s a great game! Question, Male MC or Fem MC? Just curious as to who you pick. Anyways, the word count''s just about reached, so I''ll bid myself out now. Chiao! [54] A Story Over, Another Begins The League of Mages, It¡¯s sorta like the Mages¡¯ Association thing from Fate, a group that binds the magicians of Earth to keep them from going all gung-ho and blowing up the entire planet because they thought, ¡®Hey, why not?¡¯ The big difference being that instead of having 3 of them that control different things, the League of Mages is simply a title to be put in the spotlight, with countless more ¡®Houses¡¯ living under it. The ¡®YumeKyarai¡¯ is one of those houses. It¡¯s a house that mostly operates in and only in the one country of Anime, Japan. They do everything from monitoring the changes of the mana in the atmosphere, to odd occurrences that cause disruptions in the flow of mana, and even sending some of their mages to go and deal with problems. And al to protect the people from harm!...Well, mostly because they¡¯re bored. You see? In this world of science, magic¡¯s pretty much faded into obscurity, just like any story with an Earth setting that has science beating out magic. In the past, countless magicians roamed the Earth, harvesting the mana from the Earth itself and channelling it to do many mystical things. Healing with a single touch, splitting the skies and seas, causing eruptions and tornadoes. But as logic became prevalent and the scientific method began to take place, as Mana was something normal technology, and even high-tech technology could detect, magic was quickly sunk into myths and legends. In this day and age, the remaining mages have come together, united under one title, living their lives with the purpose to prolong the life of their magic, and to further develop their crafts. ¡°The, end. Ah~, so amazing!¡± With the last word read, the girl closed the book she was reading and giggled, entranced by the many things this book she bought from the Mage store back in Kyoto. The afternoon sun shone brightly over Kofu city, and many students were currently out and about doing their own thing. It was about the time when the Japanese High schools ended, so the many high school students, including herself, walking around was to be expected. They were, unlike her, just normal students, and had no knowledge of magic, unlike her. Fumiko Akari mused to herself, feeling her pride swell up to mount fuji, knowing that out of all the students here, the jocks, the pretties, the cool, she¡¯s the only(probably) girl to have magic on her side. So, ha! Suck it! She was, on the outside, a completely ordinary girl. Average female height, short black hair, black eyes, enjoys sports and reading, which was a bit odd, and was a fanatic and fangirl of anything magic-related. Right now, aside from stroking her ego, she was also out on a daily errand to check for any irregularities in the area. Of course, since she¡¯s a newbie in the team, they¡¯ve assigned her the simple stuff and restricted most access to any magic research, which sucks! She did get this cool iPad-like gadget however! It¡¯s currently inside her school backpack, but if there are any mana fluctuations, the thing will vibrate like crazy and point her in the direction of the cool stuff. Right now, it was staying silent, since nothing¡¯s really- *Brrrrrrrrrrr* O¡­kay, maybe not. In a haste, she pulled out the device from her bag and, as her colleagues explained to her, it was vibrating quite heavily, and a graph in the style of a heart rate monitor, which gets more violent the closer she gets to the fluctuation. Oooh~! A mission~! As this was her first time meeting something like this, she couldn¡¯t help but feel excited, tapping her feet against the asphalt, and also attract odd glances from anyone with enough care to notice her. Like the fangirl she was, she ran in speeds even sonic couldn¡¯t match, before finally arriving at- ¡°¡­Huh?¡± A completely normal pedestrian street. There¡­There¡¯s nothing here! She couldn¡¯t help but wonder if either the device was going weird, or it was her being incapable of even sensing the anomaly. She waited for quite a bit, squinting her eyes to try and get a better picture. Before a group of 3 people suddenly passed her, and her device spiked so much in nearly broke. She turned around to see two girls and one man walking side by side, one of the girls staying silent while the other was having a pleasant(if loud) chat with each other. This¡­No, they were it. Those 3 people were the anomalies that her device was detecting! But, from the looks of it, they were¡­human? With the levels of mana this device was detecting it seemed unlikely. But they moved, talked, showed emotions, and more- Doesn¡¯t that mean they¡¯re aliens!? And with that, another stupid theory was born, as she contemplated whether or not she believed that these things called aliens actually existed¡­Thinking about it, aliens are just things that are distinctly not human, animal, or plant, so they obviously exist. Just look at Phantasmal Beasts! Scary as hell! She was about to go and talk to them, but she then wondered whether they even spoke Japanese or not. With their looks and such, she doubted they were, and she wasn¡¯t a genius who- ¡°¡­Ah! T-They¡¯re gone!¡± ¡­By the time she snapped out of her many thought bubbles, she realised that the three people she was looking for was now gone! Device in hand, Fumiko cursed herself as she ran to follow them. She later saw them buying ice cream from a street vendor. With money. And capable of speaking to the locals. ¡­¡­Well then, guess her worry of them not being able to speak Japanese was unneeded. Now, once again, she was about to go up to them and speak, however! She was there. Shizenso Yue. A young idol from another school. About the same age and height as her. But all similarities end there. She had beautiful long golden hair, striking green eyes, a curvy body figure, an infinite closet of fashionable clothing(probably), and lots and lots of money. Like, LOTS of money.The tale has been illicitly lifted; should you spot it on Amazon, report the violation. She¡¯s an arrogant b*tch who goes around, flaunting her money all over the place, charming boys, and sometimes girls, with no effort at all, and even going so far as owning a large jewellery company in Kyoto. It¡¯s crazy. But she knew better, and that¡¯s what makes it worst. Not only was she spoiled rich and a b*tch, she was also a mage, and a powerful one at that. She came from the ¡®Shizenso¡¯ family, a prominent family in magecraft that dealt with making use of the Earth¡¯s mana to do many things, which was usually somewhat related to nature in some way. And she a prodigy-¡­No, even that might be too small for her. Her reserve of mana was gigantic it made her device go mad just by standing next to her, and her skill at using her magecraft put most mages to shame. It¡¯s absolutely crazy. And since she¡¯s here¡­No¡­It can¡¯t be-! She lost. It was her first encounter with something magical, and she¡¯s lost already! Damnit! She cursed herself as she forced herself to hide behind a tree, watching. She knew, if she tried to get in her way, just like anyone that did before, she¡¯d get beaten down, not just by magic, but her political standing and power. It¡¯s the perfect kryptonite for a normal ordinary Japanese girl like her! But what happened next shocked her. ¡°Hey there you three~, I¡¯m-¡° She was going on like normal, introducing herself with that annoying voice of hers. The way her hips moved and eyes shone got the man captivated at least, and the silent girl titled her head and looked at her with suspicion. But the other one, ¡°Um~¡­You¡¯re a mage, aren¡¯t you?¡± This gave Yue a noticeable moment of panic, not just because this girl knew she was a mage, but also because she said it out in the open, with people to hear. If the public starts to realise mages are a thing¡­she couldn¡¯t even imagine what¡¯d happen! ¡°I¡¯m Diana, nice to-¡° ¡°Shh!! D-Don¡¯t just say I¡¯m a mage! I¡¯ll get in trouble!¡± Before Diana could say anymore, and presumably even speak out more stuff about magic than a broken recorder could on a looped disk, Yue moved up and forced her hands over Diana¡¯s mouth, eyes darting around to make sure no one heard that. ¡­Which was kinda redundant, since her act only caused more people to turn their heads and look at them. The man beside Diana was smirking to himself, and the other girl was surveying the situation with cold eyes. The two didn¡¯t seem to be too bothered by the increased attention, but the sudden touch did seem to garner some attention from them, especially that other girl. After the initial ¡®shock?¡¯, Diana slowly pulled away Yue¡¯s hands from her mouth, a carefree smile on her face. After that fiasco, Diana and her friends followed Yue to a secluded area to talk about an artefact or something. She would¡¯ve gone and followed them even more, but a close friend of hers, her school¡¯s student council vice president, spotted her suspiciously hiding behind a tree and pulled her away. ¡­¡­¡­¡­¡­¡­¡­ Shizenso Yue. Young idol. Most popular girl in school. Beautiful. Honour Student. Good grades. Good physique. Enough money to build several personal skyscrapers. She had it all. Born and raised as the heir to Shizenso family, gifted with an unnatural talent in magic, and an incredible sensitivity to mana, she was known as one of the best mages in Japan, even at her young age. On one seemingly normal day, after school had just ended, just like any student would, after saying goodbye and complimenting her fans to get her way, she made her way out of the school and was headed home. Until she felt something. An enormous cascade of mana pulsed from somewhere in Kofu city, and just like any mage, she had a smile on her face as she ran towards it. After all, to wield magic was to walk with death. Wait, wasn¡¯t that a quote from Fate!? Finally, after some running, she saw them, a group of 3 people, dressed in normal clothing and chatting about like normal people. Or that¡¯s what anyone would see from the outside. Using her keen senses, she could see the insane mana surging inside the 3 individuals. However, unlike mages, their mana wasn¡¯t convoluted by worldly matters, but clean and pure. A trait that only belonged to the ages of myths and gods. This was awesome! For a girl who had lived her life dwelling in the arte of magic, someone with ties to the age of lost magic was someone she just had to find! But, ¡°Um~¡­You¡¯re a mage, aren¡¯t you?¡± The girl, who she later learnt was called Diana, figured her out first. This worried her, not because she knew she was a mage, but because she just stated that, in public, with ordinary people and students walking about! By reflex, she stepped up to her and forced her hand over her mouth, Which garnered looks of interest from everyone walking by, but she didn¡¯t take time to notice. Later getting her to agree to talk somewhere else more private, she got the three to follow her back to her house, which was nice, since she was getting annoyed at that stalker hiding oh so obviously behind a tree. This then, was the time for the three to be surprised. Yue¡¯s home, as a proud Japanese, was a large traditional Japanese home built out of wood. Tatami floors, sliding doors, a large backdoor park, and many Japanese rules to follow, It was Diana¡¯s absolute dream come true! ¡°Waha~!¡± She squealed happily as she looked at the amazing sight, with Fyorei also staring in wonder, and Anna who was silently observing the situation, if not slightly sending hostile glares at the fairly proud Yue. Finally inside, using some of the manners she gained through her many experiences in the void for once, she took off the shoes she was wearing, told Anna and Fyorei to do the same, before they followed Yue inside. And, hoo boy~! The inside was just as cool as she remembered from all those animes she watched! Made her want to shout ¡®Tadaima~!¡¯ to no one in particular, but she realised that this wasn¡¯t her house, so she held herself back. ¡°Phew¡­Alright, let me ask you some questions. First, are you human?¡± ¡°Nope!¡± She answered as happy and carefree as ever. Fyorei grinned and nodded, and Anna nodded silently as well. Well, seeing as they were holding magic no human could ever handle should have made the answer quite obvious, but better safe than sorry. ¡°Next, where did you come from?¡± ¡°Umu¡­That¡¯s a secret!¡± She couldn¡¯t just say she was born on Earth and then got transported to another world as a girl, could she? She¡¯ll probably just look at her all weird. ¡°Ah, oh, okay. Then, lastly, what are you planning?¡± This was the final straw. If these three beings came to this planet to cause chaos for the populace, it would be her job as a mage to keep the peace. Now- ¡°We¡¯re just here to try and find something to kill a god.¡± ¡­Uh¡­Huh¡­What? ¡°¡­Sorry?¡± ¡°We¡¯re here to kill a god-, ah, I guess that¡¯s pretty weird, huh! Ahaha~¡± Somehow¡­she wondered if this girl sitting across from her was actually right in the head. And seeing as this was Diana she was talking about here¡­well¡­Being ¡®right in the head¡¯ wasn¡¯t exactly Diana¡¯s best forte. Now! As the author and narrator, I shall intervene right here. H-Hey!? Ignore Diana¡¯s cries for attention, as I beam you back to the world of fantasy once more. Just this time, it was less fantasy and more, ¡®holy sh*t, what the f*ck happened to everyone?!¡¯ Due to the recent and sudden outbreaks of gates into the void world, many vengeful spirits, those who had been forcefully ejected from their bodies as their empty husks became ¡®the lost¡¯, these spirits sought out more human candidates to use as a shell. Sadly, as the gates close, the spirits will get dragged back into the gates, even after they¡¯ve inhabited another body. Which meant that the vengeful spirit, and the spirit of the body they inhabited, will both return to the realm of vengeful spirits. This chain reaction occurred in only a couple hours, but in those couple hours, near to all of humanity have been dragged into the void, and this left the world an empty husk, free from the reign of humans. Monsters and non-human races rejoiced as their fiercest competitor literally just vanished from the face of the planet, running amok through the empty cities and towns, and finally gaining the courage to bring themselves out into the wild. But, while all rejoiced, Crystal, Rei, and Gaz did not. Crystal and Rei had just lost the reason they went out in the first place, which was actually before the death of all humans, but that just made it more devastating. Gaz spent his new life here trying to build a harem for himself, and in a flash, all of the women he had saved had disappeared into the gates of void. There was no victory for the three. As they walked back from the plains, no words were spoken, no magic was cast, no attacks were done, no levels were gained, no powers were used. Only a dreading silence, accompanied by the rising sun. Victory for everyone, but none for them. So, with their heads hung low and all of humanity gone, the trio walked back to the goblin village¡­or they were, until Crystal slowly began to realise that she couldn¡¯t even feel her legs, until she finally collapsed, her body crashing against the dirt. Ever so silent, Rei carried Crystal on her back as they went to Gaz¡¯s now empty hideout, which was much closer in comparison to the village. But nothing was over. Now that the reigning humans were no longer present, the monsters were free to battle, roam, and do whatever they want with a higher chance of survival. Chaos ensued, overtaking the entire world. For now, Crystal¡¯s story was over, but Diana was still out there, searching for the treasure, all to come back to her. How long that¡¯ll take, who knows. [55] Problems on Earth Diana was an odd existence, anyone that gets to know her surely thinks that way. She¡¯s a bubbly, kind, way too humble and honest for her own good, but occasionally, little cracks would appear on her, And there was sadness, disappointment, and perhaps a bit of regret hidden inside. Or, that¡¯s what Yue saw at least. She thought that her kind and sweet nature was just a fa?ade, but that was just as real as her hidden feelings. It was as if those two sides of her existed to almost compliment each other. I¡¯m thinking to deep into this¡­ Yue thought as she finally willed herself to get out of hr futon and get some fresh air at her personal inside garden. The morning had just arrived after all, and the morning sky was a constant favourite of hers to look at. Except, she wasn¡¯t alone. She stopped in her tracks, her eyes moving over to Diana, who was silently standing in the centre of the garden, her eyes blankly staring into the morning sky as the birds flew by. She seems lost in thought. Actually? No! Diana just got sentimental like, two days ago, she¡¯s not going to go and contemplate her life choices again! No no. Right now, while she as curious to see how her drunkard mother was doing, she was just vacantly staring at the unseen stars, their light overridden by the shine of the rising sun. And she saw even beyond the stars, the galaxies, and even the observable universe. She went past the pillars of creation, the insanely massive black hole at the centre of it all, and even the quickly expanding boundaries of space itself. Using her (unofficial)godly status, she saw past the boundaries of reality, and peeked into several different universes. You see, while there was no doubt that Earth held some crazy shit that could take down gods like its nothing, all the possibilities she came up with were incredibly hard to find, and one of them wasn¡¯t even a weapon or an item, it¡¯s a goddamn giant prison! So, she used her eyes to peek into other universes, just in case she could find something there as well. And well¡­well¡­holy hell, there was a lot of stuff, everywhere. However, this, in turn, gave her an insight to several similar, yet different story lines to her universe. Some of them even had her journey finished, with her settling down in all sorts of places with several different people. There were happy ones, sad ones, funny ones, stupid ones, and so on the list goes. It did make her wonder though, after she comes back to Crystal, where will her story go next? After all, while it hasn¡¯t been that long since she first incarnated as Diana, it sure as hell was packed with many events. It¡­actually might be a nice thing to lay down after this. I mean, you know, if she succeeds, she¡¯s have defied, or even killed a god. How much more power creep will occur here? So, relaxing a bit, and maybe finally accomplishing the promise she made to Rei about making some nice delightful food. ¡°¡­¡­¡± Heh¡­Somehow, I¡¯m getting a bit emotional over this. Wonder why. She couldn¡¯t help but wonder as her adventures flashed by her mind, from start to now. And- ¡°Oii! Diana! Where are yooouuu! Damn, this house is too big!¡± ¡­Well, it seems like her time of contemplation has been cut short once more. Wiping the building tears in her eyes, she smiled and followed the direction of the voice, leaving Yue behind to watch her back disappear into her house. Now, while she¡¯s off to help Fyorei out with all his troubles, it¡¯s time for her mind to start coming up with ways to combat those pesky gods. And the recent sleep she had sure gave her several good ideas. All of them dangerous, none of them guaranteed success, but all of them were awesome and cool in their own rights. Pretty sure old Davin would agree as well. ¡­ ¡­¡­ ¡­¡­¡­ She later realised he was just coercing her to have s*x with him, even put on a strong sound barrier using his weird magic. To that, she just sighed and let him take the lead.
End the problem in its infancy. Nip the chaos at the bud. Yeah, sure, these words got thrown around quite a bit in the realm of fairly bored gods who watched the world from above. After all, this world was theirs, and any who broke into it were burglars and criminals. To think they¡¯d mess up this badly¡­ Upon Diana¡¯s first arrival, the gods were fine with it. She was just a guy turned girl who was fairly confused about what the f*ck just happened to her. She also got herself beaten in by a slime, so no potential dangers there. Or so they thought. Soon, she grew in strength and experience, and she even managed to escape the domain of the god of death, he who ruled over the withered forest. But then, the apocalypse happened, and Diana was thrown into the void. There, they managed to track her down and bring her in as a newby god, not knowing that she was still stubborn as hell, even going as far as avoiding them completely and taking several million bolts to the ass just so she could maintain her humanity and love for her friends. And in the end, she managed to escape into that ever present gate of chaos, and break from all their quasi-clone dimensions. Now they were worried. This, in turn, earned them the wrath of the one who stood above them all, the one who ruled over the heavens and was the first to push her reign upon this magical world. It was her, the goddess of war, Victoria. Unlike the other gods, who were just concepts and spirits materialised into a higher being, she was a true god, born with godly heritage. Fed up with how her past life was, she escaped from her own dimension and lay claim to the unclaimed lands she found herself in.You might be reading a pirated copy. Look for the official release to support the author. Right now, up in her personal room in heaven, she was heavily sighing to herself, her shoulders drooped in defeat. Her wonderful long teal hair was messy all over, and the circles under her eyes show that she¡¯s been lacking some rest(mentally). Diana¡­that girl was¡­annoyingly difficult to deal with. Even after an eternity¡¯s worth of lightning bolts to the ass, she was still able to muster enough courage and power to fight against her will. And it fed her up even more to know that she couldn¡¯t just waltz up to Earth and take her down. After all, while that world was unclaimed, the planet itself seemed to hold consciousness, and will send anything and everything her way to destroy her. ¡°*Hah*¡­how preposterous¡­¡± She sighed as she brought herself out of the large bath she was enjoying, the water trailing down her naked body as she left the humidity. She could only watch as the girl had some passionate s*x with that faithless man. Even if he was just a denizen of the void, a gate world that connected all worlds, his strength and wisdom alone was something worthy of notice. Now now, she shouldn¡¯t be fretting over something so uncertain just yet. After all, that being was just a newby god. Someone like her wasn¡¯t going to harm her in a millennium! She does have something to send to her, as a gift of course. If she wasn¡¯t wrong, her roster of friends had two humans in it, and one of them she already claimed as hers, which then left the male in the void, still lurking with no purpose to guide him. Just for a bit of fun, and seeing a bit of genuine use in his ability to have foresights, she sent one of her envoys down into the void realm and got him to bring back this male. It did however cost her a valuable asset, as the envoy she sent was quickly corrupted without her blessing over her and she became sickly and weak because of it. It¡¯d take quite a long time for her to come back to her maximum potential, but as always, she had time. A lot of time.
¡°So, what do you plan on doing now?¡± That was the question Yue had to ask. After all, three terrestrial being just landed on Earth and was staying in her home, with the goal of ¡®sealing/killing a god¡¯, no way was she just going to sit idly by and be all cool about it. ¡°A-Ah, well¡­I¡¯ll probably do a little digging in the internet first. D-Do you have a computer and internet here?¡± Diana asked back, a fierce blush on her cheeks and her hips wiggling awkwardly. Her hands were tucked together, holding over her aching nether regions. She severely underestimated just how beastly Fyorei was in bed. Fyorei on the other hand was just grinning ear to ear, enjoying in the after-feel from that wonderful time in bed. And as the two who were left out, Anna and Yue could only look at them in confusion, but it didn¡¯t take long for Yue to put two and two together and blush at the thought. She¡¯s a pure cinnamon roll. Also, she didn¡¯t have any computers at her home, so she and her two friends were forced to go to an internet caf¨¦ down the road while Yue went for her school. They also got some pocket change for payment. Being the internet savant she was, Diana easily immersed herself back into the world of worldwide information. Fyorei was silently ¡®inspecting¡¯ one of the computers by breaking it apart away from prying eyes. Anna was just, there, watching her, almost eerily so. Actually, she was pretty sure she just saw a frown on her face, but it disappeared as quick as it came. That aside, she¡¯s still on work with her mission to find a god sealing/killing weapon/item. And you know? There¡¯s sooo many~¡­ There were so many to pick from, it wasn¡¯t even funny. Hell, even popular fictional ones set in Japan should actually exist, since enough mana has gathered due to the people¡¯s will and dreams. I mean, it¡¯d be pretty cool to find Enkidu and use him to chain down the gods. Gil would probably shimmer her alive tho¡­ Actually, wouldn¡¯t meeting Gil be, like, the best thing ever!? She fantasized in her head, her eyes glittering in delight as any Gil fangirl would be. She also didn¡¯t notice that Anna¡¯s frown had returned. A-Ah! But she was fretting over minor details! N-No getting side-tracked until she manages to return to her friends in the other world! Umu, she shall set her mind straight! So she proclaimed as she unconsciously played with the bangs of her hair. *¡­¡­¡­¡­¡­¡­* ¡°A-Ah, better get searching.¡± Somehow she had a very ominous stare at her back. Her hands swiftly placed back at the keyboard (and the attendant putting down the cup of tea she ordered earlier), she continued her dive into the web. And while all this was happening, no one even batted an eye to the dangers soon coming.
Japan¡¯s branch headquarters. It¡¯s like the clocktower from the Fate series, or a mini-sized academy city from the To Aru series, or any magic¡¯ association building from any modern fantasy setting. A place where the top mages gather to discuss matters the public cannot hear. And today was no different. Inside a room hidden from any prying eyes, a total of 7 people was sitting around a long table, some tense, some casual, one was sleeping, others were eating, all were very famous and were held as the 7 stars of Japan, the 7 strongest mages of this country. ¡°So, let me get this straight, a rift to the dimension of the gods have just been opened, and its causing all phantasmal beasts to evolve faster than ever recorded? Yeah, sure sherlock. What kind of bullsh*t is that, ha?!¡± A fairly young and handsome man shouted as he slammed his fists against the table, his blonde hair waving wildly as bursts of wind shot out, his anger practically oozing out into the atmosphere. ¡°Now, now. Keep your anger in check, Garou-san. We won¡¯t have enough budget to keep replacing the table every time you get angry. And I assure you, this information is correct, as much as I wish it wasn¡¯t.¡± A soft voice elegantly explained, belonging to another fairly handsome young man, with unnatural blue hair and a piercing gaze. His fingers were wrapped around a small spoon, gently swirling the tea it was placed in. Garou retracted his fists and huffed. He¡¯s gotten a lot of bullsh*t in his life, but this, this was just on another level of sh*ttery. A portal to a god¡¯s realm, sure, sure. ¡°Tch. Then what, Val? Sit back and watch?¡± Garou asked softly, a look of dim sadness flashed in his eyes as he stared at the one other member who was taking this seriously. Val held his chin and thought for a moment. ¡°We lack information, and as such, can¡¯t conceive a plan. That¡¯s what we need to solve first.¡± ¡°Yeah, no sh*t.¡± The meeting ended without any result, and all 7 mages split to continue whatever they were doing. Val went back to the hotel room he rented and sat down on his bed, his mind still deep in thoughts from the recent events. A huge surge of mana, a number of unidentified characters sudden appearing, a rift to the realm of the gods, an increase in phantasmal beasts. They were definitely connected in some way, but why? He had an odd feeling that humans, at least ones from Earth, weren¡¯t meant to be placed in that equation as well, but since all¡¯s happening on Earth, they¡¯re forced into the fray as well. How troublesome¡­
*HUUUAAA!!!* A terrific roar sounded through the air, shaking the many trees surrounding its source. There, a large lion-like beast with blue fur and black eyes could be seen. Its sharp claws were bright gold and a cloak of purple fire was surrounding its neck. ¡°Ha¡­Ha¡­Puh¡­That hurt.¡± Standing before it, Yue spat out some blood as she regained her footing, her waist shooting with pain from the recent strike she took. Her usual dignified demeanour was gone, replaced with a feral look of survival. -Rewinding a bit- After she let off Diana and her companions at an internet caf¨¦, she went off to deal with a phantasmal beast she heard about yesterday. They said that it was a lion-type, and had been killing anyone who had even come close to its domain. All seemed well and all, she was even about to kill it, but then, Just as she was about to deal the finishing blow, its eyes shined black as a burst of purple flames circled and enveloped the beast, before it reappeared, its appearance changed, its injuries healed, and its power far strengthened. But! As the prodigy of the Shizenso family, she would not back down! She controlled the roots underground using her magic and tied the beast down. Using the poison manufactured from countless plants, she was about to inject it into the beast, but it easily tore through the roots and slashed at her waist with its golden claws. Her quick reflex was the only thing that saved her from her death. Which brings her back to the present moment, with blood seeping into her skirt and her magic ineffective against it. A drop of sweat trailed down her cheeks as she prepared to move, her eyes never leaving it. Before suddenly, ¡°Kya!?¡± A bubble of green slime splashed onto her back, covering her with the gooey substance. She would¡¯ve shook it off at that moment, but for one, she was being carefully watched by that lion for any openings, and two, she was healing. ¡°Iya~, Yue, you¡¯re quite beat up, huh? Stand back, ¡®kay?¡± Suddenly, she heard a familiar voice from behind her. Turning to look, she saw Diana there, happily waving her hand at her as her two friends were walking behind her. ¡°Y-You¡­¡± ¡°Don¡¯t worry and watch. Big sis is here.¡± The cavalry has arrived. And what¡¯s with the big sis?